Candida tropicalis engineering bacterium, preparation method thereof and sewage treatment method

Abstract

The invention relates to a candida tropicalis engineering bacterium, a preparation method thereof and a sewage treatment method, and belongs to the technical field of genetic engineering. According to the candida tropicalis engineering bacteria, Candida tropicalis CBW-2 delta URA3 (the preservation number is CGMCC NO.31647) is used as a chassis strain, ACS genes are knocked out, and a promoter is transferred to heterologous expression alpha-amylase genes; the promoter is an endogenous promoter. Candida tropicalis is an unconventional yeast with industrial significance, has the characteristics of high cell growth speed and high environmental tolerance, and has sewage treatment potential. The ACS gene is knocked out, so that the activity of acetyl coenzyme A synthetase is obviously reduced, and the acetic acid accumulation amount of the strain is increased. By efficiently expressing alpha-amylase, the starch component can be efficiently converted into acetic acid, acetic acid can be provided for a heterotrophic nitrification-aerobic denitrification strain as a carbon source, and an exogenous carbon source does not need to be added.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and in particular relates to an engineered Candida tropicalis bacterium and a preparation method thereof and a sewage treatment method. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance the understanding of the overall background of the invention, and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.

[0003] The main methods for removing nitrogen from sewage can be divided into physical, chemical and biological methods. Physical denitrification methods, such as ion exchange and adsorption, have a high retention rate for pollutants, are uneconomical and easily cause secondary pollution. Although chemical denitrification has the advantages of simple operation, fast reaction speed and high denitrification rate, the process and time cost are high. Biological denitrification is a method that uses microorganisms to convert organic nitrogen and ammonia nitrogen in sewage into nitrate and nitrite, and then converts them into nitrogen through ammoniation, nitrification and denitrification. It has significant advantages such as simple process, no secondary pollution, and economic efficiency, and has attracted widespread attention. Biological denitrification requires a carbon source: on the one hand, the carbon source can provide nutrients for microbial growth during the denitrification process, help microorganisms synthesize cell substances and other metabolites, promote the growth of bacteria and denitrifying bacteria, and realize the conversion and removal of ammonia nitrogen; on the other hand, the carbon source can increase the activity of microorganisms, accelerate the degradation rate of organic matter, and improve the efficiency of sewage treatment. However, due to various technical problems and cost reasons, commonly used external carbon sources, such as methanol, sodium acetate, glucose, etc., are not suitable for long-term use as an external carbon source for denitrification.

[0004] Candida tropicalis is a common unconventional yeast that can exist in hyphae or yeast forms as the environment changes. It does not have a sexual reproductive stage and has diverse metabolism. Because Candida tropicalis can produce unique metabolites, has outstanding assimilation ability for various carbon sources (glucose, xylose, galactose) and has strong environmental tolerance, Candida tropicalis has important appeal in the fields of food (sweetener production), energy (biofuel production), biotechnology (enzyme and polysaccharide production), environment (bioremediation applications) and medicine. In yeast cells, the biosynthesis of acetyl-CoA is mainly achieved through the acetyl-CoA synthetase (ACS) reaction with acetate as a substrate. Even under glycolytic growth conditions, yeast cells convert pyruvate into acetate under the catalysis of pyruvate decarboxylase (PDC), acetaldehyde dehydrogenase and acetyl-CoA synthetase. The two known isoforms of acetyl-CoA synthetase in yeast are encoded by genes ACS1 and ACS2, which show 57% sequence identity at the protein level. The two known acetyl-CoA synthetases preferentially use acetate or propionate as their main substrates. Although Candida tropicalis has α-amylase, its efficiency in utilizing starch is low and its application is limited.

[0005] Therefore, how to modify microorganisms through genetic engineering and use the components in sewage to generate the carbon source required for the denitrification process is an urgent problem to be solved. Summary of the invention

[0006] In view of the shortcomings of the prior art, the present invention aims to provide an engineered Candida tropicalis and a preparation method thereof and a method for treating sewage, wherein the engineered Candida tropicalis has the ability to produce acetic acid by knocking out the ACS gene, and the selected strong promoter is used to heterologously express α-amylase, so that the engineered Candida tropicalis can efficiently produce acetic acid using starch as a carbon source. The engineered Candida tropicalis is co-cultured with heterotrophic nitrification-aerobic denitrification bacteria, which has an excellent sewage treatment effect.

