Sea cucumber polysaccharide with anti-colitis effect and application thereof

Abstract

The invention belongs to the technical field of ocean, and particularly relates to sea cucumber polysaccharide with an anti-colitis effect and application of the sea cucumber polysaccharide. According to the invention, the holothuria leucospilota polysaccharide H.leucospilota PS with a brand new structure is separated and purified from holothuria leucospilota, and the holothuria leucospilota polysaccharide H.leucospilota PS is composed of five monosaccharides, namely glucosamine, glucuronic acid, galactosamine, galactose and fucose. According to the present invention, by changing the intestinal microflora structure, the polysaccharide further regulates the generation of 3-Hydroxybutyrate, L-Meliic acid and Succinic semialdehydes, such that the intestinal energy metabolism is regulated, the intestinal microflora disorder and the energy metabolism disorder caused by the colitis are improved, and the drug resistance and the side effect caused by the long-term taking of the colitis treatment agent can be avoided;

Description

Technical Field

[0001] The invention belongs to the field of marine technology, and specifically relates to sea cucumber polysaccharide with anti-colitis effect and application thereof. Background Art

[0002] Ulcerative colitis (UC) and Crohn's disease (CD) are the two main forms of inflammatory bowel disease (IBD). The pathogenesis of UC is closely related to dysregulated immune response, changes in intestinal microbiota, genetic susceptibility and environmental factors. UC patients are usually accompanied by reduced diversity of intestinal microbiota, changes in intestinal microbial metabolic profiles and reduced short-chain fatty acids. At present, UC is mainly treated with drugs, and clinicians will select drugs to control the progression of the disease according to the severity of lesions in UC patients. Conventional preparations for UC include aminosalicylic acid, corticosteroids, immunosuppressants and biologics, but these drugs have side effects and limitations. Therefore, it is necessary to find some new, safe and efficient natural products to prevent and improve UC.

[0003] Clinical evidence shows that reduced diversity of the fecal microbiota is a universal indicator of UC. When inflammation occurs in the intestine, the number of intestinal flora decreases sharply and the flora structure is disrupted, resulting in the dominance of some harmful bacteria, which further exacerbates inflammation. There is a correlation between the characteristics of the intestinal flora and the metabolite composition of UC patients. The relative abundance of certain pathogenic bacterial genera in UC is significantly correlated with the levels of host microbial co-metabolites; when the relative abundance of pathogenic bacterial genera increases significantly, biogenic amines, amino acids and lipids increase significantly, and B vitamins decrease significantly. Intestinal metabolic biomarkers may improve the methods of diagnosis and management of UC, thereby promoting the development and application of personalized drugs.

[0004] In recent years, researchers have found that a large number of functional polysaccharides can be obtained from many marine plants, animals and microorganisms. These natural polysaccharides have the advantages of safety, high efficacy, non-toxicity, low cost and good biocompatibility. Marine dietary polysaccharides have good immunomodulatory activity and anti-inflammatory effects, and affect the immune system by regulating intestinal flora. Chinese patent application CN111543638B discloses a sea cucumber polysaccharide product with auxiliary hypoglycemic effect and its preparation method, which reduces the blood sugar of diabetic patients. Patent application CN111265627B discloses a sea cucumber polysaccharide composition for regulating intestinal flora, its preparation method and application, which can effectively regulate gastrointestinal flora, protect gastrointestinal mucosa, and thus improve the function of immunity. Patent CN111658664B discloses the application of sea cucumber polysaccharides in anti-new coronavirus, and the sea cucumber polysaccharide oral liquid can inhibit the invasion of SARS-CoV-2 virus from the digestive system. However, the Yuzu sea cucumber polysaccharide H. leucospilotaThere are no relevant reports on the role and application of PS in anti-colonic inflammation. Summary of the invention

[0005] In view of the current technical deficiencies of sea cucumber polysaccharides as pharmaceutical preparations in the field of anti-colitis, the present invention aims to provide a sea cucumber polysaccharide H. leucospilota PS and its uses.

[0006] The purpose of the first aspect of the present invention is to provide a sea cucumber polysaccharide.

[0007] The purpose of the second aspect of the present invention is to provide a method for preparing the sea cucumber polysaccharide of the first aspect of the present invention.

[0008] The third aspect of the present invention aims to provide a polysaccharide composition.

[0009] The purpose of the fourth aspect of the present invention is to provide the use of the sea cucumber polysaccharide of the first aspect of the present invention in the preparation of a product for treating diabetic nephropathy.

[0010] In order to achieve the above-mentioned purpose of the present invention, the technical solution adopted by the present invention is: The first aspect of the present invention aims to provide a sea cucumber polysaccharide, which is isolated from sea cucumber and named as sea cucumber polysaccharide ( Holothuria leucospilota polysaccharide, H. leucospilota PS).

