Method for improving size and grain weight of rape seeds by using gene editing technology and application of method

Abstract

The invention provides a method for improving the size and grain weight of rape seeds by using a gene editing technology and application of the method, and relates to the technical field of molecular breeding of crops. The method specifically comprises the following steps: (1) screening a target sequence at a position with high similarity degree of a brassica napus BnaRSL nucleotide sequence, and designing a corresponding target primer; the BnaRSL comprises three copy genes of BnaA9RSL, BnaC5RSL and BnaA10RSL, and the nucleotide sequences of the three copy genes of BnaA9RSL, BnaC5RSL and BnaA10RSL are respectively as shown in SEQ ID No. 1, SEQ ID No. 2 and SEQ ID No. 3; (2) constructing a CRISPR / Cas9 (clustered regularly interspaced short palindromic repeats / CRISPR associated protein 9) recombinant vector pBnaRSL for directional editing of the brassica napus by using the target primers; and (3) transforming the pBnaRSL vector into brassica napus so as to obtain a strain with increased seed size and grain weight of the brassica napus. According to the method provided by the invention, the size and weight of the rape seeds can be remarkably increased, a new germplasm and method are provided for high-yield breeding of the rape, and the method has a good application prospect.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular breeding of crops, and in particular relates to a method for increasing rapeseed seed size and grain weight by utilizing gene editing technology. Background Art

[0002] Rapeseed is a plant of the cruciferous family, belonging to the genus Brassica, and is rich in nutritional value. Currently, the main cultivated types of rapeseed are: Brassica rapa, Brassica juncea, and Brassica oleracea. Rapeseed is one of the most important oil crops in the world and an important source of edible oil for humans.

[0003] The scale of oilseed crop cultivation in my country is second only to grain crops. The stable production and effective supply of oilseed products provide important guarantees for national food security and people's well-being (Wang Hanzhong et al. 2014). Rapeseed seed size is not only an important economic trait, but also one of the determining factors of crop yield (Li et al. 2016, Li et al. 2021); the three factors that determine rapeseed yield are seed size and weight, number of siliques, and number of siliques per plant (Fu et al. 2015, Wang Jieli 2016). Therefore, it is urgent to improve rapeseed yield and cultivate high-yield rapeseed varieties through the study of the function of genes related to regulating seed size in Brassica napus.

[0004] The study found that BnaA9.RSL is a gene closely related to rapeseed seed size and oil content screened by Fox-hunting technology. However, there is no report on increasing seed size and weight based on BnaRSL functional loss in Brassica napus seeds. Summary of the invention

[0005] The object of the present invention is to provide a method for gene editing three copies of BnaRSL of Brassica napus by using CRISPR / Cas9 gene editing technology, so as to obtain Brassica napus germplasm with increased seed size and grain weight.

[0006] To achieve the above object, the present invention provides a method for increasing rapeseed seed size and grain weight using gene editing technology, comprising the following steps:

[0007] (1) Screening target sequences at positions with high similarity to the nucleotide sequence of Brassica napus BnaRSL, and designing corresponding target primers; the BnaRSL includes three copy genes, BnaA9RSL, BnaC5RSL, and BnaA10RSL, whose nucleotide sequences are shown in SEQ ID No. 1, SEQ ID No. 2, and SEQ ID No. 3, respectively;

[0008] (2) using the target primers to construct a CRISPR / Cas9 recombinant vector pBnaRSL for targeted editing of the Brassica napus;

[0009] (3) The pBnaRSL vector is used to transform Brassica napus to obtain a rapeseed line with increased seed size and grain weight.

[0010] In a preferred embodiment, in step (1), the target sequences screened include S1 and S2, and their nucleotide sequences are shown as SEQ ID No. 4 and SEQ ID No. 5, respectively.

[0011] In a preferred embodiment, in step (1), the target primers designed include:

[0012] The nucleotide sequences of the target primers corresponding to the target S1 are shown in SEQ ID No.6 and SEQ ID No.7;

[0013] The nucleotide sequences of the target primers corresponding to the target S2 are shown in SEQ ID No.8 and SEQ ID No.9.

[0014] In a preferred embodiment, in step (2), the construction of the CRISPR / Cas9 recombinant vector pBnaRSL for targeted editing of Brassica napus specifically comprises the following steps:

[0015] Connecting the designed target primer to the sgRNA target expression cassette;

[0016] Amplify different sgRNA target expression cassettes;

[0017] The sgRNA target expression cassette was ligated with the gene editing vector CRISPR / Cas9 P35SpHSE401 by enzyme digestion.

