Application of Cpt1a gene in preparation of medicine for treating central nervous system injury

Abstract

The invention discloses application of a Cpt1a gene in preparation of a medicine for treating central nervous system injury. According to the invention, the expression of Cpt1a is gradually increased in sequencing data of cerebral cortical neurons of rats cultured for E18 days in vitro, 1 day after birth and 3 days after birth, and the expression of Cpt1a is found to have a trend of gradually increasing and then decreasing after spinal cord injury in transcriptome sequencing data of a spinal cord semi-transection model. Therefore, a substance for intervening Cpt1a expression can be designed according to the nucleotide sequence (CDS region) of Cpt1a, so as to treat central nervous system injury and promote nerve growth.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the application of Cpt1a gene in preparing a drug for treating central nervous system injury. Background Art

[0002] The axon regeneration capacity of adult central nervous system neurons is extremely limited, and severe damage usually leads to permanent functional loss, a typical example of which is paralysis caused by spinal cord injury. Currently, the efficacy of various treatments for nerve repair after spinal cord injury is unsatisfactory, so it is of great significance to find effective methods to treat spinal cord injury. Although the molecular mechanism of axon regeneration of central neurons has been explored in animal models, axon regeneration cannot be achieved clinically at present, so it is particularly important to conduct in-depth research on the basic biological processes that affect axon regeneration.

[0003] The nervous system is rich in lipids, and axon regeneration also requires a large amount of lipids to participate in the formation of cell membranes, but the effect of neuronal lipid metabolism on axon regeneration is still unclear. Carnitine palmitoyltransferase 1A (CPT1A) is a rate-limiting enzyme that mediates the transport of fatty acids to mitochondria for subsequent β-oxidation. Literature shows that the Cpt1a gene is involved in the epigenetic regulation of cancer-promoting survival, cell death escape, and tumor invasion pathways, but the specific role of the Cpt1a gene in neuronal axon growth is still unclear. Summary of the invention

[0004] The purpose of the present invention is to provide application of Cpt1a gene in screening or preparing drugs for treating central nervous system injury.

[0005] In the present invention, the nucleotide sequence (CDS region) of the Cpt1a gene is: Rattus norvegicuscarnitine palmitoyltransferase 1A (Cpt1a) mRNA (NCBI Reference Sequence: NM_031559.2).

[0006] The inventors found that the expression of Cpt1a gradually increased in the sequencing data of rat E18 days, 1 day after birth (P1) and 3 days (P3) cerebral cortical neurons (regeneration ability gradually weakened) in vitro, and found that the expression of Cpt1a gradually increased and then decreased after spinal cord injury in the transcriptome sequencing data of the spinal cord hemisection model. Therefore, substances (such as compounds, proteins, polypeptides, polysaccharides, glycoproteins, glycopeptides, nucleic acids) that intervene in the expression of Cpt1a can be designed according to the nucleotide sequence (CDS region) of Cpt1a to achieve the treatment of central nervous system damage and promote nerve growth. BRIEF DESCRIPTION OF THE DRAWINGS

[0007] Figure 1 The expression of Cpt1a during neuronal development (A) and spinal cord injury (B).

[0008] Figure 2 For PCR reaction program.

[0009] Figure 3 is the knockdown efficiency of Cpt1a siRNA in neurons (**p<0.01).

[0010] Figure 4 The results show the effect of Cpt1a siRNA treatment on neuronal axons. Figure A shows representative neuronal staining images after Cpt1a siRNA and Ctrl siRNA treatment, and Figure B shows the statistical graph of neuronal axon length (**p<0.01). DETAILED DESCRIPTION

[0011] The preferred embodiments of the present invention will be described in detail below in conjunction with examples. It should be understood that the following examples are provided only for the purpose of illustration and are not intended to limit the scope of the present invention. Those skilled in the art may make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0012] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0013] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0014] Example 1

[0015] Expression of Cpt1a gene during neuronal development and spinal cord injury

[0016] The inventors analyzed the sequencing data of rat cerebral cortical neurons (whose regeneration ability gradually weakened) cultured in vitro at E18, 1 day after birth (P1), and 3 days after birth (P3), and found that the expression of Cpt1a gradually increased ( Figure 1Middle A). We also analyzed the transcriptome sequencing data of the spinal cord hemisection model and found that Cpt1a expression gradually increased and then decreased after spinal cord injury ( Figure 1 (middle B).

