Steroid 11 beta-hydroxylase mutant recombinant penicillium raistri and application thereof

Abstract

The invention discloses construction and application of a strain for efficiently preparing hydrocortisone from penicillium raistri, and belongs to the technical field of genetic engineering. According to the invention, a penicillium raistri chassis strain suitable for expressing exogenous hydroxylase is obtained through CRISPR-Cas9 (clustered regularly interspaced short palindromic repeats-associated protein 9) editing, and a penicillium raistri recombinant bacterium capable of efficiently and heterologously expressing the absidia coerulea C11 beta-hydroxylase CYP5103B2 R126D mutant is constructed. The total feeding amount of the substrate 11-deoxycorticosterol-21-acetate is 3.5 g / L, and the yield of the product hydrocortisone reaches 78%. The invention provides a valuable technical method and an industrial strain for researching and developing a process for efficiently producing hydrocortisone by using the Rissiqing recombinant bacterium.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and specifically relates to the construction and application of Penicillium reis strains for efficiently preparing hydrocortisone. Background Art

[0002] Hydrocortisone (HC) is an important glucocorticoid and an important intermediate for the synthesis of other glucocorticoid drugs. It is mainly used in the treatment of collagen diseases, lupus erythematosus, and rheumatoid arthritis in clinical practice.

[0003] In industry, Absidia coerulea is mainly used to convert 11-deoxycortisol-21-acetate (RSA) into 11-deoxycortisol (RS), and then a hydroxyl group is introduced at the C11β position to synthesize hydrocortisone. The conversion process is as follows: Figure 1 Since the hydroxylation specificity of Absidia cyanobacteria is poor and there are many by-products, a new expression host of the C11β-hydroxylase gene was sought in order to obtain a recombinant strain that can efficiently produce hydrocortisone.

[0004] At present, Saccharomyces cerevisiae is commonly used as the expression host of C11β-hydroxylase gene. This method has the advantages of easy gene manipulation and screening in enzyme molecule modification, but it still has disadvantages such as low feed amount and slow conversion rate in the process of preparing hydrocortisone. In contrast, Penicillium raistrickii ATCC 10490 itself has good steroid conversion ability, and after modification by CRISPR-Cas9 gene editing technology, it is more suitable as the host of C11β-hydroxylase gene. Summary of the invention

[0005] The C11β-hydroxylase gene mutant CYP5311B2E232D with high hydroxylation specificity constructed in the laboratory in the early stage provided genetic resources for the construction of a new recombinant strain of Penicillium reisensis for the efficient production of hydrocortisone.

[0006] The technical route of the present invention is as follows: The present invention replaces the C15α-hydroxylase gene PRH in Penicillium reticulum by CRISPR-Cas9 editing with the C11β-hydroxylase gene CYP5311B2E232D, and obtains a Penicillium reticulum reticulum reticulum reticulum reticulum reticulum reticulum reticulum reticulum reticulum reticulum reticulum for industrial and efficient preparation of hydrocortisone, which provides a reference for the C11β-hydroxylation process. The steps of obtaining the recombinant host bacteria of Penicillium reticulum reticulum reticulum with the C11β-hydroxylase gene CYP5311B2 using CRISPR-Cas9 gene editing technology are as follows:

[0007] (1) Determine the PRH gene sequence targeted by Cas9;

[0008] (2) Constructing the expression vector pLM1-gRNA-1-2-Cas9 containing the AMA1 sequence, two gRNA expression cassettes, and one Cas9 expression cassette;

[0009] (3) The recombinant expression vector in (2) is transformed into wild Penicillium repens by protoplast transformation method for gene editing;

[0010] (4) extracting the genome of the obtained transformants and performing sequencing verification to obtain a Penicillium reis host strain with an inactivated C15β-hydroxylase gene PRH;

[0011] (5) The transformants were transferred to antibiotic-free PDA test tubes and cultured until spores were produced. The mold spores were washed with sterile ddH2O and diluted and plated;

[0012] (6) After the colonies grew, they were spotted onto 300 mg / ml hygromycin B and non-antibiotic PDA plates to screen for Penicillium reis host strains that lacked the C15β-hydroxylase gene PRH and the pLM1-gRNA-1-2-Cas9 vector.

[0013] (7) Construction of the target gene expression vector pBlue-pAOH-CYP5311B2 E232D.