[0018] In a preferred embodiment, in step (3), the method of transforming Brassica napus with the pBnaRSL vector comprises: transforming using an Agrobacterium-mediated genetic transformation method.

[0019] The object of the present invention is to provide rapeseed germplasm with improved seed size and grain weight bred by any one of the above methods.

[0020] Another object of the present invention is to apply the method of increasing rapeseed seed size and grain weight by using any of the above-mentioned gene editing technologies in the field of rapeseed breeding.

[0021] Compared with the prior art, the technical solution of the present invention has the following advantages:

[0022] The present invention utilizes gene editing technology to mutate three copies of BnaRSL of Brassica napus, namely BnaA9RSL, BnaC5RSL and BnaA10RSL, and screens two target sequences at positions where the nucleotide sequences of the three copies have a high degree of similarity. Corresponding target sequence primers are designed to further construct a recombinant vector pBnaRSL for directional editing of the three copies of Brassica napus. The Brassica napus is transformed using an Agrobacterium-mediated genetic transformation method, thereby obtaining a strain with significantly increased seed size and weight.

[0023] The method provided by the present invention can significantly increase the size and weight of rapeseed seeds, provide new germplasm and methods for high-yield rapeseed breeding, and have good application prospects in the field of rapeseed breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] These and / or other aspects and advantages of the present invention will become more clear and easier to understand from the following detailed description of the embodiments of the present invention in conjunction with the accompanying drawings, in which:

[0025] Figure 1 Schematic diagram of the BnaRSL gene structure and binary expression vector containing the target sequence; A is the CRISPR-Cas9 targeted gene BnaRSL, the arrow area is the target site, and the arrow direction indicates the positive and negative strands of the target; B is a schematic diagram of the binary expression vector;

[0026] Figure 2 1.5% agarose gel detection of pBnaRSL transgenic material positive detection mutation site; wherein, the negative in the figure represents the negative control rapeseed variety Zhongshuang 9, the positive represents the positive control CRISPR BnaA9.RSL vector plasmid, and lanes 1-21 represent different transgenic plants;

[0027] Figure 3 The peak graph of the target gene amplified by specific primers; A is the peak graph of the sequencing of the target position of Zhongshuang 9; B is the peak graph of the sequencing of the target position of the mutant plant, and the arrow is the starting position of the mutation;

[0028] Figure 4 Identification of seed size and weight of mutant materials and recipient materials; A is the mature and dry rapeseed seeds of mutant materials and recipient materials, and B is the statistics of 1000-grain weight of mutant materials and recipient materials. Error bars represent the error of the mean value calculated from three groups of biological replicates. *, P < 0.05; **, P < 0.01; ***, P < 0.001 (t test). DETAILED DESCRIPTION

[0029] In order to enable those skilled in the art to better understand the present invention, the present invention is further described in detail below in conjunction with the accompanying drawings and specific implementation methods, but it should be understood that the protection scope of the present invention is not limited to the specific implementation methods.

[0030] The present invention provides a method and application thereof for increasing the seed size and grain weight of rapeseed by using gene editing technology, which specifically comprises: using gene editing technology to mutate three copies of BnaRSL of Brassica napus, BnaA9RSL, BnaC5RSL and BnaA10RSL, constructing a recombinant vector pBnaRSL for directional editing of three copies of Brassica napus, and transforming Brassica napus by using Agrobacterium-mediated genetic transformation method, thereby obtaining a strain with significantly increased seed size and weight.

[0031] Unless otherwise specified, the technical means used in the present invention are conventional means well known to those skilled in the art, and the various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods. The reagents used in the present invention are analytically pure unless otherwise specified.

[0032] Example 1 Amplification and nucleotide sequence analysis of BnaRSL gene

[0033] Primers were designed based on the reference genome sequence of Brassica napus Darmor (Chlhoub et al 2014) (see Table 1 below) to amplify three RSL copies BnaA9RSL, BnaC5RSL and BnaA10RSL present in the rapeseed transformation recipient variety Double 9, which are located on chromosomes A9, C5 and A10, respectively. The DNA sequences obtained by sequencing are shown in SEQ ID No.1, SEQ ID No.2 and SEQ ID No.3, respectively.