[0017] Example 2

[0018] Functional validation of Cpt1a

[0019] 1. Primary Culture of Postnatal Day 1 (P1) Cortical Neurons

[0020] 1. Take P1 day red-skinned mice, disinfect the whole body with 75% alcohol, decapitate and cut open the brain, remove the cerebral cortex, and place the cerebral cortex in a medium dish with pre-cooled Hanks dissection solution (Biyuntian Company, Product No.: C0218; 2% penicillin-streptomycin + 2.5μg / mL amphotericin); peel off the membrane completely under a stereomicroscope, and place the peeled cerebral cortex tissue in a small dish with pre-added Hanks dissection solution.

[0021] 2. Place appropriate amount of cerebral cortex in 5 mL EP tubes, add 1 mL of pre-warmed 0.125% pancreatic enzyme, cut the cortical brain tissue with ophthalmic scissors, and digest at 37°C for 30 minutes.

[0022] 3. Add 2 mL of fresh DMEM / F12 complete medium to terminate digestion, blow evenly to form a single cell suspension, and pass the cell suspension through a 40 μm sieve (before sieving, moisten the reverse side of the medium after use).

[0023] 4. Centrifuge at 1200 rpm × 5 min to remove the supernatant, add 10 mL of DMEM / F12 complete medium to resuspend the cells and mix well.

[0024] 5. Take 1 mL of cell suspension into a new 15 mL centrifuge tube, add 9 mL of DMEM / F12 complete medium, mix well by pipetting, and take 10 μL of cell suspension for counting.

[0025] 6. Centrifuge at 1200 rpm for 5 min to remove the supernatant, add an appropriate volume of Neurobasal complete medium to resuspend the cells according to the cell concentration, and set the cell culture medium at 1×10 7 The cells were inoculated into 100 mm culture dishes and cultured in a 37°C, 5% CO2 incubator.

[0026] II. siRNA Electrotransfection of P1 Cortical Neurons

[0027] Count the P1 day cerebral cortical neurons from the original material, take a certain amount of cells and mix them with siRNA, mix them thoroughly, and make the final concentration reach 3.0×10 in 100 μL of the mixture per tube. 6Neuronal cells + 200 nM siRNA, wherein the cell volume is 90 μL and the siRNA volume is 10 μL. Then, the electrotransfection is performed according to the electrotransfection operation steps of NEPA21 (NEPAGENE) neuronal cells (275 V, 0.7 ms).

[0028] Cpt1a siRNA is as follows:

[0029] Justice chain:GGACAGCAGGCACAUUGUUTT

[0030] Antisense strand:AACAAUGUGCCUGCUGUCCTT

[0031] Ctrl siRNA:

[0032] Justice chain:UUCUCCGAACGUGUCACGUTT

[0033] Antisense strand: ACGUGACACGUUCGGAGAATT.

[0034] 3. Extraction of RNA from Neuronal Cells

[0035] RNA extraction was performed according to the instructions of the Coyoubo Cell RNA Rapid Extraction Kit (U10018A):

[0036] 1. Sample Lysis

[0037] 1) Aspirate the culture medium and wash once with an appropriate amount of PBS;

[0038] 2) Add 500 μL of Lysis Buffer and pipette or stir several times until the cells are completely lysed. Transfer to an EP tube and vortex for 10 seconds to fully lyse the cells;

[0039] 2. Column loading / RNA extraction

[0040] 1) Add an equal volume of anhydrous ethanol to the lysed cells and mix thoroughly (precipitation may occur, which is normal, just continue with the operation). You can invert the centrifuge tube vigorously several times, or pipette vigorously 10 times, and then transfer the liquid to the centrifuge column.

[0041] 2) Centrifuge at 4,000 g for 1 minute (equivalent to about 7,000 rpm. If there is still liquid remaining on the centrifuge column, increase the speed to 12,000 g).

[0042] 3. Column Cleaning

[0043] 1) Add 500 μL of Wash Buffer to the RNA column and centrifuge at 12,000 g for 1.5 minutes (be careful not to let the waste liquid in the collection tube contact the RNA column when removing the column after centrifugation to avoid contamination. You can pour out the waste liquid, put the RNA column back into the collection tube, and centrifuge the empty tube once to completely remove any residual Wash Buffer).

