Method for producing novel spider silk-silk composite fiber and improving performance of bombyx mori silk

Abstract

The invention provides a method for producing a spider silk-silk novel composite fiber and improving the performance of bombyx mori silk, which comprises the following steps: according to the N-terminal sequence NT of South African arachnoid main ampulla gland silk protein MaSp1, the repetitive sequence unit W of arachnoid ventricosa meglumine silk protein AcSp1, and the C-terminal sequence CT of arachnoid ventricosa secondary ampulla gland silk protein MiSp1, carrying out a reaction on the N-terminal sequence NT of the South African arachnoid; the method comprises the following steps: constructing a chimera spider silk protein gene sequence of a repetitive sequence unit W containing four AcSp1, artificially synthesizing a gene, and constructing a targeting Donor plasmid through a homologous recombination technology; the method comprises the following steps: carrying out micro-injection, and introducing a targeting Donor plasmid, a Cas9 plasmid for providing Cas9 nuclease, and plasmids of sgRNA1 and sgRNA2 sequences aiming at a silkworm FIB-H No. 2 exon into a fertilized egg within 1-6 hours after silkworm spawning; after silkworm eggs are hatched, screening through fluorescence labeling genes, and carrying out multiple times of culture and continuous generation to obtain a transgenic silkworm breed line capable of stably inheriting the chimera spider silk protein gene; bombyx mori silk glands are used as a bioreactor to secrete chimeric spider silk protein, and the chimeric spider silk protein enters silkworm cocoons along with spinning and cocooning behaviors of bombyx mori.

Description

Technical Field

[0001] The present invention designs an application of a gene sequence and an action method thereof, and in particular relates to a method for producing a new type of spider silk-silkworm silk composite fiber by using a chimeric spider silk protein gene to improve the performance of silkworm silk. Background Art

[0002] Spiders are a general term for animals in the Arthropoda class Arachnida order Araneae, and are a type of organism with a very long history. As of early 2024, a total of 135 families, 4,377 genera and nearly 52,000 species of spiders have been discovered.

[0003] Spider silk is not only closely related to the life activities of spiders, but also a natural material with better performance than silk, with excellent mechanical properties and biological characteristics. Most spiders can produce seven types of spider silk and spider silk-related proteins, including Major Ampullate Silk, Minor Ampullate Silk, Flagelliform Silk, Tubuliform Silk, Pyriform Silk, Aciniform Silk and Aggregate Spider Glue.

[0004] Molecular biology studies have shown that all spider silk proteins come from the same family, and their primary structures contain highly conserved N-terminal non-repetitive regions, C-terminal non-repetitive regions, and central repetitive regions located in the core. Among them, the central repetitive region accounts for more than 90% of the spider silk protein sequence and determines the material properties of different spider silk fibers. The N-terminal non-repetitive region and the C-terminal non-repetitive region are mainly responsible for maintaining the stable storage of spider silk proteins in the silk gland and controlling the formation of spider silk fibers.

[0005] Among them, the silk fibers formed by Aciniform Spidroins (AcSp) have the strongest toughness among spider silks, and their surface is smooth and soft. Therefore, spiders use them to wrap and fix struggling prey, and as the inner layer of spider egg bags to provide a comfortable environment for spider eggs. Argiope trifasciata ) The central repeat region of the chrysanthemum silk protein AcSp1 contains more than 14 repeating sequence units, each unit contains 200 amino acid residues, and the structure is almost completely identical. In addition, the South African spider ( Euprosthenops australis ) N-terminal sequence of the major ampullate gland silk protein MaSp1 from the spider ( Araneus ventricosus) The C-terminal sequence of the sub-ampullar gland silk protein MiSp1 is not only highly conserved, but also has good water solubility. The chimeric spider silk protein gene sequence (NTW4CT) constructed with these three has good protein expression ability, and the expressed chimeric spider silk protein can be made into spider silk fibers with excellent mechanical properties and biocompatibility.