[0011] Preferably, the sea cucumber polysaccharide comprises a polysaccharide represented by the structure of formula 1): Formula 1); Wherein, the R group is selected from H, SO3 - One of; R1 group is selected from Fucp, H, SO3 - One of; n is 75-157, and p is the abbreviation of pyranose, which represents a hexavalent sugar.

[0012] In some embodiments of the present invention, the sea cucumber polysaccharide is composed of the following monosaccharides: D-glucuronic acid (GlcpUA), N-acetylgalactosamine (GalpNAc) and fucose (Fucp); the molar ratio of D-glucuronic acid (GlcpUA), N-acetylgalactosamine (GalpNAc) and fucose (Fucp) is: (0.2~0.6):1:(2.0~3.0).

[0013] In some embodiments of the present invention, the sea cucumber polysaccharide is a sulfated polysaccharide having a fucosylated glycosaminoglycan (FGs)-like structure, and its main chain structure is →3)-β-D-Galp NAc-(1→4)-β-D-Glcp UA-(1→, wherein p is the abbreviation of pyranose, representing a hexameric sugar.

[0014] In some embodiments of the present invention, the sea cucumber polysaccharide has a substitution group, wherein the R group substitution occurs at the 4-O and 6-O positions of GalpNAc, and the R group is selected from H, SO3 - The Fucp side chain is located at the C3 site of GlcpUA, wherein the 2C and 3C sites of Fucp have replaceable R groups, and the R groups are selected from H, SO3 - The 4C position of Fucp has a replaceable R1 group, and the R1 group is selected from Fucp, H, SO3 - One of them.

[0015] In some embodiments of the present invention, the sea cucumber polysaccharide comprises a polysaccharide represented by the structure of formula 2): Formula 2).

[0016] In some embodiments of the present invention, the sea cucumber polysaccharide comprises a polysaccharide represented by the structure of formula 3): Formula 3).

[0017] In some embodiments of the present invention, the sea cucumber polysaccharide comprises a polysaccharide represented by the structure of formula 4): Formula 4).

[0018] In some embodiments of the present invention, the weight average molecular weight of the polysaccharide of formula 1) is 9×10 4 ~1.1×10 5 Da; preferably, 1.05×10 5 ~1.08×10 5 Da.

[0019] In some embodiments of the present invention, the number average molecular weight of the polysaccharide of formula 1) is 0.5×10 5 ~0.8×10 5 Da; preferably, 0.6×10 5 ~0.7×10 5 Da.

[0020] In some embodiments of the present invention, the Z average molecular weight of the polysaccharide of formula 1) is 5×10 5 ~7×10 5 Da; preferably, 6×105 ~6.5×10 5 Da.

[0021] The second aspect of the present invention provides a method for preparing the sea cucumber polysaccharide according to the first aspect of the present invention, comprising the following steps: 1) Defatting and enzymatic hydrolysis of sea cucumber; 2) Hexadecylpyridinium chloride (CPC) precipitation; 3) Alcohol precipitation; 4) Activated carbon decolorization; 5) Deproteinization; 6) Dialysis desalination; 7) Chromatographic purification.

[0022] In some embodiments of the present invention, the degreasing is performed using an organic reagent, and the organic reagent includes at least one of acetone, petroleum ether, and chloroform.

[0023] In some embodiments of the present invention, the enzyme used for enzymatic hydrolysis includes at least one of papain, alkaline protease, and trypsin.

[0024] In some embodiments of the present invention, the temperature of the enzymolysis is 50-70° C.; the time of the enzymolysis is 22-26 h; and the amount of enzyme used in the enzymolysis is 8000-11000 (U / g).

[0025] In some embodiments of the present invention, the dosage of the CPC precipitate is 0.08-0.12 g / mL.

[0026] In some embodiments of the present invention, the reagent used for the alcohol precipitation is selected from at least one of ethanol, isopropanol and butanol.

[0027] In some embodiments of the present invention, the deproteinization method is selected from Sevage reagent or trichloroacetic acid.

[0028] In some embodiments of the present invention, the chromatography purification includes ion chromatography purification and molecular sieve chromatography purification.

[0029] In some embodiments of the present invention, the ion chromatography purification is performed using a DEAE Sepharose fast flow chromatography column, and other conventional ion chromatography columns in the art can also achieve corresponding effects.

[0030] In some embodiments of the present invention, the molecular sieve chromatography purification is performed using a Sephadex G-100 chromatography column, and other conventional molecular sieve chromatography columns in the art can also achieve corresponding effects.

[0031] The third aspect of the present invention provides a sea cucumber polysaccharide composition, including sea cucumber polysaccharide H. leucospilota PS and pharmaceutically acceptable excipients.

[0032] In some embodiments of the present invention, the pharmaceutically acceptable excipients include at least one of a flavoring agent, a binder, and a filler.

