Engineering bacterium preparation based on aerosol inhalation as well as preparation method and application thereof

Abstract

The invention discloses an engineering bacterium preparation based on aerosol inhalation as well as a preparation method and application thereof, and relates to the technical field of engineering bacteria. The system is composed of engineering bacteria-calcium alginate-chitosan core-shell microspheres, the engineering bacterium contains an immune checkpoint inhibitor anti-PD-L1nanobody plasmid, an anti-inflammatory cytokine IL-10 plasmid and a genome integration synchronous splitting circuit, and is characterized in that the immune checkpoint inhibitor anti-PD-L1nanobody plasmid and the anti-inflammatory cytokine IL-10 plasmid are separated from each other; the nucleic acid sequence of the immune checkpoint inhibitor anti-PD-L1nanobody is as shown in SEQ ID No. 1, and the nucleic acid sequence of the immune checkpoint inhibitor anti-PD-L1nanobody is as shown in SEQ ID No. 2. The nucleic acid sequence of the anti-inflammatory cytokine IL-10 is as shown in SEQ ID No. 2. According to the invention, local delivery of lungs can be realized, accurate release of active molecules in an exogenous engineering bacterium drug is realized by utilizing synchronous cracking of engineering bacteria, and further alleviation and treatment of lung diseases are realized.

Description

Technical Field

[0001] The present invention relates to the technical field of engineered bacteria, and more specifically to an engineered bacteria preparation based on atomization inhalation and a preparation method and application thereof. Background Art

[0002] At present, with the continuous breakthroughs in the research and clinical application of microbial tumor prevention and treatment, important progress has been made in engineered microbial preparations that can predict host immune responses using synthetic biology technology. Studies have reported that the use of engineered bacteria to convert tumor metabolites (NH3) into L-arginine (L-Arg), and high concentrations of L-Arg in the local tumor can enhance the efficiency of immunotherapy with anti-programmed death ligand 1 (anti-PD-L1) drugs, effectively avoiding the dose toxicity of oral or intravenous L-Arg. In addition, China Zhiyi Bio's pipeline SK08 (a live biological drug developed based on Bacteroides fragilis) combined with anti-programmed death receptor 1 / programmed death ligand 1 (anti-PD-1 / L1) monoclonal antibodies for the treatment of advanced solid tumors is also undergoing clinical trials in China.

[0003] Functionally customized engineered bacteria active biological drugs that are decomposed, designed, assembled, and constructed using top-down genetic engineering technology. On the one hand, the engineered bacteria themselves carry inherent immunogenic molecules such as lipopolysaccharide and peptidoglycan; on the other hand, the engineered bacteria can express cytokines (such as interleukin, IL-12), cytotoxic factors (such as tumor necrosis factor-related apoptosis-inducing ligand, TRAIL), anti-tumor proteins (such as azurin, Laz), prodrug enzymes (such as cytosine deaminase) and siRNA (such as siPD-1RNA), etc., targeting specific steps of anti-tumor acquired immune response, thereby producing synergistic effects with inherent immune activation and reshaping the tumor immune microenvironment, thereby improving the anti-tumor efficacy of engineered bacteria. Although the coordinated delivery of immune checkpoint inhibitors and anti-inflammatory cytokines by engineered bacteria can increase the anti-tumor effect, the nonspecific colonization of other tissues or organs after intravenous administration of engineered bacteria can induce systemic immunotherapy-related adverse reactions (irAEs), leading to chronic damage, functional impairment, or even functional loss of various organs, affecting patient prognosis.

[0004] Therefore, providing an engineered bacteria delivery system for a non-intravenous administration route is an urgent problem to be solved by those skilled in the art. Summary of the invention

[0005] In view of this, the present invention provides an engineered bacteria preparation based on atomization inhalation and a preparation method and application thereof.

[0006] In order to achieve the above object, the present invention adopts the following technical solution:

[0007] An engineered bacteria preparation based on aerosol inhalation, wherein the system is engineered bacteria-calcium alginate-chitosan core-shell microspheres;

[0008] The engineered bacteria contain an immune checkpoint inhibitor anti-PD-L1 nanobody plasmid and an anti-inflammatory cytokine IL-10 plasmid, and the genome of the engineered bacteria is integrated with a synchronous cleavage loop SLIC gene;

[0009] The immune checkpoint inhibitor anti-PD-L1 nanobody nucleic acid sequence is shown in SEQ ID No. 1;

[0010] The anti-inflammatory cytokine IL-10 nucleic acid sequence is shown in SEQ ID No.2.

[0011] Furthermore, the core-shell microspheres are engineered bacteria-calcium alginate microspheres with a single chitosan coating on the surface; the engineered bacteria-calcium alginate microspheres are engineered bacteria with a single calcium alginate coating on the surface.