[0007] In order to achieve the above object, the technical solution of the present invention is:

[0008] In the first aspect, an engineered Candida tropicalis strain is provided, wherein Candida tropicalisCBW-2ΔURA3 is used as a chassis strain, the ACS gene is knocked out, and a promoter is introduced to heterologously express an α-amylase gene;

[0009] The starting strain of the chassis strain is Candida tropicalis; the promoter is an endogenous promoter;

[0010] The Candida tropicalisCBW-2ΔURA3 was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on August 9, 2024, with the deposit number CGMCC No.31647.

[0011] Wherein, the Candida tropicalisCBW-2ΔURA3 is a uracil-deficient mutant strain.

[0012] Optionally, the ACS gene includes: ACS1 gene and / or ACS2 gene.

[0013] In a second aspect, the method for preparing the above-mentioned engineered Candida tropicalis comprises the following steps:

[0014] S1. Using Candida tropicalis CBW-2ΔURA3 as the chassis strain, an engineered Candida tropicalis strain with a single copy of the ACS gene knocked out was constructed;

[0015] S2, culturing tropical Candida engineered bacteria under static and shaking culture conditions, screening the promoter corresponding to the protein efficiently expressed under both static and shaking culture conditions as a strong promoter of tropical Candida;

[0016] S3, screening and obtaining an α-amylase gene sequence from a fungus, and constructing a transformation plasmid containing the promoter obtained in S2 and the α-amylase gene sequence from a fungus;

[0017] S4. Using the transformation plasmid obtained in S3, the ACS gene single copy knockout engineered bacteria obtained in S1 were transformed to obtain tropical Candida engineered bacteria.

[0018] Optionally, in S2, the promoter sequence is shown as SEQ ID No.35, SEQ ID No.36 or SEQ ID No.37.

[0019] Optionally, in S2, samples are taken during the stationary phase, logarithmic growth phase and stable phase of the strain for proteomic analysis.

[0020] Optionally, in S3, the α-amylase gene sequence is derived from Aspergillus salbicans, Aspergillus niger, Sulfolobus solfataricus or Schwanniomycess occidentalis.

[0021] Optionally, the NCBI accession number of the α-amylase gene sequence is GAA83911.1, CAK48325.1, AAK41260.1 or AAB22383.2.

[0022] Optionally, in S4, after transformation is completed, engineering bacteria with high α-amylase expression activity are screened.

[0023] In a third aspect, a method for treating sewage comprises the steps of:

[0024] The tropical Candida engineered bacteria and the heterotrophic nitrification-aerobic denitrification strains are co-cultured in sewage.

[0025] Optionally, the sewage includes: kitchen waste sewage, including starch components.

[0026] Optionally, the heterotrophic nitrification-aerobic denitrification strain includes: P. stutzeri SDU10 strain.

[0027] Optionally, the combined culture method is: first inoculate tropical Candida engineered bacteria into the sewage at an inoculation rate of 5-10%, and after 24-36 hours, inoculate heterotrophic nitrification-aerobic denitrification strains into the sewage at an inoculation rate of 5-10%.

[0028] One or more of the above technical solutions have the following beneficial effects:

[0029] 1. The present invention proposes an engineered Candida tropicalis, which is an unconventional yeast with industrial significance, characterized by fast cell growth rate and strong environmental tolerance, and has the potential for sewage treatment. The Candida tropicalisCBW-2ΔURA3 used in the present invention is a uracil-deficient mutant strain, which significantly reduces the activity of acetyl-CoA synthetase and increases the acetic acid accumulation of the strain by knocking out the ACS gene. And by efficiently expressing α-amylase, the starch component can be efficiently converted into acetic acid to provide a carbon source that can be used by heterotrophic nitrification-aerobic denitrification strains.

[0030] 2. When the tropical Candida engineered bacteria proposed in the present invention are applied to the field of sewage treatment, they are co-cultured with heterotrophic nitrification-aerobic denitrification strains to provide acetic acid as a carbon source for the heterotrophic nitrification-aerobic denitrification strains without adding an exogenous carbon source, which is beneficial to the efficient and stable operation of the sewage treatment system.