[0006] However, due to the complexity of the structure of spider silk protein itself and the high repetitiveness of the core region, spider silk protein expressed by Escherichia coli, yeast, mammalian cells, insect cells and other systems using molecular biology techniques often suffers from problems such as misfolding, low yield, and unstable expression, which limits the large-scale production of spider silk protein and the preparation of high-performance silk fibers. From ancient times to the present, silkworms have been widely raised to harvest silk fibers. Breeding silkworms has the advantages of low feeding costs, short growth cycles, good safety, and high silk yields. In addition, the structure of spider silk protein has certain similarities with that of silkworm fibroin, both of which contain core repeat regions composed of highly repetitive sequences. Therefore, more and more researchers at home and abroad are trying to use silkworms as bioreactors to mass-produce spider silk.

[0007] At present, most of the research on using transgenic silkworms to express spider silk focuses on major ampullate gland silk proteins and secondary ampullate gland silk proteins. The existing technology lacks effective transgenic treatment for other spider silk protein genes, especially artificially constructed chimeric spider silk protein genes to improve silk performance. And the technologies such as PiggyBac transposition, which are currently widely used in silkworm gene editing, can only randomly integrate genes into the silkworm genome, and cannot control the stability and expression efficiency of the transferred gene sequence. To solve the above problems, the present invention uses CRISPR-Cas9 technology to establish a method for targeted knock-in of chimeric spider silk protein genes into the silkworm genome, and finds that the gene has the effect of significantly improving silk performance. Summary of the invention

[0008] The present invention mainly provides a method for producing a novel spider silk-silk composite fiber and improving the performance of silkworm silk, so as to solve the technical problems raised in the above-mentioned background technology.

[0009] The technical solution adopted by the present invention to solve the above technical problems is: A method for producing a novel spider silk-silk composite fiber and improving the performance of silkworm silk, comprising the following steps: (1) According to the South African robin spider ( Euprosthenops australis ) The N-terminal sequence of the major ampullate gland silk protein MaSp1, NT, from Argiope trifasciata ( Argiope trifasciata ) Repeating sequence unit W of the succulent gland silk protein AcSp1, Araneus macroglossus ( Araneus ventricosus) The C-terminal sequence CT of the subampullar gland silk protein MiSp1 was used to construct a chimeric spider silk protein gene sequence containing 4 repeating sequence units W of AcSp1. The gene was artificially synthesized, and a targeting Donor plasmid was constructed through homologous recombination technology. The donor plasmid contained the chimeric spider silk protein gene as an exogenous gene and a red fluorescent protein expression gene (DsRed) as a marker gene.

[0010] (2) The Donor plasmid, the Cas9 plasmid providing the Cas9 nuclease, and the plasmids containing the sgRNA1 and sgRNA2 sequences targeting the exon 2 (Exon2) of the silkworm FIB-H are introduced into the fertilized eggs within about 1 to 6 hours after laying eggs of the silkworm by microinjection.

[0011] (3) After the silkworm eggs are hatched, they are screened for fluorescent marker genes. After multiple generations of culture, a transgenic silkworm strain is obtained that can stably inherit the chimeric spider silk protein gene and whose silk gland cells can synthesize and secrete the chimeric spider silk protein.

[0012] (4) Using the silk gland of the silkworm as a bioreactor to synthesize and secrete chimeric spider silk proteins, which then enter the cocoon as the silkworm spins and makes cocoons; This results in a silkworm variety that is capable of efficiently and massively producing new spider silk-silkworm silk composite fibers containing chimeric spider silk proteins, thereby improving the mechanical properties of the silk and maintaining the silkworm lineage by relying on the silkworm's own reproductive ability.

[0013] A further improvement is that the targeting Donor plasmid includes a homology arm Homo-U identical to the upstream sequence of Bombyx mori FIB-H, whose sequence is such as SEQ ID No.4, a homology arm Homo-D identical to the downstream sequence of FIB-H, whose sequence is such as SEQ ID No.5, and an insertion sequence between the two homology arms.

[0014] The further improvement is that the inserted sequence includes the chimeric spider silk protein gene sequence, the Fib-H C-terminal sequence, the terminator SV40, the eye and nerve specific promoter 3×p3, the marker gene red fluorescent protein DsRed, and the second terminator SV40.