[0012] Further, the immune checkpoint inhibitor anti-PD-L1nanobody plasmid is p15A-J23119-anti-PD-L1nanobody, including the constitutive promoter J23119 and the immune checkpoint inhibitor anti-PD-L1nanobody gene;

[0013] The anti-inflammatory cytokine IL-10 plasmid is pRSF-J23119-IL-10, which includes a constitutive promoter J23119 and an anti-inflammatory cytokine IL-10 gene.

[0014] Furthermore, the method for integrating the synchronous lysis circuit SLIC gene into the genome of the engineered bacteria is:

[0015] The SLIC gene fragment of the pTD103luxI_sfGFP plasmid that performs the lysis function is integrated into the cagA site of the engineering bacteria, and the SLIC gene fragment of the pTD103aiiA(Cm) plasmid that performs the lysis function is integrated into the fhlA site of the engineering bacteria;

[0016] The pTD103luxI_sfGFP plasmid performs the SLIC gene of the lysis function, and the nucleic acid sequence is shown in SEQ ID No.3;

[0017] The pTD103aiiA (Cm) plasmid has a SLIC gene that performs lysis function, and its nucleic acid sequence is shown in SEQ ID No.4.

[0018] A method for preparing an engineered bacteria preparation based on atomization inhalation comprises the following steps:

[0019] 1) The suicide plasmid pRE112 was introduced into the wild-type E. coli EcN, and the two cryptic plasmids pMUT1 and pMUT2 in EcN were knocked out to obtain the E. coli EcNΔΔ strain; the red homologous recombination technology was used to transform EcNΔΔ, and the synchronous lysis circuit SLIC gene was integrated into the genome to construct the chassis strain EcN SLIC with a synchronous lysis cycle;

[0020] 2) The vectors p15A and pRSF were linearized by PCR technology, avoiding the original promoter region; the anti-PD-L1 nanobody fragment was connected to the p15A vector by homologous recombination to construct the plasmid p15A-J23119-anti-PD-L1 nanobody; the IL-10 fragment was connected to the pRSF vector to construct the plasmid pRSF-J23119-IL-10;

[0021] 3) Using E. coli DH5α strain as host for plasmid construction and amplification, and using EcNΔΔSLIC strain as host for functional characterization, we obtained the engineered bacteria EcN SLIC that produces anti-PD-L1 nanobody and IL-10;

[0022] 4) Using microfluidic equipment to mass produce engineered bacterial gel micro-nano particles:

[0023] The mixed solution of engineered bacteria EcN SLIC and alginate was used as the internal phase, and the ratio of CFU:m / v in the internal phase was 1.0·10 8 : 1%; calcium chloride solution is used as the external phase to prepare gel single-coated engineered bacteria particles, and the concentration of calcium chloride in the external phase is 5%;

[0024] The two-component microspheres were synthesized by a homemade microfluidic device. The device was controlled by two injection pumps, which injected the external phase fluid and the internal phase fluid respectively, so that the external phase fluid sheared the internal phase fluid. The flow rate of the internal phase injection pump was 40 μL / min, and the flow rate of the external phase injection pump was 1600 μL / min, and the engineered bacteria-calcium alginate microspheres were prepared.

[0025] The engineered bacteria-calcium alginate microspheres were placed in a 0.5% chitosan solution and slowly stirred, wherein the ratio of the engineered bacteria-calcium alginate microspheres to the chitosan solution was m:v=1 mg:4 mL, to prepare single-coated engineered bacteria-calcium alginate-chitosan core-shell microspheres;

[0026] 5) The engineered bacteria-calcium alginate-chitosan core-shell microspheres are freeze-dried to a water content of 4%, dispersed in physiological saline, and atomized into aerosol particles to achieve respiratory drug delivery function.

[0027] 6. The method for preparing an engineered bacteria preparation based on atomization inhalation according to claim 5 is characterized in that the freeze-drying process in step 5) is to adjust and set the gradient freeze-drying program of the freeze dryer, the gradient freeze-drying temperature program is 0°C, -20°C, -40°C, and the gradient freeze-drying time is 30min, 120min, and 360min.

[0028] Furthermore, the diameter of the engineered bacteria-calcium alginate-chitosan core-shell microspheres is 3-6 μm.

[0029] The invention discloses an application of an engineered bacteria preparation based on aerosol inhalation in the preparation of anti-tumor drugs.

[0030] It can be seen from the above technical solution that, compared with the prior art, the beneficial effects of the present invention are:

[0031] 1. The local lung delivery system based on engineered bacteria inhaled through the respiratory tract of the present invention is an engineered bacteria-calcium alginate-chitosan core-shell microsphere with uniform morphology and good dispersibility. It can achieve local lung delivery and release engineered bacteria drugs at the same time. It uses "engineered bacteria synchronous lysis" to achieve the precise release of active molecules in exogenous engineered bacteria drugs, further achieving the relief and treatment of lung diseases.