[0031] Collection Instructions

[0032] The Candida tropicalis CBW-2ΔURA3 provided by the present invention is deposited in the General Microbiology Center of the China Culture Collection Administration, the address of which is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, the deposit number is CGMCC No.31647, and the deposit date is August 9, 2024. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0034] Figure 1 This is a diagram of the electrophoresis verification results in Example 1 of the present invention.

[0035] Figure 2 1 and 2 are graphs showing the analysis results of mRNA expression in Example 1 of the present invention, wherein (a) is a graph showing the analysis results of the ACS1 gene, and (b) is a graph showing the analysis results of the ACS2 gene.

[0036] Figure 3 This is a graph showing the results of measuring acetic acid content in Example 1 of the present invention.

[0037] Figure 4 This is a diagram of the fluorescence microscope observation results in Example 1 of the present invention.

[0038] Figure 5 This is a diagram showing the quantitative analysis results of the green fluorescent protein level in Example 1 of the present invention.

[0039] Figure 6 This is a diagram of the transparent circle identification result in the first embodiment of the present invention.

[0040] Figure 7 This is a diagram of the SDS-PAGE protein gel identification results in Example 1 of the present invention.

[0041] Figure 8 This is a graph showing the acetic acid production results in Example 1 of the present invention.

[0042] Fig. 9 This is a diagram showing the total nitrogen purification effect of sewage in Example 1 of the present invention.

[0043] Fig.10 This is a diagram of the COD purification effect of sewage in Example 1 of the present invention. DETAILED DESCRIPTION

[0044] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples without specifying specific conditions are usually carried out under conventional conditions or under conditions recommended by the manufacturer.

[0045] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, it indicates the presence of features, steps, operations, devices, components and / or combinations thereof.

[0046] Embodiment 1

[0047] 1. Obtaining uracil-deficient mutants of Candida tropicalis

[0048] The target strain of Candida tropicalis preserved in the laboratory was subjected to atmospheric pressure room temperature plasma (ARTP) mutagenesis and nitrosoguanidine chemical mutagenesis. After double multiple screening, single colonies were spotted on supplemented and basic medium plates for mutant reversion mutation verification experiments. Finally, a uracil-deficient mutant was screened out and named Candida tropicalisCBW-2ΔURA3 (deposited in the General Microbiology Center of China Microbiological Culture Collection Administration, the address is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with a deposit number of CGMCC No.31647 and a deposit date of August 9, 2024, hereinafter referred to as C.tropicalis C1.

[0049] The C. tropicalis C1 strain was subcultured several times, the genomic DNA of the mutant was extracted, and the URA3 gene fragment was amplified by PCR and sequenced. The results showed that the URA3 gene had stable mutations and base deletions, and no reversion mutation occurred.

[0050] Since the deletion of URA3 gene leads to the inactivation of orotidine 5-phosphate decarboxylase, the mutant is identified as uracil-deficient. The orotidine 5-phosphate decarboxylase in C. tropicalis C1 strain is inactivated and cannot grow normally in the basic medium without uracil, but grows normally in the supplemented medium plate supplemented with uracil, laying an important foundation for the subsequent transformation of tropical Candida.

[0051] 2. Knockout of ACS genes

[0052] Using the genome of Candida tropicalis as a template and primers ACS1-UHA-F and ACS1-UHA-TrpB-R as primers, PCR amplification was performed to obtain the upper homologous arm ACS1-UHA of the ACS1 gene. PCR amplification was performed using primers TrpB-ACS1-DHA-F and ACS1-DHA-R to obtain the lower homologous arm ACS1-DHA of the ACS1 gene.

[0053] The genome of Bacillus subtilis was used as a template, and PCR amplification was performed with primers ACS1-UHA-TrpB-F and TrpB-URA3-R to obtain the TrpB fragment. The ACS1-UHA and TrpB fragments were connected to obtain the fusion fragment ACS1-UHA-TrpB. The PUC-URA3 plasmid was digested with Bgl II and EcoR I, and then connected with the fusion fragment ACS1-UHA-TrpB to obtain the recombinant plasmid PUC-ACS1-UHA-TrpB-URA3.