[0014] (8) The expression vector pBlue-pAOH-CYP5311B2 E232D in (7) was transformed into the C15β-hydroxylase gene PRH-inactivated Penicillium repens strain using the protoplast transformation method to obtain a recombinant strain.

[0015] The nucleotide sequence of the Absidia corytae C11β-hydroxylase mutant gene CYP5311B2 E232D of the present invention is shown in SEQ ID NO.1, and the above sequence belongs to the protection scope of the present invention.

[0016] The recombinant expression vector, recombinant expression plasmid or host cell constructed by using the gene fragment CYP5311B2 E232D encoding C11β-hydroxylase of the present invention also belongs to the protection scope of the present invention, and the amplification primer sequence used also belongs to the protection scope of the present invention.

[0017] The steroid hydroxylase encoded by the mutant gene CYP5311B2 E232D obtained by semi-rational design and site-directed mutagenesis in the present invention includes but is not limited to expression in host cells such as Saccharomyces cerevisiae, Pichia pastoris, Absidia corymbe, and Penicillium reisen.

[0018] Beneficial effects: The present invention uses CRISPR-Cas9 gene editing technology to transform wild Penicillium reis, obtains a Penicillium reis host strain with inactivated C15α-hydroxylase gene PRH, and then uses CRISPR-Cas9 technology to obtain a recombinant Penicillium reis for efficiently preparing hydrocortisone. The hydroxylation specificity of the recombinant Penicillium reis is improved and the feed amount reaches 3.5g / L, and the yield of the product hydrocortisone reaches 78%. The research results of the present invention have great industrial application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 C11β-hydroxylation of 11-deoxycortisol-21-acetate (RSA);

[0020] Figure 2 Schematic diagram of the pLM1-gRNA-1-2-Cas9 expression vector;

[0021] Figure 3 Schematic diagram of the pBlue-pAOH-CYP5311B2 E232D expression vector;

[0022] Figure 4 Schematic diagram of pLM1-pAOH-CYP5311B2 E232D expression vector

[0023] Figure 5 The yield of hydrocortisone prepared by recombinant Penicillium repens at a feed rate of 3.5 g / L 11-deoxycortisol-21 acetate. DETAILED DESCRIPTION

[0024] The method of the present invention is described below by specific embodiments. The experimental methods in the following examples are conventional methods unless otherwise specified. The embodiments should be understood to be illustrative rather than limiting the scope of the present invention, and the essence and scope of the present invention are limited only by the claims. The test materials used in the following examples are purchased from conventional biochemical reagent stores unless otherwise specified.

[0025] The present invention involves strains: Escherichia coli JM109, Penicillium raistrckii ATCC 10490, and the Microbial Culture Collection Center of Tianjin University of Science and Technology.

[0026] Example 1 Using CRISPR-Cas9 gene editing technology to obtain a Penicillium reishi host strain with a C15β-steroid hydroxylase gene PRH deletion

[0027] 1. Determination of Cas9-targeted PRH gene sequence

[0028] Target-1:GGGGGTGTGCGTTGCCTTGC

[0029] Target-2: CAGTAGTTCAACCGTGGGGT

[0030] 2. Construction of pBlue-PU6-gRNA-1-TU6, pBlue-PU6-gRNA-2-TU6 and pBlue-gRNA-1-2 vectors

[0031] Plasmid pBlue-PU6-gRNA-TU6 was used as a template and 11β-gRNA-1-F / R was used as a primer for polymerase chain reaction to obtain the target vector fragment pBlue-PU6-gRNA-1-TU6, and 11β-gRNA-2-F / R was used as a primer for polymerase chain reaction to obtain the target vector fragment pBlue-PU6-gRNA-2-TU6. The primers were synthesized by Beijing BGI.

[0032] 11β-gRNA-1-F:GGGGGTGTGCGTTGCCTTGCGTTTTAGAGCTAGAAATAGCAAG

[0033] 11β-gRNA-1-R:GCAAGGCAACGCACACCCCCACTTGTTCTTCTTTACAATGATT

[0034] 11β-gRNA-2-F:GGGGGTGTGCGTTGCCTTGC GTTTTAGAGCTAGAAATAGCAAG

[0035] 11β-gRNA-2-R: CAGTAGTTCAACCGTGGGGTACTTGTTCTTCTTTACAATGATT

[0036] PCR reaction system (Total 50μl):

[0037]

[0038] PCR procedure:

[0039]

[0040] 2 μl of PCR product was subjected to agarose gel electrophoresis to verify its band size. The PCR product was digested with Dpn I and purified and recovered, and the recovered product was transformed into competent E. coli JM109, and the transformant was picked to extract the plasmid, and sequencing was performed to verify that it was correct, thus obtaining pBlue-PU6-gRNA-1-TU6 and pBlue-PU6-gRNA-2-TU6 plasmids.

