Sample target repair system and repair method for nucleic acid or protein in-situ detection

Abstract

The invention relates to the technical field of nucleic acid or protein in-situ detection, in particular to a sample target repairing system and method for nucleic acid or protein in-situ detection. The target repairing system comprises 1 to 50 U / mL of protease K and 1 to 10 mg / mL of elastase. According to the target repairing method, the target repairing system is added into the sample for repairing for 5-10 min. In related technologies, pepsase is commonly used in FFPE tissue antigen repair and is sensitive to temperature, time and concentration, the repair effect is difficult to control, and the operation process is complicated; the repairing method is easy and convenient to operate, the repairing effect is better and more stable, and the repairing method can be carried out in a laboratory with common configuration.

Description

Technical Field

[0001] The present application relates to the technical field of in situ detection of nucleic acids or proteins, and in particular to a sample target repair system and a repair method for in situ detection of nucleic acids or proteins. Background Art

[0002] During the preparation of formalin-fixed paraffin-embedded (FFPE) samples, formaldehyde is used for fixation. Formaldehyde mediates reversible covalent cross-linking between proteins, proteins, DNA, and proteins, forming a stable cross-linked structure, which can retain cells or ex vivo tissues in their original state to a large extent, allowing samples to be preserved for a long time. However, it is this cross-linking of key amino acid side chains that may selectively mask different epitopes of different antigens and cause subtle changes in the overall three-dimensional structure of protein molecules. In addition to inducing cross-linking, formaldehyde also destroys hydrogen bonds and other electrostatic interactions that affect protein structure, further increasing the possibility of major changes in target epitopes. At the same time, since most antibodies are proteins in their native conformation, they may not be able to effectively bind to target polypeptides with this structural transformation, resulting in antigen masking. Therefore, it is critical to choose an appropriate method for antigen retrieval when conducting in situ hybridization or other immune-related experiments.

[0003] Protease repair is one of the commonly used target repair methods. It removes the polypeptide chain that masks the antigen epitope through the enzyme to expose its binding site. At present, low-concentration pepsin is often used as a protease for target repair of FFPE samples. However, due to the limited repair capacity of low-concentration pepsin, it is usually necessary to extend the pepsin repair time or add additional heat repair to further remove the cross-links between multiple molecules. This process is complicated to operate and the heat repair temperature is difficult to accurately control.

[0004] In addition, if the concentration of pepsin is increased for repair, it is very easy to over-repair, resulting in target destruction or damage to tissue morphology. High concentrations of pepsin require a certain acidic environment to dissolve or reach a more suitable pH. Usually, a certain concentration of hydrochloric acid is required as a diluent, that is, the overall repair process is more complicated and the repair effect is unstable. Summary of the invention

[0005] The present application provides a sample target repair system and repair method for in situ detection of nucleic acids or proteins. The method is suitable for target repair for in situ RNA or protein detection on tissues or cells. In the related art, pepsin is commonly used in FFPE tissue antigen repair, which is sensitive to temperature, time and concentration, the repair effect is difficult to control, and the operation process is complicated; while the repair method provided by the present application is easy to operate, the repair effect is better and more stable, and it can be carried out in a laboratory with ordinary configuration.

[0006] In different types of tissues, elastin on connective tissue usually produces a strong spontaneous fluorescence background, which seriously interferes with signal imaging detection. Using elastase to repair targets in such tissues can achieve the purpose of eliminating spontaneous background and enhancing signal-to-noise ratio. In addition, proteinase K, as an enzyme with a wide range of temperature and pH applications, can hydrolyze a variety of polypeptide bonds and fully expose the target to be tested. On the basis of the above, this application has developed a target repair system that can be performed at room temperature and can adapt to most FFPE samples.

[0007] In the first aspect, the present application provides a sample target repair system for in situ detection of nucleic acids or proteins, which adopts the following technical solutions:

[0008] A sample target repair system for in-situ detection of nucleic acid or protein, the target repair system comprising 1-50 U / mL proteinase K and 1-10 mg / mL elastase.

[0009] Optionally, the concentration of the proteinase K is 0.625-5U / mL.

[0010] Optionally, the concentration of the proteinase K is 1.25-2.5 U / mL.