[0054] ACS1-DHA was connected to the TrpB fragment to obtain the fusion fragment TrpB-ACS1-DHA; the PUC-ACS1-UHA-TrpB-URA3 plasmid was digested with Kpn I and Xba I, and then connected to the fusion fragment TrpB-ACS1-DHA to obtain the recombinant plasmid PUC-ACS1-UHA-TrpB-URA3-TrpB-ACS1-DHA.

[0055] A similar method was used to construct the recombinant plasmid PUC-ACS2-UHA-TrpB-URA3-TrpB-ACS2-DHA.

[0056] Among them, the primer sequences are shown in the following table as SEQ ID No. 1 to 18, that is, as shown in Table 1.

[0057] Table 1

[0058]

[0059] Use a pre-cooled 2mm electroporation cup for electrotransformation, draw an appropriate amount of transformed bacterial solution and apply it to the basic plate, incubate at 30℃ for 3 days, and observe the growth of the colonies. If colonies grow on the SM-5-fluoroorotic acid plate, it is temporarily considered that the plasmid fragment matches the ACS1 gene on the chromosome and the URA3 gene is successfully ejected. Draw an appropriate amount of bacterial solution to extract yeast genomic DNA and perform PCR verification using ACS1-YZ-F and ACS1-YZ-R primers. The strain is named C. tropicalis C1-1.

[0060] A similar method was used to verify that the ACS2 gene was successfully knocked out, and the strain was named C. tropicalis C1-2.

[0061] RNA from C. tropicalis C1, C. tropicalis C1-1, and C. tropicalis C1-2 strains was extracted for qRT-PCR reaction, and the extracted RNA fragments were verified by electrophoresis. The results are as follows Figure 1As shown. RNA with qualified quality was selected as template to synthesize cDNA for qRT-PCR analysis of ACS1 gene. The log(2-ΔΔct) method was used and the mRNA expression of URA3 gene was set as 100% for analysis. The analysis results are shown in Figure 2 As shown in (a); RNA with qualified quality was selected as a template to synthesize cDNA for qRTPCR analysis of the ACS2 gene. The log (2-ΔΔct) method was used to set the mRNA expression level of the URA3 gene to 100% for analysis. The analysis results are shown in Figure 2 As shown in (b) in .

[0062] From the experimental results Figure 2 (a) It can be seen that one copy of the ACS1 gene was knocked out in the C. tropicalis C1-1 strain, the transcription level of the ACS1 gene was reduced, and the relative expression level was reduced by 30.13%; from the experimental results Figure 2 As can be seen in (b), one copy of the ACS2 gene was knocked out in the C. tropicalis C1-2 strain, and the transcription level of the ACS1 gene was significantly reduced, with the relative expression level reduced by 47.94%. At the transcription level, it was proved that knocking out one copy of ACS1 and ACS2 alone could reduce the relative expression of ACS1 and ACS2 genes, and the transcription level of genes in the acetic acid metabolic pathway may be affected.

[0063] The activated C. tropicalis C1, C. tropicalis C1-1, and C. tropicalis C1-2 strains were inoculated into 20 ml of basic culture medium at a rate of 5%, cultured for 24 hours, and the supernatant was taken for detection using HPLC instrument. The results were as follows: Figure 3 shown.

[0064] Figure 3 Among them, the acetic acid production of C. tropicalis C1 strain was 0.759 g / L; the acetic acid production of C. tropicalis C1-1 strain was 1.458 g / L; and the acetic acid production of C. tropicalis C1-2 strain was 2.082 g / L. Therefore, the C. tropicalis C1-2 strain was selected for subsequent transformation. From the results of acetic acid determination, it was found that the single copy knockout of the ACS2 gene would reduce the protein expression level of acetyl-CoA synthetase and reduce the consumption of acetic acid, thereby promoting the accumulation of acetic acid in tropical Candida.