[0033] In some embodiments of the present invention, the flavoring agent is selected from at least one of xylitol, longan dry powder, sorbitol, maple syrup powder, and candied sugar.

[0034] In some embodiments of the present invention, the adhesive comprises at least one of chitosan, trehalose, and gum arabic.

[0035] In some embodiments of the present invention, the filler includes at least one of corn starch, acetylated starch, and hydroxypropyl starch.

[0036] In some embodiments of the present invention, the sea cucumber polysaccharide H. leucospilota The mass ratio of PS, flavoring agent, adhesive and filler powder is 6~12:15~20:35~45:10~15.

[0037] The fourth aspect of the present invention provides the use of the sea cucumber polysaccharide described in the first aspect of the present invention in the preparation of a product for treating colitis.

[0038] In some embodiments of the present invention, the sea cucumber polysaccharide H. leucospilota PS alleviates colon inflammation by regulating intestinal bacterial disturbances and intestinal metabolites caused by colitis.

[0039] In some embodiments of the present invention, the intestinal flora is Lactobacillaceae .

[0040] In some embodiments of the present invention, the intestinal flora is Bifidobacteriaceac .

[0041] In some embodiments of the present invention, the intestinal metabolite is 3-Hydroxybutanoate.

[0042] In some embodiments of the present invention, the intestinal metabolite is L-Malic acid.

[0043] In some embodiments of the present invention, the intestinal metabolite is Succinic semialdehyde.

[0044] In some embodiments of the invention, the product comprises a pharmaceutical product.

[0045] In some embodiments of the present invention, the dosage form of the food or medicine includes at least one of powder, tablet, capsule, sustained-release agent, and granule.

[0046] The beneficial effects of the present invention are: The present invention separates and purifies a new structure of sea cucumber polysaccharide H. leucospilota PS is composed of five monosaccharides: glucosamine, glucuronic acid, galactosamine, galactose and fucose. leucospilota PS changes the structure of intestinal microbial communities and further regulates the production of 3-Hydroxybutanoate, L-Malic acid, and Succinic semialdehyde, thereby regulating intestinal energy metabolism, improving intestinal microbial community disorders and energy metabolism disorders caused by colitis, and avoiding drug resistance and side effects caused by long-term use of colitis treatments.

[0047] 2) The sea cucumber polysaccharide H. leucospilota PS can effectively improve the intestinal energy metabolism disorder caused by colitis. Therefore, this polysaccharide has certain application prospects in the preparation of drugs for the treatment of colitis. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein: Figure 1 For standard monosaccharides and H. leucospilota HPAEC-PAD chromatogram of PS (A); HPLC chromatogram of monosaccharide composition analysis of H.leucospilota PS (B).

[0049] Figure 2 For H. leucospilota HPSEC chromatogram of PS.

[0050] Figure 3 For H. leucospilota Infrared spectrum of PS.

[0051] Figure 4 For H. leucospilota 1H NMR spectrum of PS.

[0052] Figure 5 For H. leucospilota 13C NMR spectrum of PS.

[0053] Figure 6 For H. leucospilota COSY spectrum of PS.

[0054] Figure 7 For H. leucospilotaTOCSY spectrum of PS.

[0055] Figure 8 For H. leucospilota HSQC spectrum of PS.

[0056] Figure 9 For H. leucospilota NOESY spectrum of PS.

[0057] Figure 10 For H. leucospilota HMBC spectrum of PS.

[0058] Figure 11 For H. leucospilota Schematic diagram of the structure of PS.

[0059] Figure 12 The results of the changes in the levels of immune cytokines TNF-α and IL-6 in serum in Example 3 are shown.

[0060] Figure 13 Microorganisms in the intestine Lactobacillaceae , Bifidobacteriaceac The relative content changes of .

[0061] Figure 14 These are the relative content changes of 3-Hydroxybutanoate, L-Malic acid, and Succinic semialdehyde in feces. DETAILED DESCRIPTION

[0062] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0063] Example 1 Sea Cucumber Polysaccharide H. leucospilota PS separation and purification The invention provides a method for extracting sea cucumber body wall polysaccharides. The sea cucumber is selected from sea cucumbers of the genus Tripterygium wilfordii. Sea cucumbers of the genus Tripterygium wilfordii are one of the most common edible sea cucumbers in the South China Sea of ​​my country and have medicinal and edible values.