[0032] 2. The system of the present invention is expected to achieve targeted and effective colonization of exogenous engineered bacteria drugs in the host lungs through respiratory inhalation of engineered bacteria-calcium alginate-chitosan core-shell microspheres, local delivery, precise colonization in lesion sites, and coordinated response of the lung mucosal immune system, and further realize the temporal and spatial precision of engineered bacteria drugs in exerting immune regulation, thereby achieving the prevention of recurrence of lung diseases, in situ treatment and inhibition of the course of the disease to the greatest extent.

[0033] 3. The present invention is based on the local lung delivery system of engineered bacteria inhaled through the respiratory tract, and achieves the prevention of recurrence, in situ treatment and disease course inhibition of exogenous engineered bacteria drugs for lung diseases through local positioning, precise lysis and coordinated response of the lung mucosal immune system. The present invention innovatively integrates "synthetic biology-gel polymerization technology" and develops a new strategy that can achieve targeted and effective colonization of exogenous engineered bacteria drugs in the host lungs. On this basis, the secretion of synergistic therapeutic factors by engineered bacteria is precisely regulated to activate lung mucosal immunity.

[0034] 4. The engineered bacteria-calcium alginate-chitosan core-shell microsphere delivery system of the present invention can realize intelligent, precise, visualized and non-invasive efficient delivery of exogenous engineered bacteria drugs; it utilizes "atomization inhalation technology" to deliver exogenous engineered bacteria, realizes local delivery of exogenous engineered bacteria drugs in the host's lungs, realizes targeted colonization of engineered bacteria drugs in lesions, and further synergistically realizes the spatiotemporal precision of exogenous engineered bacteria drugs in exerting immune regulation. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0036] Figure 1 The plasmid p15A-J23119-anti-PD-L1 nanobody map for producing the immune checkpoint inhibitor anti-PD-L1 nanobody in the present invention;

[0037] Figure 2 The map of the plasmid pRSF-J23119-IL-10 for producing the anti-inflammatory cytokine IL-10 in the present invention;

[0038] Figure 3 This is a verification diagram of the production of anti-PD-L1 nanobody by the engineered bacteria EcN SLIC in the present invention;

[0039] Figure 4 This is a verification diagram of the production of IL-10 by the engineered bacteria EcN SLIC in the present invention;

[0040] Figure 5 The figure is a process diagram for preparing the engineering bacteria-calcium alginate-chitosan core-shell microsphere atomization preparation of the present invention;

[0041] Figure 6 This is a stability verification diagram of the engineered bacteria-calcium alginate-chitosan core-shell microspheres of the present invention;

[0042] Figure 7 This is a graph verifying the survival rate of the engineered bacteria in the engineered bacteria-calcium alginate-chitosan core-shell microspheres of the present invention;

[0043] Figure 8 This is a diagram for verifying the lung retention efficiency of the engineered bacteria-calcium alginate-chitosan core-shell microspheres of the present invention;

[0044] Figure 9 The data are the blood routine data of mice in the animal experiment of the present invention. DETAILED DESCRIPTION

[0045] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0046] Example 1

[0047] Construction of a strain for synchronous lysis and release of anti-PD-L1 nanobody and IL-10:

[0048] Anti-PD-L1 nanobody and IL-10 gene sequences were synthesized by GENEWIZ, Inc. (Suzhou, China).

[0049] Anti-PD-L1 nanobody nucleic acid sequence (372 bp), as shown in SEQ ID No. 1:

[0050] ATGGCGCAAGTGCAGTTAGTGGAAACCGGCGGTGGCTTAGTGCAGCCGGGCGGTAGCCTGCGCCTGAGCTGCACCGCGAGCGGCTTTACCTTTAGCATGCATGCGATGACCTGGTATCGCCAAGCGCCGGGCAAACAGCGCGAACTGGTGGCGGTGATTACGAGCCATGGCGATCGCGCGAACTAT ACCGATAGCGTGCGCGGCCGCTTTACCATTAGCCGCGATAACACCAAAAACATGGTGTATCTGCAGATGAACAGCCTGAAACCGGAAGATACCGCGGTGTATTATTGCAACGTGCCGCGCTATGATAGCTGGGGCCAAGGCACCCAAGTGACCGTGAGCAGCGGCGGCCTGCCGGAAACGGGCGGC;

[0051] IL-10 nucleic acid sequence (480 bp), as shown in SEQ ID No. 2:

[0052] AGCAGGGGCCAGTACAGCCGGGAAGACAATAACTGCACCCACTTCCCAGTCGGCCAGAGCCACATGCTCCTAGAGCTGCGGACTGCCTTCAGCCAGGTGAAGACTTTCTTTCAAACAAAGGACCAGCTGGACAACATACTGCTAACCGACTCCTTAATGCAGGACTTTAAGGGTTACTTGGGTTGCCAAGCCTTATCGGAAATGATCCAGTTTTACCTGGTAGAAGTGATGCCCCAGGCA GAGAAGCATGGCCCAGAAATCAAGGAGCATTTGAATTCCCTGGGTGAGAAGCTGAAGACCCTCAGGATGCGGCTGAGGCGCTGTCATCGATTTCTCCCCTGTGAAAATAAGAGCAAGGCAGTGGAGCAGGTGAAGAGTGATTTTAATAAGCTCCAAGACCAAGGTGTCTACAAGGCCATGAATGAATTTGACATCTTCATCAACTGCATAGAAGCATACATGATGATCAAAATGAAAAGC;