[0015] A further improvement is that the plasmid containing sgRNA1 and sgRNA2 sequences can transcribe sgRNA1 and sgRNA2, sgRNA1 can specifically complement the recognition site upstream of Bombyx mori FIB-H Exon2, and the sequence is such as SEQ ID No.6, and sgRNA2 can specifically complement the recognition site downstream of Bombyx mori FIB-H Exon2, and the sequence is such as SEQ ID No.7.

[0016] A further improvement is that the Cas9 plasmid includes a Cas9 nuclease expression frame for expressing the Cas9 nuclease.

[0017] A further improvement is that the chimeric spider silk protein gene sequence is specifically expressed in the silk gland cells of the silkworm under the control of the Fib-H endogenous regulatory sequence, and enters the cocoon through the silkworm's spinning and cocooning.

[0018] A further improvement is that the specific steps of the microinjection are: mixing the targeting Donor plasmid, the Cas9 plasmid, and the plasmid containing the sgRNA1 and sgRNA2 sequences, and injecting 2-10 nL of the mixture into the fertilized silkworm eggs with a microinjection needle; the final concentration of the targeting Donor plasmid and the Cas9 plasmid in the mixture is 200-350 ng / μL, and the final concentration of the plasmid containing the sgRNA1 and sgRNA2 sequences is 100-150 ng / μL; after the injection of the fertilized silkworm eggs, the injection port on the silkworm eggs is sealed, and then transferred to a constant temperature and humidity incubator for incubation.

[0019] A further improvement is that the fluorescent marker gene screening specifically refers to observing the silkworms through a fluorescence microscope with an excitation light of ~554 nm after the silkworm eggs are hatched, and screening out silkworms with red fluorescence in the eyes or nerves.

[0020] Compared with the prior art, the present invention has the following beneficial effects: The present invention uses CRISPER / Cas9 technology to target and knock in a chimeric spider silk protein gene sequence into the silkworm genome, replacing the silkworm heavy chain protein gene (FIB-H), and obtains transgenic silkworms whose silk gland cells can stably synthesize and secrete chimeric spider silk proteins after multiple generations of culture, thereby obtaining a silkworm variety that can efficiently and massively produce new spider silk-silkworm silk composite fibers, thereby improving the mechanical properties of silk, and maintaining the silkworm lineage by relying on the silkworm's own reproductive and generation-succession ability. Compared with the existing piggybac transposition method for gene editing, the spider silk gene is randomly integrated into the silkworm genome, and the present invention can effectively improve the stability and expression efficiency of the gene.

[0021] The present invention combines CRISPR / Cas9 gene editing technology to simultaneously complete the knockout of the silkworm Fib-H gene sequence and the targeted knock-in of the chimeric spider silk protein sequence, so that the chimeric spider silk protein sequence replaces the position of the Fib-H sequence, thereby being able to specifically synthesize and secrete the chimeric spider silk protein in the silk gland cells of the silkworm with the help of the Fib-H endogenous regulatory sequence, and screening transgenic silkworms with the help of fluorescent labeling technology. The transgenic silkworms can specifically synthesize and secrete the chimeric spider silk protein in the silk gland cells of the silkworm, improve the performance of silk, simplify the purification method, reduce the production cost, improve the production efficiency and economic benefits of the enterprise, and improve the economic benefits of silkworm farmers.

[0022] The present invention will be explained in detail below with reference to the accompanying drawings and specific embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Schematic diagram of Donor plasmid construction for targeting; Figure 2 Schematic diagram of the CRISRP / Cas9-mediated targeted insertion of the chimeric spider silk protein gene into the silkworm genome; Figure 3 This is a fluorescence identification image of the transgenic silkworm moth; Figure 4 This is an electron microscope image of the new spider silk-silk composite fiber. DETAILED DESCRIPTION

[0024] To facilitate understanding of the present invention, the present invention will be described more comprehensively below with reference to the relevant drawings. Several embodiments of the present invention are given in the drawings, but the present invention can be implemented in different forms and is not limited to the embodiments described in the text. On the contrary, these embodiments are provided to make the content disclosed in the present invention more thorough and comprehensive.