[0064] The specific implementation method of the present invention is as follows: soak the dried sea cucumber body wall for 20 to 24 hours, remove the internal organs and body cavity membrane, mince it with a meat grinder, and freeze-dry it into powder. The freeze-drying parameters of the freeze-drying powder are -60 to -25°C, vacuum degree 1-3 bar, and 10 to 14 hours. Soak in acetone for defatting, and the mass ratio of sodium acetate, papain, EDTA, cysteine ​​and water is 3.28:0.26:0.58:0.24. Stir and centrifuge, take the supernatant, add cetylpyridinium chloride (Cetyl-Pyridinium Chloride, CPC) to the supernatant at a ratio of 10% (W / V), centrifuge after standing at room temperature, and redissolve the precipitate in NaCl: ethanol (100:15V / V) solution. Add anhydrous ethanol to precipitate, stand for 10 to 12 hours, and then centrifuge. Add 0.5%-0.75% activated carbon to the supernatant for decolorization, and stir and decolorize at 40°C for 60 minutes. Trifluoroacetic acid was used to remove protein, and the solution was dialyzed for 48 h using a dialysis bag with a molecular weight cutoff of 8000 Da; and freeze-dried (temperature -60~-25℃, vacuum degree 1-3 bar) for 10-14 h to obtain crude sea cucumber polysaccharides.

[0065] The graded column chromatography of the present invention specifically uses a DEAE-Sepharose Fast Flow column for graded separation, and then eluted and purified by a Sephadex G-100 column. After assembling the chromatography column, fill it with fully degassed DEAE-FF filler and balance it with 0.1 M sodium acetate buffer. Weigh 200 mg of the sample, add 10 mL of buffer to dissolve it, pass the prepared polysaccharide solution through a 0.45 μm filter membrane, and add it to the chromatography column. The eluent uses a 0.1 M sodium acetate solution containing 1.5 M, set the flow rate to 1 mL / min, 5 min / tube, collect tubes 61-68, and lyophilize to obtain HLP-1. Further purification using Sephadex G-100: weigh 100 mg of HLP-1 lyophilized powder, add 5 mL of 0.1 M sodium acetate buffer containing 2 M NaCl, fully dissolve it, pass it through a 0.45 μm filter membrane, and set the flow rate to 0.5 mL / min. The main peak (tubes 19-30) was collected, with 5 mL collected in each tube. After reduced pressure concentration, the solution was dialyzed for 48 h and freeze-dried to obtain the purified sample of sea cucumber polysaccharide.

[0066] Example 2 Sea Cucumber Polysaccharide H. leucospilota Structural identification of PS 1) Analysis of monosaccharide composition by HPLC The monosaccharide composition was measured by high performance liquid chromatography (HPLC) method of pre-column PMP derivatization. 6 mg of the sample (prepared in Example 1) was dissolved in 3 mL of trifluoroacetic acid (4M) to prepare a 2 mg / mL mixed solution, which was transferred to an ampoule tube, sealed and hydrolyzed at 120 °C for 4 h. After the reaction was completed, it was cooled to room temperature, 100 μL of the hydrolyzate was added with an equal volume of methanol, and dried with nitrogen to remove trifluoroacetic acid. The above operation was repeated 3 times until the sample tube had a constant weight. The dried sample was dissolved in 100 μL of ultrapure water, and an equal volume of 0.6 M NaOH solution was added and mixed evenly, and then an equal volume of 0.5 M PMP-methanol solution was added for pre-column derivatization reaction, and the reaction was carried out in a 70 °C water bath for 1.5 h. After the reaction was finished and cooled to room temperature, 100 μL of the reactant was taken out and neutralized with 50 μL of hydrochloric acid (0.3 M), 1 mL of chloroform and 900 μL of water were added, the chloroform layer was discarded after vigorous shaking and centrifugation for 5 min, and 1 mL of chloroform was added to the aqueous layer, and the extraction was repeated 3 times. Finally, the upper layer (aqueous layer) was filtered using a 0.22 μm water filter membrane and then detected by high performance liquid chromatography. The monosaccharide standard was prepared as a 1 mg / mL solution and the polysaccharide hydrolyzate was derivatized and labeled at the same time. The monosaccharide standards are glucosamine, glucuronic acid, aminogalactose, galactose and fucose.

[0067] The detection conditions of liquid chromatography are shown in Table 1.

[0068] Table 1 Liquid chromatography operating parameters

[0069] 2) Analysis of monosaccharide composition by ion chromatography The derivatized polysaccharide solution in the upper layer (aqueous phase) obtained in step 1) was passed through a 0.22 μm water filter membrane and injected. Different concentrations of monosaccharide standard solutions and mixed standard solutions were prepared, and the samples were analyzed using the HPACE-PAD method. The mixed standard solution was prepared with the same concentration of glucosamine, glucuronic acid, aminogalactose, galactose and fucose. The five monosaccharide standard samples were prepared into 5.0 mg / mL stock solutions, and 1.0 mL was drawn from each of the five monosaccharide standard sample stock solutions, mixed to prepare 0.5 mg / mL mixed standard solutions, and the mixed standard solutions were diluted to the required concentration gradient, such as 0.02, 0.04, 0.06, 0.08, 0.1 mg / mL mixed standard solutions. Equipped with a Carbo Pac TMPA 20 (4 mm × 250 mm) ion chromatography column, set the flow rate to 0.5 mL / min, and the mobile phase A was UP water, expressed in percentage.