[0041] pBlue-PU6-gRNA-1-TU6 was digested with Kpn I to prepare a homologous recombination backbone. Primers with homology arms were designed using pBlue-PU6-gRNA-2-TU6 as a template to amplify the PU6-gRNA-2-TU6 target fragment. 2 μl of the digested product and 2 μl of the PCR product were taken for agarose gel electrophoresis to verify the band size. After digestion and purification of the PCR product, the target fragment and the backbone were homologously recombined, and the recombinant system was transformed into Escherichia coli JM109 competent cells. The transformants were picked to extract the plasmid, and sequencing was verified to be correct, thus obtaining the pBlue-gRNA-1-2 plasmid. The primers were synthesized by Beijing BGI.

[0042] pBlue-gRNA-2-F: CTCGAGGGGGGGCCCGGTACTAATGCCGGCTCATTCAAACG

[0043] pBlue-gRNA-2-R:AGGGAACAAAAGCTGGGTACAGCAGCTCTATATCACGTGAC

[0044] PCR reaction system (Total 50μl):

[0045]

[0046] PCR procedure:

[0047]

[0048] Enzyme digestion reaction system (Total 50μl):

[0049]

[0050] Recombination reaction system (Total 10μl):

[0051]

[0052] 3. Construction of pLM1-gRNA-1-2-Cas9 vector

[0053] The pLM1-ΔgRNA-Cas9 plasmid stored in the laboratory was digested with Mlu I to prepare the homologous recombination backbone. The pBlue-gRNA-1-2 plasmid was used as a template to design primers with homology arms to amplify the target fragment containing two gRNA expression cassettes. 2μl of the digested product and 2μl of the PCR product were taken for agarose gel electrophoresis to verify their band sizes. After the PCR product was digested and purified, the target fragment and the backbone were homologously recombined, and the recombination system was transformed into Escherichia coli JM109 competent cells. The transformants were picked to extract the plasmids, and the sequencing was verified to be correct, and the following was obtained. Figure 2 The pLM1-gRNA-1-2-Cas9 plasmid shown in the figure was synthesized by Beijing BGI Corporation.

[0054] 2gRNA-F-Mlu I: CAGTGCCAAGCTTAACGCGTCTAATGCCGGCTCATTCAAACG

[0055] 2gRNA-R-Mlu I: CAATATCATCTTCTGACGCGAGCAGCTCTATATCACGTGAC

[0056] PCR reaction system (Total 50μl):

[0057]

[0058] PCR procedure:

[0059]

[0060] Enzyme digestion reaction system (Total 50μl):

[0061]

[0062] Recombination reaction system (Total 10μl):

[0063]

[0064]

[0065] Example 2 Protoplast transformation of pLM1-gRNA-1-2-Cas9 vector to construct recombinant Penicillium repens host bacteria

[0066] Mix 3-5 μg of recombinant plasmid pLM1-gRNA-1-2-Cas9 and 680 μl of pre-cooled PEG6000 solution and add 200 μl of concentration>10 8 / ml wild Penicillium reis protoplasts, mix upside down, and place on ice for 20 minutes;

[0067] Add 2 ml of PEG6000 buffer, mix gently by inversion, and place horizontally at room temperature for 10 min;

[0068] Add 4ml STC Buffer and 4ml upper culture medium preheated and mixed at 60℃, gently invert and mix, and then spread on the lower culture medium with hygromycin B concentration of 300mg / ml. Place the plate upright in a 28℃ incubator. After 5-7 days, transformants will grow. Transfer it to a test tube without anti-PDA and culture it until spores are produced. Extract the genome for sequencing verification, and obtain the host strain of Penicillium reis with PRH deletion in the C15α-hydroxylase gene. The PRH gene function deletion is confirmed by 11-deoxycortisol-21-acetate conversion experiment.

[0069] The above-mentioned Penicillium reis spores were washed with sterile water, diluted and plated, and after colonies grew, the colonies were spotted onto 300 mg / ml hygromycin B and non-antibiotic PDA plates at the same time, and the Penicillium reis host bacteria with C15β-hydroxylase gene PRH deletion and pLM1-gRNA-1-2-Cas9 vector were screened in 300 mg / ml hygromycin B to obtain.