[0065] 3. Proteomic Analysis of Promoter Strength and Verification

[0066] After the activation of C. tropicalis C1 strain, it was inoculated into 50 mL YPD liquid medium at a 1% inoculum. Two groups were set up, each with three replicates. One group was placed in a 30°C constant temperature incubator for static culture, and the other group was placed in a shaking incubator at 30°C and 180 r / min. 1 mL of sample was taken every 2 hours to detect OD 600 , and a growth curve was drawn. The results showed that the strain was in a static period from 0 to 10 hours, and the cell metabolic growth activity was slow; the cell growth rate of the strain increased exponentially from 10 to 22 hours, and the metabolism was vigorous; the cell number reached a peak at 24 to 38 hours. Therefore, 5 mL of samples were taken at 8 hours in the static period, 14 hours in the logarithmic growth period, and 24 hours in the stable period of the strain, respectively, to obtain three groups of differentially upregulated protein detection samples for proteomic analysis. Among them, the iTRAQ (Isobaric Tags for Relative and Absolute Quantitation) technology was used to label proteins or peptide ends to realize the qualitative and quantitative analysis of proteins.

[0067] The first ten representative proteins that were significantly upregulated under different culture conditions were selected, and three significantly upregulated proteins were randomly selected from them. The gene information was obtained by querying the NCBI website, and the promoters of GADPH, PGK, and FBA1 genes were selected for subsequent experiments.

[0068] The sequence of the promoter is as follows.

[0069] P GAPDH It is the promoter of the GADPH gene, as shown in SEQ ID No.35:

[0070] 。

[0071] P PGK It is the promoter of PGK gene, as shown in SEQ ID No.36:

[0072] 。

[0073] P FBA1 is the promoter of the FBA1 gene, as shown in SEQ ID No.37:

[0074] 。

[0075] Candida tropicalis CBW-2 (deposited in the General Microbiology Center of China Microbiological Culture Collection Administration, Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC No.31646 and the deposit date August 9, 2024) was used as the template and P GAPDH -F, P GADPH -GFP-R was used as primer, and PCR cloning obtained a band of about 1000 bp, which was close to the theoretical value of 1000 bp. The target fragment was recovered in liquid; GADPH -GFP-F and GFP-TR were used as primers, and PCR cloning obtained a band of about 700 bp, which was close to the theoretical value of 714 bp. The target fragment was recovered in liquid; fusion PCR was used to obtain the target fragment with P GAPDH -F, GFP-TR were used as primers, and the PCR clone obtained a band of about 1800 bp, which was close to the theoretical value of 1714 bp. The liquid was sent to a third party for sequencing, and the sequence alignment was consistent, so it was considered that P GADPH -GFP fusion was successful. PGK -GFP, P FBA1 -GFP fragment.

[0076] The PYES2-URA3 plasmid was digested with Kpn I and the P GADPH -GFP fragment was ligated with PYES2-URA3 plasmid digested with KpnI to obtain PYES2-P GADPH -GFP-URA3 plasmid; transform the ligation product into E.coliDH5α, spread it on an LB plate containing Amp resistance and culture it overnight, pick a single colony, and use the verification primers PYES2-YZ-F and PYES2-YZ-R on the vector to perform colony PCR screening and verification, and obtain a band of about 2000bp, which is close to the theoretical value of 1894bp. The plasmid that may be successfully connected is inoculated in LB liquid culture medium, and the extracted plasmid is sent to a third party for sequencing. The sequence alignment is correct and will be used for subsequent experiments. Obtained by similar methods

[0077] PYES2-P PGK -GFP-URA3 and PYES2-P FBA1 -GFP-URA3 plasmid.

[0078] Table 2

[0079]

[0080] 10 μL of concentrated PYES2-P was used for electroporation GADPH-GFP-URA3 plasmid was introduced into competent Candida tropicalis, and the genome of the colonies growing on the basic plate was verified by PCR using primers PYES2-YZ-F and PYES2-YZ-R. The successfully transformed strain was named C. tropicalis C1-4-1. PYES2-P was transformed in a similar manner. FBA1 -GFP-URA3, PYES2-P PGK -GFP-URA3 plasmid, and the strains were named C. tropicalis C1-4-2 and C. tropicalis C1-4-3, respectively.