[0070] Table 2 Monosaccharide gradient elution program

[0071] Due to the limitations of high performance anion exchange chromatography (HPAEC) and the separation effect of the PA-20 column, the peak times of galactosamine and rhamnose are very close ( Figure 1 In the structural analysis, HPSEC and PMP-HPLC with Agilent C18 column were used to measure the monosaccharide composition. Each peak was integrated and quantified according to the HPLC peak position and time ( Figure 1 In B), it can be seen that the monosaccharide composition of HLP-Ⅰ is mainly D-glucuronic acid (Glcp UA), N-acetylgalactosamine (GalpNAc) and fucose (Fucp) with a molar ratio of 0.45:1.00:2.40.

[0072] 3) Determination of homogeneity and molecular weight High-performance size exclusion chromatography-multi-angle laser light scattering (HPSEC-MALLS) measurements were performed using an Agilent 1200 series LC system (Agilent Technologies, Palo Alto, USA) at 25 °C. The mobile phase was 0.1 M NaNO3 in water with a flow rate of 0.6 mL / min and the specific refractive index increment (dn / dc) was set to 0.145 mL / g. The molecular weight was calculated by the Zimm method of static light scattering according to the basic light scattering equation.

[0073] H. leucospilota The weight average molecular weight (Mw), number average molecular weight (Mn) and Z average molecular weight (Mz) of PS were measured to be 1.062×10 5 Da, 0.652×10 5 Da and 6.232×10 5 Da. The narrow and symmetrical peaks on the HPSEC-RI chromatogram ( Figure 2 ) and a relatively low polydispersity index value (1.63, PDI = Mw / Mn) indicated that H. leucospilota PS has higher purity and better uniformity.

[0074] 4) Infrared spectroscopy analysis of molecular structure The sample and KBr mixture (1:100, w / w) were compressed into thin sheets and transferred to an FT-IR spectrometer (Nicolet6700, Thermo Fisher Scientific Technology Co., Ltd, USA). -1 FT-IR spectra were recorded in the range of 100 nm and 64 scans.

[0075] 5) Analysis of molecular structure by nuclear magnetic resonance spectroscopy Deuterated polysaccharides (50 mg) were dissolved in 0.6 mL D2O and subjected to 1D and 2D NMR experiments. All experiments were performed on a Bruker AVANCE spectrometer (Bruker BioSpin, Rheinstetten, Germany). 1H and 13C NMR spectra were acquired at 298.2 K using 600.58 and 151.01 MHz proton frequencies and processed with MestReNova 14.0 software. 2D NMR experiments, including 1H-1H correlation spectroscopy (1H-1H COSY), 1H-13C heteronuclear single quantum coherence (HSQC), heteronuclear multiple bond correlation (HMBC), total correlation spectroscopy (TOCSY), and NOESY were performed for structural analysis.

[0076] like Figure 3 As shown, 3478.53 cm -1 The strong absorption band at 2929.85cm represents the stretching vibration of OH in the sugar residue. -1 The band nearby is related to the stretching vibration of CH in the sugar ring. -1 and 1650 cm -1 The peak at 1253.12 cm is attributed to the -COOH bending vibration of the carboxylic acid product and the bending and stretching vibration of CO in glucuronic acid and N-acetylgalactosamine. -1 The signal at 1050.93 cm is attributed to the asymmetric stretching vibration of the sulfate group (O=S=O), which is a typical feature of sulfated polysaccharides. -1 The absorption peak is in the fingerprint region of polysaccharides (400-1300 cm -1 , which can be used to distinguish small differences in the structure of different compounds) can identify specific chemical groups in HLP-Ⅰ, which are generated by COC stretching vibration. 962.47, 850.71 and 686.36 cm -1 The asymmetric absorption peak of H. leucospilota There are abundant sulfate groups in PS. 820 cm -1 - 850 cm -1 The nearby bands have obvious differences, which may be related to the different substitution positions of sulfate groups in the polysaccharide chain structure. -1 The characteristic peak of COS stretching vibration indicates that the C-4 position of the fucose residue contains an axial sulfate group.

[0077] like Figure 4 As shown, the chemical shift of the anomeric proton signal region in the 1H NMR spectrum is 5.0-5.8 ppm, indicating the presence of α-sulfated fucose residues and H. leucospilotaThe sulfate group substitution types in PS are Fucp 2,4S, Fucp 4S, and Fucp 0S. The signal ranges of the methyl protons (-CH3) of Fucp and GalNpAc are in the 1.1-1.4 ppm and 1.8-2.1 ppm regions, and the signal integration results in an area ratio of 1.05:1.00. The 13C NMR spectrum further illustrates the H. leucospilota The carbon skeleton of PS polysaccharide is composed of L-Fucp, D-GalNpAc and D-GlcUA, and D-GalpNAc and D-GlcUA are in the β-anomeric carbon configuration ( Figure 5 ).