[0025] The present invention uses CRISPR / Cas9 gene editing technology, utilizes plasmids containing sgRNA1 and sgRNA2 sequences to generate sgRNA1 and sgRNA2 that are transcribed to complement the recognition sites on Fib-H Exon2 in the silkworm embryonic cell genome, respectively, and guides the Cas9 nuclease expressed by the Cas9 plasmid to target and cut the upstream and downstream sequences of Fib-H, thereby knocking out the Fib-H gene; utilizes homology directed repair (HDR), and integrates the inserted sequence in the targeting donor plasmid into the silkworm genome through homologous recombination, thereby introducing a chimeric spider silk protein sequence at the same position while knocking out the silkworm Fib-H gene, and stably inheriting and expressing it, thereby breeding transgenic silkworms that secrete the chimeric spider silk protein.

[0026] The present invention will be further described below through specific examples. The present invention takes the gene encoding the chimeric spider silk protein NTW4CT as an example, and the plasmid pET-NTW4CT as a template. The gene of the chimeric spider silk protein NTW4CT is directionally inserted into the silkworm genome through the CRISPER / Cas9 technology to replace the position of the silk fibroin heavy chain protein Fib-H sequence of the silkworm. Thus, with the help of the Fib-H endogenous regulatory sequence, the chimeric spider silk protein is specifically synthesized and secreted in the silk gland cells of the silkworm, and a transgenic silkworm that secretes the chimeric spider silk protein is bred. Example

[0027] Using the South African robber spider ( Euprosthenops australis ) N-terminal sequence (NT) of the major ampullate gland silk protein MaSp1, Argiope trifasciata ( Argiope trifasciata) four repeating sequence units of the chrysanthemum silk protein AcSp1, and the large-bellied spider ( Araneus ventricosus ) The C-terminal sequence (CT) of the secondary ampullate silk protein MiSp1 was used to artificially synthesize the chimeric spider silk protein gene sequence NTW4CT and clone it into the pET vector to obtain the plasmid pET-NTW4CT.

[0028] like Figure 1 As shown, pET-NTW4CT was used as a template to amplify the NTW4CT sequence whose two ends were complementary to the upstream homology arm (Homo-U) and the FIB-H C-terminal fragment respectively by PCR; the plasmid pMD-18-S containing the upstream and downstream homology arms of the silk fibroin heavy chain protein (Fib-H) was used as a template to PCR amplify the pMD-18-S linearized vector whose two ends were complementary to the 5' NT and 3' CT fragments of the chimeric spider silk protein respectively; the NT4CT sequence and the pMD-18-S linearized vector were circularized by homologous recombinase to form the targeting Donor plasmid pMD-18-S-NTW4CT.

[0029] The obtained targeting donor plasmid pMD-18-S-NTW4CT was mixed with the Cas9 plasmid and the plasmid containing sgRNA1 and sgRNA2 sequences, and dissolved in 0.5mM phosphate buffer (pH=7). The final concentration of the targeting Donor plasmid was 300 ng / μL, the final concentration of the Cas9 plasmid was 250 ng / μL, and the final concentration of the plasmid containing sgRNA1 and sgRNA2 sequences was 150 ng / μL. Then, it was microinjected into the fertilized eggs of the wild-type silkworm variety Nistari within 3 hours after laying eggs, and the total volume of the introduction was 10nL. The CRISRP / Cas9 technology was used to complete the targeted insertion of the spider silk protein gene into the silkworm genome. The principle is as follows Figure 2 shown.

[0030] The injected silkworm eggs were sealed with quick-drying glue to seal the injection port on the eggs and transferred to a constant temperature and humidity incubator (25°C, 80%) for incubation. After the eggs were hatched, the silkworms were observed at the third instar larvae, pupae, and adults using a fluorescence microscope (Olympus, BX53, Japan) at an excitation light of ~554 nm to screen out transgenic positive silkworms with red fluorescence in the eyes or nerves. Figure 3 As shown. The transgenic silkworm moths were crossed with the wild type and passed down to the G1 generation. Since the G1 generation, transgenic silkworms have been raised by single moth. After the G1 generation silkworm eggs hatched, they were screened again by red fluorescent markers to obtain transgenic positive silkworms. After being raised to adults, they were mated with the moth area to make the chimeric spider silk protein gene homozygous, and then the G2 and G3 generations that can stably inherit and express the chimeric spider silk protein gene were cultivated.