[0053] The vectors p15A and pRSF were linearized by PCR technology, and the original promoter region was avoided. The anti-PD-L1 nanobody fragment was connected to the p15A vector by homologous recombination to construct the plasmid p15A-J23119-anti-PD-L1 nanobody (see Figure 1 ), containing the constitutive promoter J23119 and the immune checkpoint inhibitor anti-PD-L1 nanobody; the IL-10 fragment was connected to the pRSF vector to construct the plasmid pRSF-J23119-IL-10 (see Figure 2 ), containing the constitutive promoter J23119 and the anti-inflammatory cytokine IL-10.

[0054] Transform the DH5α competent strain and sequence to obtain the recombinant positive plasmid. On this basis, construct an engineering strain containing anti-PD-L1 nanobody and IL-10. The transformation steps and experimental conditions are as follows:

[0055] (1) Add 5 μL of p15A-J23119-anti-PD-L1 nanobody plasmid and 5 μL of pRSF-J23119-IL-10 plasmid mixture to 100 μL of E. coli competent cells, mix gently, and incubate on ice for 30 min;

[0056] (2) Heat shock the centrifuge tube containing the above mixture in a 42°C water bath for 90 seconds and then immediately incubate on ice for 2 minutes;

[0057] (3) Add 500 μL LB incubation liquid medium and incubate at 37°C in a shaker at 120 rpm / min for 1 h;

[0058] (4) centrifuging the incubated E. coli at 4000 rpm / min for 3 min;

[0059] (5) Discard the supernatant, retain 50 μL LB liquid culture medium, spread the bacterial solution on LB resistance solid plates, and culture at 37°C overnight to obtain the engineered bacteria EcN SLIC that produces anti-PD-L1 nanobody and IL-10.

[0060] Wild-type Escherichia coli Nissle 1917 (EcN) contains two cryptic plasmids, pMUT1 and pMUT2. The cryptic plasmids in EcN were knocked out by introducing the suicide plasmid pRE112 to obtain the Escherichia coli Nissle 1917ΔΔ (EcNΔΔ) strain, which is convenient for the introduction of subsequent functional plasmids. Next, red homologous recombination technology was used to transform EcNΔΔ, and the genome was integrated with the synchronized lysis circuit (SLIC) (source: pTD103luxI_sfGFP, ADDGENE Plasmid#48885 and pTD103aiiA (Cm), ADDGENE Plasmid#48886) gene to construct a chassis strain with a synchronized lysis cycle (EcNΔΔSLIC).

[0061] The gene fragment that performs the cleavage function in the pTD103luxI_sfGFP plasmid is integrated into the cagA site of EcNΔΔ, and the gene fragment that performs the cleavage function in the pTD103aiiA(Cm) plasmid is integrated into the fhlA site of EcNΔΔ.

[0062] The genomic integration fragments are as follows (the underlined parts are homology arms, the italic parts are resistance genes, and the bold parts are target genes that perform cleavage functions):

[0063] The gene fragment that performs the cleavage function in the pTD103luxI_sfGFP plasmid is integrated into the cagA site of EcNΔΔ, wherein the SLIC gene (6052 bp) that performs the cleavage function in the pTD103luxI_sfGFP plasmid is shown in SEQ ID No. 3:

[0064] caacatgaaaaacaaattgttatttatgatgttaacaatactgggtgcgcctgggattgcagccgcag caggttatgatttagctaattcagaatataactttgcggtaaatgaattgagtaagtcttcatttaatcaggcagc cataattggtcaagctgggactaataatagtgctcagttacggcagggaggctcaaaacttttgacggttgttgcgcaagaaggtagtagcaactgggcaaagattgatcagacaggagattataaccttgcatatattgatcaggcgggca gtgccaacgatgccagtatttcgcaaggtgcttatggtaatactgcgatgattatccagaaaggttctggtaataa agcaaatattacacagtatggtactcaaaaaacggcaattgtagtgcagagacagtcgcaaatggctattcgcgtg acacaacgttaatttccattcgacttttaaatcaatccgatgggggttttactacatcatcagtatgaaagaaacagggcgcaagccctgttttttttcgggagaagaatatgaat gcgttattactccttgcggcactttccagtcagataacctttaatacgacccagcaaggggatatgtacaccatta ttcctgaagtcactcttactcaatcttgtctgtgcagagtacaaatattgtccctgcgcgaaggcagttcagggca aagtcagacgaagcaagaaaagaccctctcattgcctgctaatcaacccattgctttgacgaagttgagtttaaat atttccccggacgatcgggtgaaaatagttgttactgtttctgatggacagtcacttcatttatcacaacaatggc tgccctcttcagaaaagtcttaatttgttgaaatatcgagcataagatgaacctggagagaatggtctgctgcgaa tcagccaacctgaaagtatggataacacaaccctcaaggatgattaatcattgagg;