[0044] 2) Place the column in a clean 1.5 ml centrifuge tube free of RNase, open the cover and let it air dry for 2 minutes. This step is to completely remove the residual ethanol.

[0045] 4. RNA Elution

[0046] 1) Add 15-30 μL of Elution Buffer to the center of the RNA column membrane and let it stand at room temperature for 2 minutes.

[0047] 2) Centrifuge at 12,000g for 1 minute (add the eluted RNA solution back into the column, let it stand for 2 minutes, and centrifuge again to improve the elution efficiency and obtain more RNA). (After RNA is eluted, it is recommended to place it on ice.)

[0048] 3) Determine the concentration of the eluted RNA for subsequent experiments. The extracted RNA can be used immediately for subsequent experiments or stored at -80°C for later use. Detect the OD value and concentration of the RNA and store it at -80°C for later use.

[0049] 4. RNA Reverse Transcription to cDNA

[0050] 500 ng of RNA was reverse transcribed into cDNA using a reverse transcription kit (Vazyme R312-01). Operate on ice, 20 μL per reaction, as follows:

[0051]

[0052] The reaction procedure was: 37°C for 15 min, 85°C for 5 sec, and 4°C infinity.

[0053] 5. Real-time quantitative PCR (qRT-PCR)

[0054] The Cpt1a qRT-PCR primer sequences were designed according to the primer design principles, as follows:

[0055] Cpt1a qRT-PCR primers

[0056] Forward primer:ATTCCAGGAGAGTGCCAGGA

[0057] Reverse primer: GGATGAAGGCATCGGGACTC.

[0058] The cDNA obtained by reverse transcription reaction was diluted at 1:5 and subjected to the following qRT-PCR reaction.

[0059] (1) Prepare qRT-PCR reaction solution according to the following components:

[0060]

[0061] (2) Mix the reaction solution and set the Real-time PCR reaction program as follows: Figure 2 shown.

[0062] The results are as follows Figure 3 As shown, Cpt1a siRNA could significantly reduce the expression of Cpt1a in neurons after 24h of siRNA treatment, **p<0.01.

[0063] VI. Neuronal Immunohistochemistry and Axon Length Measurement

[0064] Place the slide in a 24-well plate, coat with poly-lysine at 4°C overnight, wash three times with deionized water, and irradiate with UV light for 30 minutes before use. Culture the electroporated neuronal cells on the slide with moderate and uniform density. Wash once with rewarmed PBS after 48 hours, then fix the neuronal cells with 4% paraformaldehyde for 30 minutes, and wash three times with PBS, each time for 5 minutes. Block with cell blocking solution (rewarmed in advance, 300μL per well) at 37°C for 1 hour; add primary antibody (TUJ1, 1:1000) at 4°C overnight. Take the culture dish out of the refrigerator the next day, recover the primary antibody and wash with PBS for more than 3 times, each time for 5 minutes. Incubate the corresponding secondary antibody for 2 hours in the dark, then use Hoechst to stain the nucleus for 15 minutes, wash three times with PBS, and take pictures after sealing. The length of neuronal axons was measured using Image J software.

[0065] The results are as follows Figure 4 As shown, compared with the control group, Cpt1a siRNA treatment for 48 hours can significantly promote the growth of axons of cortical neurons at P1 day, **p<0.01.

Claims

1. Application of Cpt1a gene in the preparation of diagnostic reagents for central nervous system injury.

2. The use according to claim 1, characterized in that: The diagnostic reagent includes a primer pair for detecting the Cpt1a gene.

3. Use of Cpt1a gene inhibitors in the preparation of drugs for treating central nervous system damage and / or promoting nerve growth.

4. The use according to claim 3, characterized in that: The Cpt1a gene inhibitor is one or more of small molecule compounds, proteins, polypeptides, polysaccharides, glycoproteins, glycopeptides or nucleic acids.

5. The use according to claim 4, characterized in that The nucleic acid is siRNA, and the sequence of the siRNA is as follows: Justice chain: GGACAGCAGGCACAUUGUUTT Antisense strand: AACAAUGUGCCUGCUGUCCTT.

Images