[0031] In the G1 generation, the silkworm larvae with red fluorescence in the eyes or nerves were cultured until the end of the fifth instar; after dissection, the silk glands were removed and washed for later use, and the remaining parts were cut into pieces and put into a mortar, and then ground with liquid nitrogen; the silkworm genome was extracted using a genome extraction kit. Using the genome as a template, PCR was used to amplify the upstream sequence, downstream sequence, reporter gene sequence, and spider silk protein-specific sequence of the inserted gene in the G1 generation genome of the transgenic silkworm; agarose gel electrophoresis was used for detection. The results showed that the full set of inserted sequences in the targeting donor plasmid was successfully integrated into the silkworm genome and replaced the silkworm Fib-H gene sequence.

[0032] The silk fibroin in the cocoons and silk glands of the G2 and G3 generations of transgenic positive silkworms was used as the material, and the expression of the chimeric spider silk protein NTW4CT was analyzed by SDS-PAGE electrophoresis. The molecular weight of the specific band obtained by SDS-PAGE electrophoresis was ~114kDa, which was consistent with the expected size of the target protein. It was proved that there was chimeric spider silk protein in both silk gland protein and cocoon, and this protein and silk protein together formed spider silk-silk composite fiber ( Figure 4 ).

[0033] The results of the mechanical properties measurement of spider silk-silk composite fibers in transgenic silkworm cocoons show (Table 2) that the mechanical properties of spider silk-silk composite fibers were significantly improved compared with those of the wild-type silkworm variety Nistari used as a control.

[0034] Example 1 Results of performance measurement of transgenic silkworm spider silk-silk composite fibers

[0035] The above results prove that the chimeric spider silk protein gene is targeted and inserted into the chromosome of the transgenic silkworm genome, replacing the silkworm Fib-H gene sequence. The gene sequence can utilize the endogenous regulatory sequence of Fib-H to synthesize and secrete the chimeric spider silk protein in the silk gland cells of the silkworm. The protein can enter the cocoon along with the spinning and cocooning behavior. This trait has been stably inherited and expressed. The mechanical properties of the transgenic silkworm spider silk-silk composite fibers are significantly improved compared with those of wild-type silkworm silk fibers.