[0065] The gene fragment that performs the cleavage function in the pTD103aiiA (Cm) plasmid is integrated into the fhlA site of EcNΔΔ, wherein the SLIC gene (4032 bp) that performs the cleavage function in the pTD103aiiA (Cm) plasmid is shown in SEQ ID No. 4:

[0066] Ggtggcgctttcggggtattggcgtttgccggaatatccagcggacggctgccggaaaattcaattgc gccaaacgggcaggcgataccacacagtttgcagcttacgcacagactttcattcaactgcacagcaccatcaaca cgagtgatggcgttaaccgggcagaccaccgcgcagggtgcatcttcacagtgatgacagagctgcggcgcagatt ctttttcatttagcatcactcgcaggcgcggcattgattgcaggccgtgctggcgatgcgtctctgaacaggcagc ctcacaagtgtggcagccgatacagagcgtggagtcagcaattacaaaacgattcaccaggcattcctcaggtgat tgtcatttttgacgaaaacatgccgatgaaatgtcattttcgacactcatcgacacgcccatccccaaacaggcgt aacgcctgcaaaacgggcaaagcctcagc

[0067] tgcaaaactaagcattccgaagccattgttagccgtatgaatagggaaactaaacccagtgataagacctgat

[0068] gttttcgcttctttaattacatttggagattttttatttacagcattgttttcaaatatattccaattaattggtgaatg

[0069] attggagttagaataatctactataggatcatattttattaaattagcgtcatcataatattgcctccattttttagg

[0070] gtaattatctagaattgaaatatcagatttaaccatagaatgaggataaatgatcgcgagtaaataatattcaca

[0071] atgtaccattttagtcatatcagataagcattgattaatatcattattgcttctacaagctttaattttattaattatc

[0072] tgtatgtgtcgtcggcatttatgtttttcatacccatctctttatccttacctattgtttgtcgcaagttttgcgtgttat

[0073] atatcattaaaacggtaatggattgacatttgattctaataaattggatttttgtcacactattgtatcgctgggaa

[0074] tacaattacttaacataagcacctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaatgaa

[0075] ttcattaaagaggagaaaggtaccatgacagtaaagaaactttatttcatcccagcaggtcgttgcatgttggat

[0076] cattcgtctgttaacagtgcgttaacaccggggaaactattaaacttgccggtgtggtgttatcttttggacgg

[0077] aagaaggtcctattttaggacaggtatgccagaaagtgcagttaataatgaagggctttttaacggtaca

[0078] tttgttgaaggacagatcttaccgaaaatgactgaagagatagaatcgtgaatattaaagcgtgtagggta

[0079] tgagccggacgaccttttatatattagttctcacttacattttgatcatgcaggaggaaacggtgctttacaa

[0080] atacaccaattattgtgcagcgaacggaatatgaggcagcacttcatagagaagaatatatgaaagaatgtat

[0081] attaccgcatttgaactacaaaattattgaaggggattatgaagtggtaccaggtgttcaattattgtatacgcca

[0082] ggtcattctccaggccatcagtcgctattcattgagacggagcaatccggttcagttttataacgattgatgcat

[0083] cgtacacgaaagagaatttgaagatgaagtgccgttcgcaggatttgatccagaattagctttatcttcaatta

[0084] aacgtttaaaagaagttgaaaaaagaaaccaatttattctttggtcatgatatagagcaggaaaagagt

[0085] tgtaggtgttcccggaatatagcagcgaacgacgaaaattacgcccttgcagcgtaacgcgtgcttag

[0086] gcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc

[0087] ctgagtaggacaaaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggattta

[0088] tttattctgcgaagtgatcttccgtcacaggtaggcgcgccgaagttcctatactttcttagagaataggaacttcggaata

[0089] ggaactaaggaggatattcatatggaccatggctaattcccatgtcagccgttaagtgttcctgt tgt caggttacccgttt

[0090] aacagagatgccagctttaagcattttctgtgccaacttttaattcattgttattaaagcgatttcta agctaaagatgaatttc

[0091] gtcgccgtgtcgacgtgtcatttcgacatcatcgacattattcaccgcagggataatcaacactggca caattattgcttgt

[0092] agctggcaatagttaatgggaggcgatatgcacgaaataaccctctgccaacgggcactggaattgat cgaacagca

[0093] ggccgcaaaacacggcgcaaaacgcgtaactggggtctggctcaaaattggcgcattttcttgtgtcg aaaccagctc

[0094] tcttgccttttgttttgatctggtttgccgcggcagcgtggcggaaggttgtaaactgcacctcgaag aacaagaggccg

[0095] aatgctggtgtgaaacatgccaacagtatgtgacgctactgacccagcgcgtccgccgctgtccactg tgtcatggtga

[0096] ca;

[0097] The Escherichia coli DH5α strain was used as the host for plasmid construction and amplification, and the EcNΔΔSLIC strain was used as the host for functional characterization, and the engineered bacteria EcN SLIC that produces anti-PD-L1 nanobody and IL-10 were obtained.