[0078] According to H. leucospilota HSQC spectral data of PS ( Figure 6 ), the positions of the H-1 signals belonging to the H and I units are 5.62 ppm and 5.32 ppm, respectively. Using 1H-1H COSY ( Figure 7 ) spectrum to further analyze other signals of the resonance system. The H-2 (4.39 ppm) and H-4 (4.58 ppm) signals are in the low field position, which verifies the presence of sulfate groups at C-2 and C-4 in the H unit. The H-3 (3.91 ppm) and H-4 (4.14 ppm) signals confirm the sulfation of the I unit at O-3 and O-4. Figure 8 As shown, signals A, B, and C are from (H-1, C-1), (H-2, C-2), (H-3, C-3), (H-4, C-4), (H-5, C-5), and (H-6, C-6) of GalpNAc, GalpNAc4S6S, and GalpNAc4S. Signals D, E, and F are from (H-1, C-1), (H-2, C-2), (H-3, C-3), (H-4, C-4), and (H-5, C-5) of Glcp UA, Glcp UA 2S, and GlcpUA2S3S. The chemical shifts of H-4 and H-6 in GalpNAc4S6S are downfield compared to GalpNAc, indicating that its O-4 and O-6 positions are sulfated. Based on the correlation peaks in HMBC and NOESY, the residue sequence of the glycosidic bond was clarified. Figure 9 The two clear signals at 4.39 / 3.86 ppm and 4.64 / 4.43 ppm (denoted as D1 / A3, B3, C3 and H1, B1, C1 / D1, E1, F1, respectively) indicated that Glcp UA was linked to the C-3 position of GalN, which was associated with the C-3 position of GalpNAc. Figure 10 The cross peaks of H1(D) / H3(E), H1(G,I) / H3(E), and H1(G,I) / H3(F) interactions confirmed the substitution of fucosyl residue at O-3 by Glcp UA.

[0079] H. leucospilota The H / C chemical shift data of PS are shown in Table 3. Based on the above structural analysis, H. leucospilota PS contains three main monosaccharides (GlcpUA, GalpNAc and Fucp), and its main chain structure is similar to that of some sea cucumber body wall FGs. Therefore, it is speculated that H. leucospilota PS is a sulfated glycosaminoglycan with a FGs-like structure, and sulfate substitution occurs at the O-4 and O-6 positions of GalpNAc. In addition, H. leucospilota PS has fucose branches with different sulfation patterns (Fucp 2, 4S, Fucp 3, 4S, and Fucp 0S).

[0080] Table 3 H leucospilota P.S. 1 H and 13 Assignment of C NMR spectra

[0081] Based on the above data, H. leucospilota PS includes the following three different polysaccharide structures: Formula 2); Formula 3); Formula 4).

[0082] Combining infrared and nuclear magnetic data, it is predicted that H. leucospilota The structural diagram of PS is shown in Figure 11 shown.

[0083] Example 3 H. leucospilota The therapeutic effect of PS on inflammatory bowel disease Animal Experiment Design This study was approved by the Animal Ethics Committee of Hainan University, and all animal operations were carried out in accordance with the Guidelines for the Care and Use of Laboratory Animals of Hainan University. After 7 days of adaptive culture in the experimental environment, male SD rats were randomly divided into 6 groups, namely, normal control group (NC, intragastric administration of normal saline, drinking purified water), model control group (MC, intragastric administration of normal saline, drinking DSS aqueous solution), positive control group (PC, intragastric administration of 100 mg / kg mesalazine, drinking DSS aqueous solution), H. leucospilota PS low-dose group (HLP-L, gavage with 50 mg / kg HLP, drinking DSS aqueous solution), H. leucospilota PS medium-dose group (HLP-M, gavage with 100 mg / kg HLP, drinking DSS aqueous solution), H. leucospilotaPS high-dose group (HLP-H, gavage of 200 mg / kg HLP, drinking DSS aqueous solution). In the first week of the experiment, rats in the HLP group were gavaged, and each group had free access to water and food. In the second week of the experiment, except for the NC group, 3% DSS (36,000−50,000 mw) was added to the drinking water of the other groups, and ulcerative colitis was induced by drinking for 7 consecutive days. At the same time, rats in the PC group and HLP group (HLP-L group, HLP-M group and HLP-H group) were gavaged with 5-ASA and different doses of HLP for intervention.