[0036] The sequence involved in the present invention is as follows: SEQ ID No.1: South African robbing spider ( Euprosthenops australis ) N-terminal sequence bases of major ampulla gland silk protein MaSp1 AGTCACACCACTCCTTGGACCAATCCGGGCTTAGCGGAGAACTTCATGAACAGCTTCATGCAAGGCTTGTCGTCGATGCCAGGGTTTACGGCATCTCAGCTGGATGACATGTCCACCATTGCACAGAGTATGGTCCAGTCGATCCAGAGTCTCGCAGCTCAAGGTCGCACCTCACCGAACAAACTGCAAGCCCTGAATATGGCGTTTGCCTCAAGCATGGCGGAAATTGCTGCCTCTGAAGAAGGTGGAGGTTCCCTGAGCACGAAAACCAGCTCTATTGCGTCAGCCATGAGCAATGCGTTTCTGCAGACAACTGGCGTTGTGAATCAGCCGTTCATCAACGAGATCACGCAGCTTGTGAGCATGTTTGCGCAAGCAGGCATGAACGATGTATCCGCTGGG SEQ ID No.2: Repeat sequence unit bases of AcSp1 of the aciniform gland silk protein of *Argiope trifasciata* Argiope trifasciata ) AGTGACGGCCCGCAGGGTGGTTTCGGTGCAACTGGTGGTGCAAGCGCGGGCCTAATTTCGCGGGTTGCAAACGCCCTGGCCAATACCAGCACGCTGCGCACGGTCCTGCGCACCGGCGTGTCGCAACAAATTGCAAGCAGCGTGGTACAACGTGCCGCCCAGTCTTTGGCCAGTACCTTAGGCGTTGATGGCAACAATCTGGCGCGTTTTGCTGTGCAGGCTGTAAGTCGTCTCCCGGCTGGCAGCGATACTTCAGCCTATGCCCAGGCGTTTAGCTCTGCGCTGTTTAACGCCGGCGTGTTGAACGCTAGCAACATCGATACCTTAGGCTCACGCGTTCTGTCGGCGCTTCTTAATGGCGTGtcTTCAGCGGCGCAGGGgCTTGGTATTAATGTTGACAGCGGTTCCGTCCAATCCGACATCTCTTCCTCCAGCTCTTTTCTGAGTACTTCGTCCTCAAGTGCTTCCTATAGTCAAGCAAGCGCTAGCAGCACATCTGGGGCCGGTTACACCGGCCCATCTGGCCCCTCAACCGGTCCGTCCGGCTACCCTGGCCCACTGGGCGGCGGCGCGCCGTTCGGGcaGAGCGGCTTCGGTGGg SEQ ID No.3: Major ampullate spidroin 1 C-terminal sequence of Araneus ventricosus Araneus ventricosus ) base of the C-terminal sequence of minor ampullate spidroin 1 (MiSp1) GTAACCTCGGGTGGATATGGGTACGGCACGTCTGCCGCAGCAGGTGCTGGGGTCGCAGCAGGATCGTATGCTGGTGCGGTCAACCGTTTAAGCTCGGCTGAGGCGGCGTCCCGCGTGAGCTCGAACATTGCGGCCATCGCGTCAGGCGGTGCCTCAGCGCTACCGTCCGTGATCTCCAACATTTATTCTGGTGTGGTGGCGTCAGGCGTAAGTTCTAATGAAGCGCTGATTCAGGCCTTGCTGGAACTGCTCAGCGCCCTTGTGCATGTTCTGAGCAGTGCCAGTATCGGCAATGTCAGTAGCGTGGGCGTCGACAGCACTCTGAATGTTGTTCAAGATAGCGTAGGCCAGTACGTT SEQ ID No.4: Upstream homologous arm Homo-U of Bombyx mori FIB-H CGCACAGATATCGTAAATTGTGCCATTTGATTTGTCACGCCCGGGGGGGCTACGGAATAAACTACATTTATTTATTTAAAAAATGAACCTTAGATTATGTAACTTGTGATTTATTTGCGTCAAAAGTAGGCAAGATGAATCTATGTAAATACCTGGGCAGACTTGCAATATCCTATTTCACCCGTAAATCAGCATTGCAATATGCAATGCATATTCAACAATATGTAAAACAATTCGTAAAGCATCATTAGAAAATAGACGAAAGAAATTGCATAAAATTATAACCGCATTATTAATTTATTATGATATCTATTAACAATTGCTATTGCCTTTTTTTCGCAAATTATAATCATTTTCATAACCTCGAGGTAGCATTCTGTTACATTTTAATACATTGGTATGTGATTATAACACGAGCTGCCCACTGAGTTTCTCGCCAGATCTTCTCAGTGGGTCGCGTTACCGATCACGTGATAGATTCTATGAAGCACTGCTCTTG TTAGGGCTAGTGTTAGCAAATTCTTTCAGGTTGAGTCTGAGAGCTCACCTACCCATCGGAGCGTAGCTGGAATAGGCTACCAGCTAATAGGTAGGGAAAACAAAGCTCGAAACAAGCTCAAGTAATAACAACATAATGTGACCATAAAATCTCGTGGTGTATGAGATACAATTATGTACTTTCCCACAAATGTTTACATAATTAGAATGTTGTTCAACTTGCCTAACGCCCCAGCTAGAACATTCAATTATTACTATTACCACTACTAAGGCAGTATGTCCTAACTCGTTCCAGATCAGCGCTAACTTCGATTGAATGTGCGAAATTTATAGCTCAATATTTTAGCACTTATCGTATTGATTTAAGAAAAAAATTGTTAACATTTTGTTTCAGTATGTCGCTTATACAAATGCAAACATCAATGATTTTGATGAGGACTATTTTGGGAGTGATGTCACTGTCCAAAGTAGTAATACAACAGATGAAATAATTAGAGATGCA SEQ ID No.5: Bombyx mori FIB-H downstream homology arm Homo-D GGACAAGGTGCAGGAAGTGCAGCTTCCTCTGTGTCATCTGCTTCATCTCGCAGTTACGACTATTCTCGTCGTAACGTCCGCAAAAACTGTGGAATTCCTAGAAGACAACTAGTTGTTAAATTCAGAGCACTGCCTTGTGTGTGAATTGCTAATTTTTAATATAAAATAACCCTTGTTTCTTACTTCGTCCTGGATACATCTATGTTTTTTTTTTTCGTTAATAAATGAGAGCATTTAAGTTATTGTTTTTAATTACTTTTTTTTAGAAAACAGATTTCGGATTTTTTGTATGCATTTTATTTGAATGTACTAATATAATCAATTAATCAATGAATTCATTTATTTAAGGGATAACAATAATCCATGAATTCACATGCACATTTAAAACAAAACTAAATTACAATAGGTTCATATAAAAACAACAAGTATGCCTTCTCAACTAAGAATACTATATTGTTTAAACCGTAAAAAAAGTCATATTTCTGTATATCAAAACA CATCTAATATTAAAAAAACAGTCAGCAAGCACTTACAAGTGTGGGCTCGGACAGCAATTACCTGGTCTCAGGAGACACTTGAAGAACGAGAAGCACGTCTCTCTGTCGATTGCGAGGCTCATGCACTATCGCTTGAGTCTGAGACCTTTACTGATAGGGAAATCCGTTTGAGCTCTCAGAGGGGTTCGGACAGCAAAAGCTTGCCCGGTCTCAGGAGACATTAGAAGAACGGGAAGCATAACTCAATA CCGATCGCGTTTCCATTGAGCCTATGCTTCGTGATAATAATAAATAAAGCCCAAGGTCAGAGCGCTAAAAGTTGTGGGTGTAGATATAAGTGTTAACTGCTTTTCACACACAGTCAACTCGGTCACG CGGTTATGTAGCTCTGTCACATGCTAGCAATCCTAGCAACCTGTATGCTTTGATCCCCGATGGCTATACGTCTACGTCGTGTATAGAGAAGCTTGAATTCACTGGCCGTCGTTTTACAACGTCG SEQ ID No.6: sgRNA1 sequence GATGCATCTCTAATTATTTC SEQ ID No.7: sgRNA2 sequence TGTCCGTATCCCCTGCCAGC