[0098] Example 2

[0099] Preparation of engineered bacteria-calcium alginate-chitosan core-shell microspheres:

[0100] Microfluidic devices were used to batch produce engineered bacteria gel micro-nano particles, in which a mixed solution of engineered bacteria alginate with synchronous lysis and release of anti-PD-L1 nanobody and IL-10 was used as the internal phase, and the ratio of CFU: m / v of the internal phase was 1.0·10 8 : 1%; calcium chloride solution is used as the external phase to prepare gel single-coated engineered bacteria particles, and the concentration of calcium chloride in the external phase is 5%. A homemade microfluidic device is used to synthesize two-component microspheres, which is controlled by two injection pumps. Generally, under the shear force of the external phase fluid shearing the internal phase fluid, the internal phase prepolymer forms uniform microdroplets. The flow rate of the internal phase injection pump is 40μL / min, and the flow rate of the external phase injection pump is 1600μL / min, and micron-sized calcium alginate micro-nano particles are prepared.

[0101] 1 mg wet weight of engineered bacteria-calcium alginate microspheres (negative charge) were placed in 4 mL of 0.5% chitosan solution (positive charge) and slowly stirred to obtain single-coated engineered bacteria two-component micro-nano gel particles based on the principle of electrostatic adsorption.

[0102] Example 3

[0103] Construct a local lung delivery system based on respiratory inhalation of engineered bacteria: adjust the settings of the freeze dryer (cap-type freeze dryer, SCIENTZ-50F / B) with a gradient freeze-drying program of 0°C, -20°C, -40°C, and a gradient freeze-drying time of 30min, 120min, and 360min; obtain freeze-dried engineered bacteria particles with a water content of approximately 4%; when inhaled through the respiratory tract, disperse the freeze-dried powder in physiological saline, and improve the commercial nebulizer (Jia Ruikang, JLN-2311HDD) to obtain an engineered bacteria gel micro-nano particle aerosol suitable for inhalation by small animals.

[0104] The functional experimental techniques for evaluating the p15A-J23119-anti-PD-L1 nanobody and pRSF-J23119-IL-10 plasmids prepared by the present invention are as follows:

[0105] The recombinant positive plasmids p15A-J23119-anti-PD-L1nanobody and pRSF-J23119-IL-10 were chemically transformed into Escherichia coli Nissle 1917ΔΔSLIC to obtain an engineered strain. The engineered strain containing p15A-J23119-anti-PD-L1nanobody and pRSF-J23119-IL-10 plasmids was inoculated into LB medium at a ratio of 1:100 and cultured to the logarithmic phase (OD 600 = 0.5). Elisa was used to detect the biological activity of anti-PD-L1nanobody and IL-10 proteins. The secretion of anti-PD-L1nanobody was relatively stable and reached 600pg / mL after 12h of culture. The secretion of IL-10 was relatively stable and reached 2500pg / mL after 12h of culture. The results are shown in Figure 3 and Figure 4 .

[0106] The experimental techniques for evaluating the in vitro stability and safety of the engineered bacteria-calcium alginate-chitosan core-shell microspheres prepared by the present invention are as follows:

[0107] Microfluidic equipment was used to batch produce engineered bacteria gel micro-nano particles, in which a mixed solution of engineered bacteria alginate with synchronous lysis release of anti-PD-L1 nanobody and IL-10 was used as the inner phase and a calcium chloride solution was used as the outer phase to prepare gel single-coated engineered bacteria particles. Next, the engineered bacteria gel micro-nano particle freeze-dried powder was obtained using gradient freeze-drying technology. When inhaled through the respiratory tract, the freeze-dried powder was dispersed in physiological saline to obtain an aerosol of engineered bacteria gel micro-nano particles. The results are shown in Figure 5 .

[0108] EcN (control), EcNΔΔ, EcNΔΔSLIC or EcN SLIC" strains were inoculated into the culture medium to determine the bacterial lysis cycle. 1000 μL of overnight activated bacterial culture was inoculated into a conical flask containing 100 mL of culture medium and cultured at 37°C for 24 h. 100 μL of bacterial suspension was taken at 0, 1, 2, 3, 4, 5, ..., 19, 20, 21, 22, 23, and 24 h, respectively. After centrifugation at 8000 rpm / min for 1 min, the supernatant was removed and the precipitate was washed with 100 μL of After resuspending in PBS, the concentration of the bacterial solution (OD value) was measured at a wavelength of 600nm, and the fluorescence intensity of the bacterial solution (FI value) was measured at a wavelength of 488nm. A set of FI / OD values ​​measured and their corresponding culture time were plotted to draw the lysis cycle of the bacteria. The lung was simulated in vitro, and the optimized engineered bacteria-calcium alginate-chitosan core-shell microspheres were placed in PBS and lung leaching solution respectively. The morphology of the two-component microspheres before and after was observed by fluorescence microscopy, and the results are shown in Figure 6From the bright field, the morphology of the microspheres placed in PBS buffer did not change. From the bright field, the morphology of the microspheres placed in lung leaching fluid did not change either.