[0081] C. tropicalis C1, C. tropicalis C1-4-1, C. tropicalis C1-4-2 and C. tropicalis C1-4-3 were inoculated from the plate into the basic liquid culture medium and cultured until the bacterial OD600 reached 2.0. After washing with PBS buffer for 2-3 times, the fluorescence of each strain was observed using a fluorescence microscope. The results are shown in the figure. Figure 4 As shown in the figure, the C1 (C. tropicalis C1) strain does not produce green fluorescence under the stimulation of ultraviolet excitation light; the 4-1 (C. tropicalis C1-4-1) strain produces strong and stable green fluorescence under the stimulation of ultraviolet excitation light; the 4-2 (C. tropicalis C1-4-2) strain can be observed to have stronger green fluorescence under extended exposure time; the 4-3 (C. tropicalis C1-4-3) strain can be observed to have weaker green fluorescence and is unstable under extended exposure time.

[0082] The green fluorescent protein levels of C. tropicalis C1, C. tropicalis C1-4-1, C. tropicalis C1-4-2, and C. tropicalis C1-4-3 strains were quantitatively analyzed using a cell imaging microplate. The results were basically consistent with those observed under a fluorescence microscope. Figure 5 shown.

[0083] The expression intensities of the three promoters were determined based on the qualitative analysis of green fluorescent protein fluorescence microscopy and cell fluorescence microplate and the quantitative analysis of total RNA extracted by qRT-PCR, which was consistent with the results obtained by proteomics analysis. GADPH Promoter for subsequent experiments.

[0084] 4. Heterologous expression of α-amylase in Candida tropicalis

[0085] Through literature reading and NCBI database screening, four α-amylase gene sequences from fungi were obtained, including Aspergillus salbicans, Aspergillus niger, Sulfolobus solfataricus and Schwanniomycess occidentalis.

[0086] The NCBI accession number of the selected α-amylase gene sequence is GAA83911.1, CAK48325.1, AAK41260.1 or AAB22383.2. The plasmids constructed by a third party company are shown in Table 3.

[0087] Table 3

[0088]

[0089] The PYES2-PGADPH-AL-URA3 plasmid was concentrated by ethanol concentration, and the concentration of the concentrated and recovered plasmid was measured by a nucleic acid microspectrophotometer. 10 μL of the concentrated plasmid was mixed with the tropical Candida competent medium, electroshocked twice at 1500V and 5ms, plated, and cultured overnight. Colony PCR was performed on PYES2-YZ-2-F and PYES2-YZ-2-R ​​shown in Table 4 using primers, and the strain after successful electrotransformation of the plasmid was named C. tropicalisC1-2-1. Plasmid PYES2-P was electrotransformed separately according to a similar method. GADPH- AN-URA3, PYES2-P GADPH -SS-URA3 and PYES2-P GADPH -SO-URA3, and the strains after successful electrotransformation were named C. tropi-calis C1-2-2, C. tropicalis C1-2-3 and C. tropicalis C1-2-4.

[0090] Table 4

[0091] Sequence Listing Number name Base sequence (5'-3') SEQ ID No.33 PYES2-YZ-2-F GCTTTTTGCTCTCTGACTCCTCCCAATCAG SEQ ID No.34 PYES2-YZ-2-R CATAACTAATTACATGATGCGGCCCTCTAG

[0092] C. tropicalis C1-2-1, C. tropicalis C1-2-2, C. tropicalis C1-2-3 and C. tropicalis C1-2-4 verified by colony PCR were transferred to activation plates, and single colonies were picked and dotted on the plates (the culture medium in the plates used soluble starch as the carbon source), and placed in a 30°C constant temperature incubator overnight until colonies grew on the plates. The plates were taken out and iodine solution was poured into the plates, and placed in a 4°C refrigerator for several hours to check whether transparent circles were produced in the plates and the size of the transparent circles. The results are as follows Figure 6 As shown. The diameter of the transparent circle indirectly indicates the strength of the α-amylase activity among the strains. The larger the diameter, the stronger the α-amylase activity. As can be seen from the figure, the diameter of the starch transparent circle of C. tropicalis-2-1 and C. tropicalis-2-2 strains is relatively larger, and the α-amylase activity of these strains is higher.

[0093] C. tropicalis C1-2, C. tropicalis C1-2-1, C. tropicalis C1-2-2, C. tropicalis C1-2-3, and C. tropicalis C1-2-4 were cultured until OD600 was about 2.0, 5 mL of bacterial solution was collected by centrifugation at 10000 r / min for 5 min, protein samples were prepared, and the expression of total protein in the bacteria was determined. Figure 7 shown.