Claims

1. A method for producing a new type of spider silk-silk composite fiber and improving the performance of silkworm silk, It is characterized in that The following steps are involved: (1) Based on the N-terminal sequence NT of the major ampullate gland silk protein MaSp1 of the South African thrush, the repeating sequence unit W of the grape-shaped gland silk protein AcSp1 of the three-banded golden spider, and the C-terminal sequence CT of the minor ampullate gland silk protein MiSp1 of the big-bellied spider, a chimeric spider silk protein gene sequence containing four repeating sequence units W of AcSp1 was constructed, the gene was artificially synthesized, and a targeting Donor plasmid was constructed by homologous recombination technology, wherein the donor plasmid contained the chimeric spider silk protein gene as an exogenous gene and a red fluorescent protein expression gene as a marker gene; (2) By microinjection, the Donor plasmid, the Cas9 plasmid providing the Cas9 nuclease, and the plasmids containing the sgRNA1 and sgRNA2 sequences targeting the exon 2 of the silkworm FIB-H were introduced into the fertilized eggs within 1 to 6 hours after laying eggs of the silkworm; (3) After the silkworm eggs are hatched, the fluorescent marker gene is screened, and the screened silkworms are cultured and subcultured for multiple generations to obtain transgenic silkworm strains that can stably inherit the chimeric spider silk protein gene and whose silk gland cells can synthesize and secrete the chimeric spider silk protein; (4) The silk gland of the silkworm is used as a bioreactor to synthesize and secrete chimeric spider silk proteins, which then enter the cocoon during the silkworm's spinning and cocooning behavior to obtain a new type of spider silk-silk composite fiber.