[0109] The experimental technique for evaluating the survival rate of the freeze-dried atomized inhalation engineered bacteria-calcium alginate-chitosan core-shell microsphere engineered bacteria prepared by the present invention is as follows:

[0110] The prepared engineered bacteria freeze-dried preparation was placed in the culture medium and gently incubated at 37°C. 50 μL of samples were taken at 0, 1, 2, 3, 4, 5, and 6 hours, and the bacteria were washed with fresh culture medium and spread on a solid culture dish containing the corresponding antibiotics. After incubation at 37°C for 12 hours, the colonies were counted to obtain the survival rate of the freeze-dried engineered bacteria. The results are shown in Figure 7 After the freeze-dried bacteria were activated, the concentration of the bacterial solution (OD value) was measured at a wavelength of 600nm, and the fluorescence intensity of the bacterial solution (FI value) was measured at a wavelength of 488nm. A set of FI / OD values ​​measured and their corresponding culture time were plotted to draw the lysis cycle of the bacteria. Elisa quantitatively analyzed the expression of anti-PD-L1 nanobody and IL-10 to verify the growth activity and stability of the freeze-dried engineered bacteria. The results are shown in Figure 7 .

[0111] The animal experiment technique for evaluating the freeze-dried atomized inhalation engineered bacteria-calcium alginate-chitosan core-shell microsphere engineered bacteria prepared by the present invention is as follows:

[0112] Mice: 24 healthy male C57BL / 6J mice aged 8 weeks were selected and purchased from Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd. Experimental groups: Mice were randomly divided into 3 groups, 8 in each group. Control group, nebulization inhalation group, and intravenous injection group. Animal experiments were carried out in the Animal Experiment Center of Xuzhou Medical University. All mice were raised in a room with strictly controlled light and dark cycles (lights on at ZT7 and lights off at ZT19) and had free access to water.

[0113] Control group: mice were not treated with any treatment.

[0114] In the aerosol inhalation group, 2 g of engineered bacteria freeze-dried powder (the number of active engineered bacteria was 1.0·10 8 / g) was placed in a commercial atomizer (Jiaruikang, JLN-2311HDD). After the modified atomizer nozzle sprayed dense atomized particles, the atomizer nozzle was worn in the mouse nasal cavity for atomization administration of the engineered bacteria freeze-dried powder. The administration interval was 48h, and the administration was continued for 6 times. After feeding for 2 weeks, the mice were killed with sodium pentobarbital. The engineered bacteria in the atomization inhalation administration group were from the engineered bacteria freeze-dried powder prepared in Example 3, specifically EcN SLIC "single-coated calcium alginate-chitosan coating.

[0115] Intravenous injection group: The number of engineered bacteria was normalized during intravenous injection.8 The engineered bacteria of CFU were administered at an interval of 48h for a total of 6 times. After 2 weeks of feeding, the mice were killed with sodium pentobarbital. The engineered bacteria of the intravenous administration group were from the engineered bacteria EcN SLIC in Example 1.

[0116] After aerosol inhalation, the distribution of engineered bacterial microspheres in the heart, liver, spleen, lungs, and kidneys was observed according to the groups. Figure 8 :The engineered bacteria microspheres were significantly enriched in the lungs. After about 240 minutes of aerosol inhalation, the abundance of engineered bacteria in the lungs reached a peak, and then gradually decreased. The engineered bacteria gradually completed metabolism in the lungs over time, with no obvious cytotoxicity. Then, after the above-mentioned administration operation, the mice were continued to be fed for 2 days, that is, after 2 weeks of feeding, the mice were killed with sodium pentobarbital, and then the eyeball blood of the mice in each group was taken for blood routine blood cell count analysis. The blood routine data of mice can be found in Fig. 9 It can be seen that in the peripheral blood, the engineered bacteria can cause host immune response after intravenous injection, and the number of white blood cells increased significantly, while the nebulized inhalation group did not induce systemic immunotherapy-related adverse reactions.

[0117] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. An engineered bacteria preparation based on aerosol inhalation, characterized in that: The system is engineered bacteria-calcium alginate-chitosan core-shell microspheres; The engineered bacteria contain an immune checkpoint inhibitor anti-PD-L1 nanobody plasmid and an anti-inflammatory cytokine IL-10 plasmid, and the genome of the engineered bacteria is integrated with a synchronous cleavage circuit SLIC gene; The immune checkpoint inhibitor anti-PD-L1 nanobody nucleic acid sequence is shown in SEQ ID No. 1; The anti-inflammatory cytokine IL-10 nucleic acid sequence is shown in SEQ ID No.