[0034] Table 1 Specific primer sequences for PCR amplification of different copies of BnaRSL

[0035] Primer Sequence(5'-3') BnaA9RSL-F CACCGAACAAGTAAAGC BnaA9RSL-R GTGAAAACATAAGACACAAATCC BnaC5RSL-F CGAACAAGTAAAGCAAGC BnaC5RSL-R AGGAACCTACATCTTTATCG BnaA10RSL-F GTAGCAAAGAAGTAAGGTCTCAAG BnaA10RSL-R GGAACCTACATTTTATGATTAAC

[0036] Example 2 Construction of BnaRSL gene editing transformation vector

[0037] Gene editing vector target site screening

[0038] Based on the nucleotide sequences of three copies of BnaA9RSL, BnaC5RSL and BnaA10RSL in Brassica napus, the online software CRISPR-P 2.0 (http: / / crispr.hzau.edu.cn / CRISPR2 / ) was used to design target sites, and a total of two target sites S1 and S2 were screened (see Figure 1The two selected target sites are both distributed in their functional domains, which is expected to cause mutations in the functional domains of the target genes, thereby leading to protein inactivation.

[0039] Table 2 Target sequences

[0040] Target name Target sequence (5'-3') Number in the sequence listing S1 TTATGTACCTCATCGTACTTGG SEQ ID No.4 S2 GCAAGCAAATAAACATAGGAGG SEQ ID No.5

[0041] Target primer design

[0042] The following target primers were further designed for the screened target sites (see Table 3 below).

[0043] Table 3 Target primer sequences

[0044]

[0045] Amplification of sgRNA expression cassette

[0046] Four-primer PCR amplification was performed using the pCBC-DT1T2 intermediate vector diluted 100 times as a template. DT1-BsF / DT2-BsR are normal primer concentrations; DT1-F 0 / DT2-R 0 Dilute 20 times. The PCR amplification system is shown in Table 4. The reaction conditions are 94℃ pre-denaturation for 3min; 98℃ for 15s, 60℃ for 30s, 68℃ for 40s, and amplification for 35 cycles; after the cycle is completed, continue to extend for 5min. The amplified product was detected by 1.5% agarose gel electrophoresis, and the size was 626bp.

[0047] Table 4 sgRNA expression cassette amplification reaction system

[0048]

[0049]

[0050] Ligation of dual-target sgRNA expression cassette and binary vector

[0051] The target sgRNA expression cassette was connected to the CRISPR / Cas9P35S pHSE401 vector by enzyme ligation. The enzyme ligation was performed by variable temperature cycling for 50 cycles, with reaction conditions of 37℃ for 20s, 37℃ for 3min, 16℃ for 4min; and finally 50℃ for 5min, 80℃ for 5min, and 20℃ for 2min. The system is shown in Table 5.

[0052] Table 5 Ligation reaction system of target sgRNA expression cassette and binary vector

[0053] Reagents Addition volume (μl) 10×ligase Buffer 1.5 10×Bsa Buffer 1.5 pHSE401 Plasmid 1 sgRNA expression cassette PCR amplification product 2 Bsa I-HF (10U / μl) 1 <![CDATA[T 4 DNAligase(400U / μl)]]> 1 <![CDATA[ddH 2 The]]> 7

[0054] Screening and identification of positive clones of target editing vector

[0055] 5 μl of the ligation product was transformed into E. coli competent cells using a universal heat shock transformation method, and the transformation product was spread on LB solid medium containing karatomycin (25 μg / ml).

[0056] Pick a monoclonal plaque and perform conventional colony PCR reaction with primers U626-IDF and U629-IDR to identify positive clones. The primer sequences are:

[0057] U626-IDF: TGTCCCAGGATTAGAATGATTAGGC; and,

[0058] U629-IDR: AGCCCTCTTTCTTTCGATCCATCAAC.

[0059] The positive clones were further sequenced, and the plasmid was extracted after the correct single colony was cultured for use. The plasmid was named pBnaRSL (eg Figure 1 (B).

[0060] Example 3: Transformation of Agrobacterium with BnaRSL Gene Editing Vector

[0061] The constructed plasmid pBnaRSL was introduced into Agrobacterium tumefaciens competent cells by electroporation.