2. A method for constructing a transgenic silkworm strain producing a novel spider silk-silk composite fiber. It is characterized in that The following steps are involved: (1) Based on the N-terminal sequence NT of the major ampullate gland silk protein MaSp1 of the South African thrush, the repeating sequence unit W of the grape-shaped gland silk protein AcSp1 of the three-banded golden spider, and the C-terminal sequence CT of the minor ampullate gland silk protein MiSp1 of the big-bellied spider, a chimeric spider silk protein gene sequence containing four repeating sequence units W of AcSp1 was constructed, the gene was artificially synthesized, and a targeting Donor plasmid was constructed by homologous recombination technology, wherein the donor plasmid contained the chimeric spider silk protein gene as an exogenous gene and a red fluorescent protein expression gene as a marker gene; (2) By microinjection, the Donor plasmid, the Cas9 plasmid providing the Cas9 nuclease, and the plasmids containing the sgRNA1 and sgRNA2 sequences targeting the exon 2 of the silkworm FIB-H were introduced into the fertilized eggs within 1 to 6 hours after laying eggs of the silkworm; (3) After the silkworm eggs are hatched, they are screened for fluorescent marker genes. The screened silkworms are cultured and subcultured multiple times to obtain transgenic silkworm strains that can stably inherit the chimeric spider silk protein gene and whose silk gland cells can synthesize and secrete the chimeric spider silk protein.

3. A method for producing a novel spider silk-silk composite fiber and improving the properties of silkworm silk according to claim 1 or 2, It is characterized in that The targeting Donor plasmid comprises a homology arm Homo-U identical to the upstream sequence of Bombyx mori FIB-H, a homology arm Homo-D identical to the downstream sequence of FIB-H, and an insertion sequence between the two homology arms.

4. A method for producing a novel spider silk-silk composite fiber and improving the properties of silkworm silk according to claim 3, It is characterized in that The insertion sequence sequentially includes a chimeric spider silk protein gene sequence, a Fib-H C-terminal sequence, a terminator SV40, an eye and nerve specific promoter 3×p3, a marker gene red fluorescent protein DsRed, and a second terminator SV40.

5. A method for producing a novel spider silk-silk composite fiber and improving the properties of silkworm silk according to claim 1 or 2, It is characterized in that sgRNA1 can specifically complement the recognition site upstream of Bombyx mori FIB-H Exon2, and sgRNA2 can specifically complement the recognition site downstream of Bombyx mori FIB-H Exon2.

6. A method for producing a novel spider silk-silk composite fiber and improving the properties of silkworm silk according to claim 1 or 2, It is characterized in that The specific steps of microinjection are: Mix the targeting Donor plasmid, Cas9 plasmid, and plasmids containing sgRNA1 and sgRNA2 sequences, and inject 2-10 nL of the mixture into the fertilized eggs of the silkworm using a microinjection needle; The final concentration of the Donor targeting plasmid and Cas9 plasmid in the mixture is 200-350 ng / μL, and the final concentration of the plasmid containing the sgRNA1 and sgRNA2 sequences is 100-150 ng / μL; After the injection of the fertilized silkworm eggs is completed, the injection port on the silkworm eggs is sealed and then transferred to a constant temperature and humidity incubator for incubation.

7. A method for producing a novel spider silk-silk composite fiber and improving the properties of silkworm silk according to claim 1 or 2, It is characterized in that The specific steps of the fluorescent marker gene screening are: after the silkworm eggs are hatched, the silkworms are observed through a fluorescence microscope with an excitation light of 554 nm, and the silkworms with red fluorescence in the eyes or nerves are screened out.

8. A novel spider silk-silkworm silk composite fiber or a transgenic silkworm strain of the novel spider silk-silkworm silk composite fiber obtained by the method according to claim 1 or 2.

9. Use of the transgenic silkworm strain producing the novel spider silk-silk composite fiber according to claim 8 as breeding material.

10. Use of the transgenic silkworm strain of the novel spider silk-silk composite fiber of claim 8 in the preparation of the novel spider silk-silk composite fiber of claim 8.

Images