[0070] Example 3 Obtaining the CYP5311B2 E232D mutant Penicillium reticulum reticulum reciprocal strain using protoplast fusion method

[0071] 1. Construction of pBlue-pAOH-CYP5311B2 E232D expression vector

[0072] The pBlue-pAOH recombinant plasmid constructed in the laboratory was used as a template to amplify the homologous recombination skeleton containing the CYP68J5 promoter and terminator with primers pBlue-pAOH backbone-F / RPCR. The pYes2-CYP5311B2 E232D plasmid was used as a template and the target fragment was amplified with F / R60-P7 (pAOH) for homologous recombination to obtain the expression vector pBlue-pAOH-CYP5311B2E232D. The plasmid map is shown in Figure 3 shown.

[0073] pBlue-pAOH Backbone-F:GAATTCGATAATGAGCTGTCAGCTTG

[0074] pBlue-pAOH Backbone-R: GACTAGTGTCGAACACGAAGTCCTG

[0075] F60-P7(pAOH): GACAGCTCATTATCGAATTCATGCTTACAGAGTACATTCATC R60-P7(pAOH): CTTCGTGTTCGACACTAGTCTTACTTTCTTGGCACAATCTTG

[0076] 2. Construction of pLM1-pAOH-CYP5311B2 E232D expression vector

[0077] The pLM1-ΔgRNA vector was digested with Mlu I to prepare the homologous recombination backbone, and the pBlue-pAOH-CYP531lB2E232D plasmid was used as a template and F / R58-pLM1 was used as a primer to amplify the target fragment. After verification by agarose gel electrophoresis, the recombinant expression vector was obtained by homologous recombination. Figure 4 pLM1-pAOH-CYP5311B2 E232D as shown. F58-pIM1: GACGGCCAGTGCCAAGCTTAACGCGGCAACTACCTCCTGATATGC

[0078] R58-pLM1:AACATATACTGGGCCCGGGTACCGCGGAGCTGTAGGTAAGGAATTG

[0079] 3. Construction of recombinant Penicillium reisensis expressing hydroxylase gene CYP5311B2 E232D mutant

[0080] The expression vector pLM1-pAOH-CYP5311B2 E232D constructed in 2 was transformed into the above-mentioned Penicillium rapae chassis fungus through protoplasts to obtain C11β mutant recombinant Penicillium rapae.

[0081] Example 4: Experimental study on the conversion of 11-deoxycortisol-21-acetate by recombinant Penicillium rapae using the CYP5311B2 mutant of the hydroxylated mold gene

[0082] The hydroxylase gene CYP5311B2 mutant recombinant Penicillium reis was used for the 11-deoxycortisol-21-acetate steroid conversion experiment. The spore suspension was cultured in a shaking incubator at 28°C for 24 hours and then the substrate was added. The feed amount of the substrate 11-deoxycortisol-21-acetate was 3.5 g / L. The fermentation conversion was sampled for 24h / 48h / 72h and extracted with ethyl acetate. The conversion was shown in the figure. Figure 5 shown.

[0083] The above embodiments only express several implementation methods of the present invention, but they are not intended to limit the present invention. It should be noted that any person skilled in the art can make several improvements to the above implementation methods without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention shall be subject to the content defined in the claims.

Claims

1. Steroid 11β-hydroxylase mutant CYP5311B2 E232D is characterized by: The amino acid sequence of the mutant is mutated on the sequence of the 11β-hydroxylase gene CYP5311B2 from Absidia cyanostriatus, that is, the amino acid at position 232 of the mutant is changed from glutamic acid to aspartic acid, and its sequence is shown in SEQ ID NO:

1.

2. A recombinant Penicillium repens, characterized in that: The CRISPR-Cas9 technology was used to obtain a Penicillium regiosum strain in which the steroid 15α-hydroxylase gene was deleted, and the CYP5311B2 E232D mutant nucleotide sequence shown in SEQ ID NO: 1 was constructed on a plasmid expression vector containing the AMA1 sequence, and expressed in a Penicillium regiosum chassis strain by protoplast transformation, thereby obtaining a recombinant Penicillium regiosum strain for efficiently preparing hydrocortisone.

3. The recombinant Penicillium repens strain according to claim 1, characterized in that Recombinant Penicillium reis can catalyze the substrate 11-deoxycortisol-21-acetate to produce hydrocortisone, with a total feed amount of 3.5 g / L.

Images