[0062] First, take out 50 μl of GV3101 (pMP90) strain competent cells from the -80℃ refrigerator and place them on ice. After they are dissolved, use a pipette to take 1 μl (0.5 μg) of plasmid and add it to the competent cells and gently stir to mix. Then transfer the mixture into a pre-cooled electroporation cup, wipe the outside of the electroporation cup with absorbent paper, and then put it into an electroporator (Bio-Rad) and electroporate at 1800V for 6ms. Take out the electric transfer cup, add 400μl liquid LB, mix well and then pipette it into a sterilized 1.5ml centrifuge tube, and culture it on a constant temperature shaker (28℃, 200r / min) for 2h; on the clean bench, take 100μl of the cultured bacterial liquid and evenly spread it on the solid LB medium containing kanamycin (25μg / ml) and gentamicin (50μg / ml) resistance, and culture it upside down in a 28℃ constant temperature incubator for 2 days; pick a single colony for PCR detection again, expand it after confirming that it is correct, add an equal volume of sterilized 50% glycerol, and store it in a -80℃ refrigerator for use.

[0063] Example 4 Agrobacterium-mediated transformation and identification of rapeseed

[0064] (I) In this embodiment, the culture medium involved in the rapeseed genetic transformation process is as follows:

[0065] Minimal Medium M 0:1 / 2MS2.2g / L+sucrose 30g / L+Agar 7g / L, pH value is 5.8;

[0066] DM: MS 4.4g / L + sucrose 30g / L, sterilized, add 0.5ml AS per 1ml before use;

[0067] Co-culture medium M 1 :MS 4.4g / L+sucrose30 g / L+Mannitol 18g / L+2,4-D1mg / L+KT0.3mg / L+Agar 7g / L, pH 5.8, sterilized, add AS when cooling quickly;

[0068] Differentiation Medium M 2 :MS 4.4g / L+sucrose 30g / L+Mannitol 18g / L+2,4-D1mg / L+KT0.3mg / L+Agar 7g / L, pH 5.8, sterilized, add STS (15μl / 100ml), TMT (1 / 1000) and Hyg (1 / 2000) when cooling quickly;

[0069] Subculture proliferation medium M 3 :MS 4.4g / L+Glucose 10g / L+Xylose 0.25g / L+MES 0.6g / L+Agar 7g / L, pH 5.8, sterilized, add Zeatin (2.0mg / L), IAA (0.1mg / L), TMT (1 / 1000), Hyg (1 / 2000) and AgNO during rapid cooling 3 (0.15 / 1000);

[0070] Rooting Medium M 4 :MS 4.4g / L+sucrose 10g / L+Agar 7g / L, pH 5.8, sterilize, add TMT (1 / 1000) when cooling quickly;

[0071] 2,4-D stock solution concentration: 1mg / ml, take 0.1g powder and add 2ml 1ml / L NaOH to dissolve, and dilute to 100ml with distilled water;

[0072] The concentration of KT stock solution is 0.3mg / ml. Dissolve 0.03g powder in 2ml of 1ml / L NaOH, dilute to 100ml with distilled water, store at -20℃, and filter sterilize.

[0073] STS(AgNO 3 ): 0.1M sodium thiosulfate (1.58 g dissolved in 100 ml ddH 2O); 0.1MAgNO 3 (1.7 g dissolved in 100 ml ddH 2 O), AgNO 3 Press V Na2SO3 :V AgNO3 =4:1 volume ratio dissolved in sodium thiosulfate and filter sterilized.

[0074] Concentration of trans-ZT (Zeatin) stock solution: 2.0 mg / ml, take 100 mg (100 mg / tube package) and dissolve it in a small amount of 1 ml / L NaOH, then add water to make up to 50 ml, filter and sterilize;

[0075] The concentration of IAA stock solution is 0.1 mg / ml. Take 0.01 g and dissolve it in a small amount of 1 ml / L NaOH, then add water to make up to 100 ml and filter to sterilize.

[0076] Concentration of AS stock solution: 200mM, take 3.924g AS and dissolve it in dimethyl sulfoxide (DMSO), and make up to 100ml (no need to sterilize);

[0077] AgNO 3 Stock solution concentration: 20mg / ml, take 2.0g and dissolve in water, make up to 100ml, filter and sterilize;

[0078] The concentration of TMT mother solution is 300 mg / ml. Pour TMT powder into a beaker, add water until it is completely dissolved, adjust the volume, and filter to sterilize.