[0094] The molecular weight of α-amylase protein is about 45 kDa. Figure 7 As shown in the green box in the figure, columns 1 to 4 are from C. tropicalis C1-2-1; columns 5 to 7 are from C. tropicalis C1-2-2; columns 8 to 10 are from C. tropicalis C1-2-3, columns 11 to 13 are from C. tropicalis C1-2-4; and column 14 is from C. tropicalis C1-2. There is an obvious and clear band at around 40-50 kDa, while the band in column 14 representing C. tropicalis C1-2 is darker and more blurred. The above results indicate that α-amylase was successfully heterologously expressed in Candida tropicalis.

[0095] Using C. tropicalis C1-2 as a control bacterium, C. tropicalis C1-2-1, C. tropicalis C1-2-2, C. tropicalis C1-2-3, and C. tropicalis C1-2-4 were transferred to 50 mL of a supplemented medium with soluble starch as a carbon source at a 5% inoculum and cultured for 24 hours. The supernatant was collected by centrifugation at 12000 r / min for 5 minutes, boiled for 5 minutes, and centrifuged again at 12000 r / min for 5 minutes to collect the supernatant. The supernatant was filtered through a 0.22 μm organic filter and the acetic acid content was detected by HPLC. The results are as follows: Figure 8 As shown. The C.tropicalisC1-2 control strain with starch as the carbon source grew poorly and the acetic acid content was only 0.721g / L, which was quite different from the acetic acid content when glucose was used as the carbon source; the four experimental strains such as C.tropicalis C1-2-1 grew well when starch was used as the carbon source, but their acetic acid production was significantly different. For example, the acetic acid production in the supernatant obtained by culturing C.tropicalis C1-2-1 for 24 hours could reach 1.592g / L, which was about 1 times higher than that of C.tropicalis C1-2; the acetic acid production in the supernatant obtained by culturing C.tropicalisC1-2-3 for 24 hours could reach 0.699g / L, which was basically the same as that of C.tropicalis C1-2; the acetic acid production in the supernatant of C.tropicalis C1-2-2 and C.tropicalis C1-2-4 for 24 hours was between that of C.tropicalis C1-2-1 and C.tropicalis C1-2-3. In summary, after culturing for 24 h in the supplemented medium with starch as the carbon source, the C. tropicalis C1-2-1 strain produced the highest acetic acid content, up to 1.592 g / L, and had good growth. Therefore, the C. tropicalis C1-2-1 strain was selected as the target strain for subsequent experiments.

[0096] 5. Combined cultivation with denitrification strains to treat total nitrogen in sewage

[0097] The heterotrophic nitrification-aerobic denitrification strain P.stutzeriSDU10 has strong environmental tolerance and overcomes the defects of traditional biological denitrification. At the same time, P.stutzeriSDU10 can simultaneously perform nitrification and denitrification, reducing the treatment cost and cycle, and providing a good alternative strain for reducing the total nitrogen content in sewage. When sodium acetate is used as a carbon source, the P.stutzeriSDU10 strain has a good denitrification effect, and the total nitrogen removal rate reaches 83.4%. The following intends to use the high acetic acid production of the C.tropicalis strain to provide a carbon source for the P.stutzeriSDU10 strain, and reduce the total nitrogen content in sewage through co-cultivation.

[0098] For basic information on the P. stutzeri SDU10 strain, see the following paper: Chen Lifei. Analysis of microbial community structure in microbial nest treatment of pig manure and research on denitrification bacteria screening and bioaugmentation [D]. Shandong University, 2022.

[0099] When the initial total nitrogen concentration and COD concentration were 100 mg / L and 1190 mg / L, two inoculation methods were used. The first inoculation method was to inoculate C. tropicalis C1-2-1 and P. stutzeri SDU10 into the food waste sewage at the same time at an inoculation rate of 5%. The second inoculation method was to first inoculate C. tropicalis C1-2-1 into the food waste sewage at an inoculation rate of 5% and culture it for 24 hours, and then inoculate P. stutzeri SDU10 into the same food waste sewage at an inoculation rate of 5%. 5 mL of samples were taken every 12 hours to measure the total nitrogen concentration and COD concentration.