[0084] 2) Sample collection and determination of inflammatory factors The health status of the experimental rats was checked every day in the second week of the experiment, and fresh fecal samples of the rats were collected one day before the end of the experiment and quickly frozen in liquid nitrogen. After fasting for 12 h, all experimental rats were anesthetized with 5% chloral hydrate (10 g / 0.1 mL), blood was collected from the orbit, and the whole blood was centrifuged (3500 g, 10 min, 4 °C) to obtain serum, which was immediately frozen at -80 °C for subsequent analysis. The cytokines IL-6 and TNF-α in rat serum were detected by enzyme-linked immunosorbent assay (ELISA), and the specific operation was carried out according to the instructions of the IL-6 kit (Jiangsu ELISA Biotechnology Co., Ltd., catalog number MM-0190R1) and the TNF-α kit (APPLYGEN, catalog number AZ0672).

[0085] 3) 16S rDNA high-throughput sequencing analysis After extracting the total genomic DNA from the fecal samples, its quality was tested by 1% agarose gel electrophoresis and quantified by spectrophotometer. TransStart Fastpfu DNA polymerase was used for PCR amplification, and the number of amplification cycles was controlled to ensure consistent amplification conditions for the same batch of samples. After the amplification step was completed, the PCR product was recovered by gel excision using a gel recovery kit. The product was eluted and detected by 2% agarose electrophoresis. According to the preliminary quantitative results of electrophoresis, the PCR product was quantified by a fluorescence quantitative system. The Illumina P7 adapter sequence (CAAGCAGAAGACGGCATACGAGAT, SEQ ID NO: 1) was added to the outer end of the target region by PCR, and the PCR product was recovered by gel excision using a gel recovery kit, and sodium hydroxide was denatured to produce single-stranded DNA fragments. The DNA was sequenced and the results were analyzed.

[0086] 4) Metabolite analysis in feces Take out the rat feces sample from the ultra-low temperature freezer and thaw it in a 4 ℃ refrigerator. Take 100 mg of feces sample, add 1200 μL of methanol / acetonitrile / water extract (2:2:1), vortex for 2 min, ultrasonicate at room temperature for 10 min, and let it stand in a 4 ℃ refrigerator for 10 min. Centrifuge at 14,000 g for 15 min at 4 ℃, take the supernatant and let it stand for use, pass through a membrane, and test on the machine.

[0087] 5) Experimental results TNF-α is a potent cytokine that promotes inflammation in IBD, which promotes inflammation through adhesion molecule expression, fibroblast proliferation, and activation of procoagulant factors. + T cells produce large amounts of IL-6 in experimental colitis and IBD patients; elevated IL-6 expression is associated with an increased risk of colorectal adenoma development. Figure 12 As shown in the figure, compared with the NC group, DSS significantly increased the levels of pro-inflammatory factors TNF-α and IL-6 in the serum of rats, and the cytokine levels in the HLP group and PC group were restored to varying degrees. leucospilota PS intervention significantly improved colon inflammation, and its inflammatory factor inhibitory effect was similar to that of 5-ASA, and it had no toxic side effects compared to long-term use of 5-ASA.

[0088] The bacterial flora sequencing results are as follows Figure 13 As shown in Figure 2, after DSS induction, the intestinal flora of rats Lactobacillaceae , Bifidobacteriaceac After HLP treatment, the relative abundance of these bacterial communities was significantly improved. Lactobacillaceae It is the most abundant probiotic family. It produces single-chain fatty acids by fermenting oligosaccharides and polysaccharides, inhibiting the adhesion of pathogens to intestinal epithelial cells, improving the intestinal environment, and promoting the proliferation of acidophilic probiotics. Lactobacillaceae , Bifidobacteriaceac It can improve the intestinal environment, inhibit the growth of harmful bacteria, and enhance the intestinal immune barrier.

[0089] Fecal metabolite results Figure 14As shown in the figure, through multivariate statistical analysis, according to the change multiple between groups>2, the probability of significant results<0.05, and the single variable in the statistical model for the model prediction result>1.0, the differential metabolites between the groups were screened, and the significantly different metabolites 3-Hydroxybutanoate, L-Malic acid, and Succinic semialdehyde were screened from the fecal metabolites as the significantly different metabolites of intestinal metabolism in colitis. The 3-Hydroxybutanoate and Succinic semialdehyde in the feces of rats with colitis decreased, and the L-Malic acid content increased, indicating that DSS interfered with the intestinal energy metabolism of rats. After ingesting HLP, the content of 3-Hydroxybutanoate and Succinic semialdehyde in the feces increased, and the content of L-Malic acid decreased. Unlike the energy sources of other organs, 70% of the intestinal energy comes from the oxidation of butyrate. Therefore, butyrate is the main energy source for intestinal epithelial cells. Inflammation in the colon is a complex energy consumption process. When the content of substances involved in energy metabolism changes significantly, it indicates that the colon energy metabolism is abnormal. L-Malic acid and Succinic semialdehyde are intermediates of the tricarboxylic acid cycle. 3-Hydroxybutanoate is a monomer of microbial polyhydroxybutyrate and a natural ketone body produced by the oxidation of butyrate in gastrointestinal epithelial cells, providing energy for cells, heart and brain. Therefore, HLP regulates the intestinal flora and restores the normal energy supply of intestinal epithelial cells (energy supply by butyrate oxidation), improves the intestinal environment, and reveals the mechanism by which HLP improves colon inflammation in rats by improving intestinal flora and regulating energy metabolism pathways (such as the tricarboxylic acid cycle pathway).