2.

2. The engineered bacteria preparation based on aerosol inhalation according to claim 1, characterized in that: The core-shell microspheres are engineered bacteria-calcium alginate microspheres with a single chitosan coating on the surface; the engineered bacteria-calcium alginate microspheres are engineered bacteria with a single calcium alginate coating on the surface.

3. The engineered bacteria preparation based on aerosol inhalation according to claim 1, characterized in that: The immune checkpoint inhibitor anti-PD-L1 nanobody plasmid is p15A-J23119-anti-PD-L1nanobody, including the constitutive promoter J23119 and the immune checkpoint inhibitor anti-PD-L1 nanobody gene; The anti-inflammatory cytokine IL-10 plasmid is pRSF-J23119-IL-10, which includes a constitutive promoter J23119 and an anti-inflammatory cytokine IL-10 gene.

4. According to the engineered bacteria preparation based on aerosol inhalation according to claim 1, the method of integrating the synchronous lysis circuit SLIC gene into the genome of the engineered bacteria is: The SLIC gene fragment of the pTD103luxI_sfGFP plasmid that performs the lysis function is integrated into the cagA site of the engineering bacteria, and the SLIC gene fragment of the pTD103aiiA(Cm) plasmid that performs the lysis function is integrated into the fhlA site of the engineering bacteria; The pTD103luxI_sfGFP plasmid performs the SLIC gene of the lysis function, and the nucleic acid sequence is shown in SEQ ID No.3; The pTD103aiiA (Cm) plasmid has a SLIC gene that performs lysis function, and its nucleic acid sequence is shown in SEQ ID No.

4.

5. The method for preparing an engineered bacteria preparation based on atomization inhalation according to claim 1, characterized in that: The following steps are involved: 1) The suicide plasmid pRE112 was introduced into the wild-type E. coli EcN, and the two cryptic plasmids pMUT1 and pMUT2 in EcN were knocked out to obtain the E. coli EcNΔΔ strain; the red homologous recombination technology was used to transform EcNΔΔ, and the synchronous lysis circuit SLIC gene was integrated into the genome to construct the chassis strain EcN SLIC with a synchronous lysis cycle; 2) The vectors p15A and pRSF were linearized by PCR technology, avoiding the original promoter region; the anti-PD-L1 nanobody fragment was connected to the p15A vector by homologous recombination to construct the plasmid p15A-J23119-anti-PD-L1nanobody; the IL-10 fragment was connected to the pRSF vector to construct the plasmid pRSF-J23119-IL-10; 3) Using E. coli DH5α strain as host for plasmid construction and amplification, and using EcNΔΔSLIC strain as host for functional characterization, we obtained the engineered bacteria EcN SLIC that produces anti-PD-L1 nanobody and IL-10"; 4) Using microfluidic equipment to mass produce engineered bacterial gel micro-nano particles: The mixed solution of engineered bacteria EcN SLIC and alginate was used as the internal phase, and the ratio of CFU:m / v in the internal phase was 1.0·10 8 : 1%; The gel single-coated engineered bacteria particles are prepared using calcium chloride solution as the external phase, and the concentration of calcium chloride in the external phase is 5%; The two-component microspheres were synthesized using a homemade microfluidic device, which was controlled by two syringe pumps, injecting the external phase fluid and the internal phase fluid respectively, so that the external phase fluid sheared the internal phase fluid. The flow rate of the internal phase injection pump was 40 μL / min, and the flow rate of the external phase injection pump was 1600 μL / min, and the engineered bacteria-calcium alginate microspheres were prepared; The engineered bacteria-calcium alginate microspheres were placed in a 0.5% chitosan solution and slowly stirred, wherein the ratio of the engineered bacteria-calcium alginate microspheres to the chitosan solution was m:v=1 mg:4 mL, to prepare single-coated engineered bacteria-calcium alginate-chitosan core-shell microspheres; 5) The engineered bacteria-calcium alginate-chitosan core-shell microspheres are freeze-dried to a water content of 4%, dispersed in physiological saline, and atomized into aerosol particles to achieve respiratory drug delivery function.

6. The method for preparing an engineered bacteria preparation based on atomization inhalation according to claim 5, characterized in that: Step 5) The freeze-drying process is to adjust and set the freeze dryer to have a gradient freeze-drying program, wherein the gradient freeze-drying temperature program is 0°C, -20°C, and -40°C, and the gradient freeze-drying time is 30min, 120min, and 360min.

7. The method for preparing an engineered bacteria preparation based on atomization inhalation according to claim 5, characterized in that: The diameter of the engineered bacteria-calcium alginate-chitosan core-shell microspheres is 3-6 μm.

8. Use of the engineered bacteria preparation based on aerosol inhalation according to claim 1 in the preparation of anti-tumor drugs.

Images