[0011] In a specific embodiment, the concentration of proteinase K is 0.625 U / mL, 1.25 U / mL, 2.5 U / mL, or 5 U / mL.

[0012] In some specific embodiments, the concentration of proteinase K is 0.625-1.25 U / mL, 0.625-2.5 U / mL, 5 U / mL, 1.25-5 U / mL, or 2.5-5 U / mL.

[0013] Optionally, the concentration of the elastase is 0.125-1 mg / mL.

[0014] Optionally, the concentration of elastase is 0.25-0.5 mg / mL.

[0015] In a specific embodiment, the concentration of the elastase is 0.125 mg / mL, 0.25 mg / mL, 0.5 mg / mL, or 1 mg / mL.

[0016] In some specific embodiments, the concentration of the elastase is 0.125-0.25 mg / mL, 0.125-0.5 mg / mL, 0.25-1 mg / mL, or 0.5-1 mg / mL.

[0017] In the second aspect, the present application provides a method for preparing a target repair system, using the following technical solution:

[0018] A method for preparing a target repair system specifically comprises the following steps: dissolving 1-50 U / mL proteinase K and 1-10 mg / mL elastase in a Tris-EDTA solution at pH 7.6 to prepare a 20× mother solution.

[0019] In a third aspect, the present application provides a sample target repair method for in situ detection of nucleic acids or proteins. The target repair method is performed using the above target repair system.

[0020] Optionally, the sample type is a FFPE sample.

[0021] Optionally, the target repair system is added to the sample for repair for 5-10 minutes.

[0022] Optionally, the repair method is performed at room temperature.

[0023] The target repair system in this application is composed of 25U / mL proteinase K and 5mg / mL elastase dissolved in a Tris-EDTA solution at pH 7.6 to form a 20× stock solution, which is then diluted into a 1× or 2× working solution according to the FFPE tissue type and preparation scheme. The sample to be repaired is repaired for 5-10 minutes at room temperature of 25°C to achieve a good target repair effect, thereby improving the detection efficiency of RNA in situ detection.

[0024] In a fourth aspect, the present application provides an application of the above-mentioned target repair system in the pre-treatment of samples for in situ detection of nucleic acids or proteins.

[0025] In summary, the present application includes at least one of the following beneficial technical effects:

[0026] (1) Compared with the prior art, the target repair system of the present application integrates the cleavage capabilities of multiple proteases on different amino acid chemical bonds, so that it can adapt to different tissue types and achieve better repair effects.

[0027] (2) The repair method using the target repair system of the present application can be carried out at room temperature without the need for additional heating equipment, which is required by pepsin in the prior art.

[0028] (3) The repair method of the present application can achieve the purpose of decrosslinking and repair the target in a shorter time of 5-10 minutes, while the prior art requires 30-45 minutes for pepsin.

[0029] (4) Different working solution concentrations and time have a gentler effect on the tissue and are less likely to destroy the integrity of the tissue morphology. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 This is the microscopic detection result of Example 1.

[0031] Figure 2 This is the microscopic detection result of Example 2.

[0032] Figure 3 This is the microscopic detection result of Example 3.

[0033] Figure 4 This is the microscopic detection result of Comparative Example 1.

[0034] Figure 5 This is the microscopic detection result of Example 4.

[0035] Figure 6 This is the microscopic detection result of Example 5.

[0036] Figure 7 This is the microscopic detection result of Example 6.

[0037] Figure 8 This is the microscopic detection result of Example 7.

[0038] Figure 9 This is the microscopic detection result of Example 8.

[0039] Figure 10 This is the microscopic detection result of Example 9.

[0040] Figure 11 This is the microscopic detection result of Example 10.

[0041] Figure 12 This is the microscopic detection result of Example 11.

[0042] Figure 13 This is the microscopic detection result of Comparative Example 2.

[0043] Figure 14 This is the microscopic detection result of Comparative Example 3.

[0044] Figure 15 This is the microscopic detection result of Comparative Example 4. DETAILED DESCRIPTION

[0045] Before describing the embodiments of the present application in detail, it should be understood that the terms used herein are only used for the purpose of describing specific embodiments. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by ordinary technicians in the field to which the terms belong.