[0090] In summary, the isolated and purified sea cucumber polysaccharide H. leucospilota PS can effectively improve the intestinal energy metabolism disorder caused by colitis. This polysaccharide has certain application prospects in the preparation of drugs for the treatment of colitis.

[0091] Example 4 A sea cucumber polysaccharide microgel enteric-coated sustained-release tablet A sea cucumber polysaccharide microcapsule enteric-coated sustained-release tablet, the formula of which is sea cucumber polysaccharide 10g, chitosan 5g (used as an embedding material to provide a sustained-release effect), trehalose 10g (a plant-derived adhesive with similar film-forming properties), xylitol 10g (a natural sweetener with moisturizing properties), longan dry powder 30g (to increase sweetness and nutritional value) and hydroxypropyl starch 15g (also with good fluidity and stability), and the microcapsule sustained-release enteric-coated tablets are obtained by wet granulation and packaged. The enteric-coated tablets have a good effect on improving colitis.

[0092] Example 5 A sea cucumber polysaccharide microgel enteric-coated sustained-release tablet A sea cucumber polysaccharide microcapsule enteric-coated sustained-release tablet, the formula is sea cucumber polysaccharide 8g, chitosan 6g (to enhance the effect of embedding and sustained release), gum arabic 10g (plant source, as a binder and thickener), sorbitol 10g (with moisturizing and sweetening effects), maple syrup powder 30g (natural source sweetener, good taste) and modified corn starch 10g (with good fluidity and adhesion), spray drying to obtain microcapsule sustained-release enteric-coated granules, and granulation to obtain sea cucumber polysaccharide microcapsule enteric-coated sustained-release tablets. The enteric-coated tablet has a good effect on improving colitis.

[0093] Example 6 A sea cucumber polysaccharide microgel enteric-coated sustained-release tablet A sea cucumber polysaccharide microcapsule enteric-coated sustained-release granule, the formula of which is sea cucumber polysaccharide 7g, chitosan 8g (providing additional biocompatibility and intestinal protection), carrageenan 10g, mannitol 10g, candied sugar 30g and acetylated starch 15g, and the microcapsule sustained-release enteric-coated tablet is obtained by dry granulation. The enteric-coated tablet has a good effect on improving colitis.

Claims

1. A sea cucumber polysaccharide, characterized in that: The sea cucumber polysaccharide comprises a polysaccharide shown in the structure of formula 1): Formula 1); Wherein, the R group is selected from H, SO3 - One of; R1 group is selected from Fucp, H, SO3 - One of; n is 75-157.

2. The sea cucumber polysaccharide according to claim 1, characterized in that: The polysaccharide is composed of the following monosaccharides: D-glucuronic acid, N-acetylgalactosamine and fucose; The molar ratio of D-glucuronic acid, N-acetylgalactosamine and fucose is: (0.2-0.6):1:(2.0-3.0).

3. The sea cucumber polysaccharide according to claim 2, characterized in that: The weight average molecular weight of the sea cucumber polysaccharide in formula 1) is 9×10 4 ~1.1×10 5 Da.

4. The method for preparing sea cucumber polysaccharide according to any one of claims 1 to 3, comprising the following steps: 1) Defatting and enzymatic hydrolysis of sea cucumber; 2) Hexadecylpyridinium chloride (CPC) precipitation; 3) Alcohol precipitation; 4) Activated carbon decolorization; 5) Deproteinization; 6) Dialysis desalination; 7) Chromatographic purification.

5. The preparation method according to claim 4, characterized in that: The enzyme used for the enzymatic hydrolysis includes at least one of papain, alkaline protease and trypsin.

6. The preparation method according to claim 5, characterized in that: The deproteinization is performed using trifluoroacetic acid or Sevag's reagent.

7. A sea cucumber polysaccharide composition, characterized in that: It comprises the sea cucumber polysaccharide according to any one of claims 1 to 3, and pharmaceutically acceptable excipients.

8. Use of the sea cucumber polysaccharide according to any one of claims 1 to 3 or the composition according to claim 7 in the preparation of a product for treating inflammatory bowel disease.

9. The use according to claim 8, characterized in that: The inflammatory bowel disease includes at least one of ulcerative colitis and Crohn's disease.

10. The use according to claim 9, characterized in that: The dosage form of the product includes at least one of powder, tablet, capsule, sustained-release agent and granule.

Images