[0079] (ii) The pBnaRSL gene editing vector was transformed into the rapeseed line Zhongshuang 9 by Agrobacterium-mediated genetic transformation of rapeseed hypocotyls. The hypocotyls were cultured into seedlings through callus induction, bud differentiation subculture, rooting culture, etc., and then transplanted to greenhouses and fields for growth. The specific steps are as follows:

[0080] Sterile seedling culture

[0081] (1) Place an appropriate amount of mature Zhongshuang No. 9 seeds in a centrifuge tube, add 75% alcohol, and soak for 3 minutes, shaking up and down several times;

[0082] (2) After pouring off the alcohol, add an appropriate amount of 50% 84 disinfectant (sterile distilled water: commercial 84 disinfectant = 1:1), soak the seeds for 5 minutes, and turn them upside down several times;

[0083] (3) After discarding the disinfectant, add an appropriate amount of sterile water to wash the seeds 3-5 times;

[0084] (4) Use sterile tweezers to pick up the sterilized seeds and sow them evenly on the M. 0 On the culture medium, place the culture dish in a sterile culture box and culture at 24°C in the dark for 6 days.

[0085] Shaking bacteria

[0086] Five days after sowing, the pBnaRSL Agrobacterium strain was cultured in LB liquid medium containing kanamycin (25 μg / ml) and gentamicin (50 μg / ml). The culture was carried out in a shaker at 28°C and 180-220 rpm for about 14-16 hours. The OD value of the bacterial solution was measured with a spectrophotometer. When the OD value was about 0.4, it was considered to be the appropriate infection concentration.

[0087] Explant preparation and infection

[0088] Prepare DM liquid culture medium, add acetosyringone AS (final concentration 100 μM) when the culture medium is cooled to about 50°C for later use;

[0089] Prepare infection solution: pipette 2 ml of the above bacterial solution into a sterile centrifuge tube, centrifuge at 6000 rpm for 3 min, and discard the supernatant; add 2 ml of DM solution to suspend, centrifuge at 6000 rpm for 3 min, and discard the supernatant; add 2 ml of DM to suspend again, pour into a sterile culture dish containing 18 ml of DM and mix well as the infection solution;

[0090] The hypocotyls of 6-day-old seedlings were placed in a dish, and the explants were cut into segments of 0.8-1.0 cm in length using sterile forceps and a scalpel;

[0091] Place the cut explants into the prepared infection solution and infect for 10-15 minutes, shaking 4-5 times at intervals; when the infection is almost over, start to suck out the DM bacterial solution with a pipette, use sterile tweezers to transfer the explants to sterile filter paper, place them for a while, and absorb the excess bacterial solution.

[0092] Differentiation and growth of explants

[0093] Preparation of co-culture medium M 1 When the culture medium cooled to about 50°C, acetosyringone AS (final concentration 100 μM) was added. The infected explants were transferred to M 1 In the culture medium, co-cultivate at 24°C in the dark for 36-48h;

[0094] Transfer the explants to M 2 In the culture medium, the cells were cultured at 24°C under illumination (16 h light / 8 h dark) for 28 days;

[0095] Transfer the explants to M 3 The culture medium was subcultured every 2-3 weeks until green shoots appeared. The green shoots with complete growth points were transferred to M 4 Rooting culture medium.

[0096] The rooted seedlings were transplanted to the greenhouse for 1-2 weeks and then transplanted to the field for growth.

[0097] Identification of positive transgenic plants

[0098] The CTAB method was used to extract T 0 Total DNA from leaves of the first generation plants was amplified by PCR using the following universal primers:

[0099] U626-IDF: TGTCCCAGGATTAGAATGATTAGGC; and,

[0100] U629-IDR: AGCCCTCTTTCTTTCGATCCATCAAC.

[0101] Figure 2 The product was detected by 1.5% agarose gel electrophoresis, and the amplification results of Zhongshuang No. 9 and recombinant plasmid DNA were used as negative and positive controls respectively. The test results showed that the total number of plants transformed with the pBnaRSL vector was 94, of which 53 were transgenic positive plants, and the transgenic positive rate was 56.38%.

[0102] Example 5 Obtaining BnaRSL triple mutant germplasm

[0103] Primers were designed near the target sequence (as shown in Table 6 below) and two rounds of amplification were performed, and the amplified products were mixed for Hi-TOM. Sequencing results showed that 12 of the plants had editing mutations, and even 4 plants had three copies edited simultaneously. Sanger DNA sequencing of the PCR products containing the target site confirmed that the mutation did occur.