[0100] After 48 hours, the total nitrogen content of the wastewater inoculated with C. tropicalis C1-2-1 and P. stutzeri SDU10 was 29.14 mg / L (e.g. Fig. 9 (A)), COD concentration is 276 mg / L (as shown in Fig.10 (A)), the removal rates were 70.86% and 76.81% respectively; after adding C. tropicalis C1-2-1 and culturing for 24h, 5% inoculum of P. stutzeri SDU10 was added, and the total nitrogen content of the sewage was 21.70 mg / L (as shown in Fig. 9 (B)), COD concentration is 197.3 mg / L (as shown in Fig.10 (B) shows that the removal rates are 78.3% and 83.42% respectively. Fig.10 In contrast, the second inoculation method of "first before and then after" significantly improved the removal rates of total nitrogen and COD.

[0101] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. An engineered strain of Candida tropicalis, characterized in that: Using Candida tropicalis CBW-2ΔURA3 as the chassis strain, the ACS gene was knocked out and a promoter was introduced to heterologously express the α-amylase gene; The starting strain of the chassis strain is Candida tropicalis; the promoter is an endogenous promoter; The Candida tropicalis CBW-2ΔURA3 was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on August 9, 2024, with the deposit number CGMCC No.31647.

2. The engineered Candida tropicalis according to claim 1, characterized in that The ACS gene includes: ACS1 gene and / or ACS2 gene.

3. A method for preparing the engineered Candida tropicalis according to any one of claims 1 to 2, comprising the steps of: S1. Using Candida tropicalis CBW-2ΔURA3 as the chassis strain, an engineered Candida tropicalis strain with a single copy knockout of the ACS gene was constructed. S2, culturing tropical Candida engineered bacteria under static and shaking culture conditions, screening the promoter corresponding to the protein efficiently expressed under both static and shaking culture conditions as a strong promoter of tropical Candida; S3, screening and obtaining an α-amylase gene sequence from a fungus, and constructing a transformation plasmid containing the promoter obtained in S2 and the α-amylase gene sequence from a fungus; S4. Using the transformation plasmid obtained in S3, the ACS gene single copy knockout engineered bacteria obtained in S1 were transformed to obtain Candida tropicalis α-amylase engineered bacteria.

4. The method for preparing the Candida tropicalis α-amylase engineered bacteria according to claim 3, characterized in that: In S2, the promoter sequence is shown as SEQ ID No.35, SEQ ID No.36 or SEQ ID No.

37.

5. The method for preparing the Candida tropicalis α-amylase engineered bacteria according to claim 3, characterized in that: In S2, samples were taken during the stationary phase, logarithmic growth phase, and stable phase of the strain for proteomic analysis.

6. The method for preparing the Candida tropicalis α-amylase engineered bacteria according to claim 3, characterized in that: In S3, the α-amylase gene sequence is derived from Aspergillus salbicans, Aspergillus niger, Sulfolobus solfataricus or Schwanniomycess occidentalis.

7. The method for preparing the Candida tropicalis α-amylase engineered bacteria according to claim 3, characterized in that: In S3, the NCBI accession number of the α-amylase gene sequence is GAA83911.1, CAK48325.1, AAK41260.1 or AAB22383.

2.

8. The method for preparing the Candida tropicalis α-amylase engineered bacteria according to claim 3, characterized in that: In S4, after the transformation is completed, the engineered bacteria with high α-amylase expression activity are screened.

9. A method for treating sewage, characterized in that: Co-culturing the tropical Candida α-amylase engineered bacteria and the heterotrophic nitrification-aerobic denitrification strain in sewage; The sewage contains starch components and includes food waste sewage.

10. A sewage treatment method according to claim 9, characterized in that: The combined culture method comprises: firstly inoculating tropical Candida engineered bacteria into sewage at an inoculation amount of 5 to 10%, and 24 to 36 hours later, inoculating heterotrophic nitrification-aerobic denitrification strains into sewage at an inoculation amount of 5 to 10%; Optionally, the heterotrophic nitrification-aerobic denitrification strain includes: P. stutzeri SDU10 strain.

Images