[0104] Table 6 Hi-tom first round amplification primer sequences

[0105] Primer name Sequence (5'--3') A9-1-F GGAGTGAGTACGGTGTGCGACAGCTTCTAGAGATTCG A9-1-R GAGTTGGATGCTGGATGGAGGATAGTTTACTTGGGTGG A10-2-F GGAGTGAGTACGGTGTGCCCATGGGGTAATACCTAATATC A10-2-R GAGTTGGATGCTGGATGGAACAAGACGTAAAGCAACTG C5-2-F GGAGTGAGTACGGTGTGCGTCTTTATATCAAAATGGTG

[0106] Further use of Hi-Tom method to 1 The genotypes of the first generation of single plants were detected, among which 29-1, 29-5, 29-6 and 08-4 were single plants with homozygous mutations in three copies of BnaA9RSL, BnaC5RSL and BnaA10RSL (see Table 7).

[0107] Table 7 Mutant genotypes of individual strains 29-1, 29-5, 29-6 and 08-1

[0108]

[0109] Example 6 Identification of seed size and weight of BnaRSL mutant

[0110] For the homozygous mutant lines 29-1, 29-5 and 29-6 of three copies of BnaA9RSL, BnaC5RSL and BnaA10RSL, the size and weight of their seeds were measured and counted, specifically including: peeling seeds from mature rapeseed siliques, removing impurities, and drying in the shade; taking photos of each sample seed and measuring the seed size; weighing 100 seeds of each sample using an electronic balance and converting them to thousand-grain weight to measure the seed weight.

[0111] It has been determined that Figure 4 The results show that the mutant seeds showed a significant increase in size and weight. The thousand-grain weight of the wild-type control (WT) double 9 was 4.90±0.24g, while the thousand-grain weight of the mutant a9a9a10a10c5c5 was 6.10±0.15g, an increase of about 1.2g, an increase of 24.48%. Figure 4 A As can be seen, the seeds of the mutant a9a9a10a10c5c5 are significantly larger than the seeds of the control group.

[0112] The foregoing description of specific exemplary embodiments of the present invention is for the purpose of illustration and demonstration. These descriptions are not intended to limit the present invention to the precise form disclosed, and it is clear that many changes and variations can be made based on the above teachings. The purpose of selecting and describing the exemplary embodiments is to explain the specific principles of the present invention and its practical application, so that those skilled in the art can realize and utilize various different exemplary embodiments of the present invention and various different selections and changes. The scope of the present invention is intended to be limited by the claims and their equivalents.

Claims

1. A method for increasing rapeseed seed size and grain weight using gene editing technology, characterized in that: The following steps are involved: (1) Screening target sequences at positions with high similarity to the nucleotide sequence of Brassica napus BnaRSL, and designing corresponding target primers; the BnaRSL includes three copy genes, BnaA9RSL, BnaC5RSL, and BnaA10RSL, whose nucleotide sequences are shown in SEQ ID No. 1, SEQ ID No. 2, and SEQ ID No. 3, respectively; (2) using the target primers to construct a CRISPR / Cas9 recombinant vector pBnaRSL for targeted editing of the Brassica napus; (3) The pBnaRSL vector is used to transform Brassica napus to obtain a rapeseed line with increased seed size and grain weight.

2. The method for increasing rapeseed seed size and grain weight using gene editing technology as claimed in claim 1, characterized in that: In step (1), the target sequences screened include S1 and S2, whose nucleotide sequences are shown as SEQ ID No.4 and SEQ ID No.5, respectively.

3. The method for increasing rapeseed seed size and grain weight using gene editing technology as claimed in claim 1, characterized in that: In step (1), the target primers designed include: The nucleotide sequences of the target primers corresponding to the target S1 are shown in SEQ ID No.6 and SEQ ID No.7; The nucleotide sequences of the target primers corresponding to the target S2 are shown in SEQ ID No.8 and SEQ ID No.

9.

4. The method for increasing rapeseed seed size and grain weight using gene editing technology as claimed in claim 1, characterized in that: In step (2), the construction of the CRISPR / Cas9 recombinant vector pBnaRSL for targeted editing of Brassica napus specifically comprises the following steps: Connecting the designed target primer to the sgRNA target expression cassette; Amplify different sgRNA target expression cassettes; The sgRNA target expression cassette was ligated with the gene editing vector CRISPR / Cas9 P35SpHSE401 by enzyme digestion.

5. The method for increasing rapeseed seed size and grain weight using gene editing technology as claimed in claim 1, characterized in that: In step (3), the method of transforming the pBnaRSL vector into Brassica napus includes: transforming using an Agrobacterium-mediated genetic transformation method.

6. Rapeseed germplasm with improved seed size and grain weight bred according to the method of any one of claims 1 to 5.

7. Application of the method for increasing rapeseed seed size and grain weight using gene editing technology as described in any one of claims 1 to 5 in the field of rapeseed breeding.

Images