[0046] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be understood as indicating or implying relative importance or implicitly indicating the number of the indicated technical features. Therefore, the features defined as "first" and "second" may explicitly or implicitly include one or more of the features. Further, in the description of this application, unless otherwise specified, the meaning of "plurality" is two or more.

[0047] The endpoints and any values ​​of the ranges disclosed in this application are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0048] In the present application, the terms "include" or "comprising" are open expressions, that is, including the contents specified in the present application, but not excluding other contents.

[0049] The present application provides a sample target repair system for in situ detection of nucleic acid or protein, wherein the target repair system comprises 1-50 U / mL proteinase K and 1-10 mg / mL elastase.

[0050] The present application also provides a method for preparing the above-mentioned target repair system, which specifically comprises the following steps: dissolving 1-50 U / mL proteinase K and 1-10 mg / mL elastase in a Tris-EDTA solution at pH 7.6 to prepare a 20× mother solution.

[0051] In addition, the present application provides a sample target repair method for in situ detection of nucleic acids or proteins, specifically: adding the target repair system to the sample for repair for 5-10 minutes.

[0052] The present application also provides the use of the above-mentioned target repair system in the pre-treatment of samples for in situ detection of nucleic acids or proteins.

[0053] In order to make the purpose, technical scheme and advantages of the present application clearer, the technical scheme in the embodiments of the present application will be clearly and completely described below in conjunction with the accompanying drawings. Based on the embodiments of the present application, all other embodiments obtained by those skilled in the art without making creative work belong to the scope of protection of the present application. The embodiments described below are exemplary and are only used to explain the present application, and cannot be understood as limiting the present application.

[0054] If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the field or the product instructions are used. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased commercially.

[0055] The present application is further described in detail below in conjunction with the embodiments, drawings and test results.

[0056] The following are examples of target repair performed on various tissues.

[0057] The target repair performance was comprehensively evaluated based on the amount of RNA in situ detection signal and its signal intensity, the degree of tissue morphology retention, and the tissue autofluorescence background. That is, the more the signal detection amount, the higher the signal intensity, the less tissue morphology loss, and the less autofluorescence background after repair, the better the repair performance of the scheme.

[0058] Example

[0059] Continuous adjacent sections of human breast cancer FFPE samples were used to perform in situ detection of RNA for target repair using a single proteinase K (manufacturer NEB, catalog number P8107S, the same below) and a combination of proteinase K and different concentrations of elastase (manufacturer Diamond, catalog number A002290, the same below) to test the target repair performance of the present application.

[0060] Example 1

[0061] This embodiment provides an in situ detection method, wherein the target repair system includes 1.25 U / mL proteinase K and 0.25 mg / mL elastase.

[0062] The specific steps include:

[0063] 1. Tissue pretreatment of paraffin samples

[0064] (1) Baking: Bake the FFPE tissue sections in an oven at 60°C for 30 min.

[0065] (2) Dewaxing and rehydration: Immerse the sections in two cylinders of xylene at room temperature to ensure that the tissue is fully covered. Dewax for 15 min and 10 min respectively. Then immerse the sections in two cylinders of 100% alcohol for 2 min each. Wash the tissue three times with PBST (1× PBS containing 0.1% Tween-20).

[0066] (3) Fixation: Add 4% PFA (Biyuntian) to the tissue, discard the liquid after fixation for 10 minutes, and wash the tissue three times with PBST.

[0067] (4) Target repair: 1.25 U / mL proteinase K and 0.25 mg / mL elastase were added to the tissue and treated at 37°C for 5 min. The slices were then removed and the tissue was washed three times with PBST.

[0068] (5) Dehydration and drying: Immerse the sections in 70%, 85% and 100% ethanol for gradient dehydration, each time for 1 min.

[0069] (6) Draw the hydrophobic circle: After the slices are dried, use Imm Edge TM Use a pen to draw a hydrophobic circle with a diameter of 1 cm around the tissue. After the hydrophobic circle is dry, wash the tissue inside the hydrophobic circle three times with PBST.

[0070] (II) In-situ testing process

[0071] (1) Dual-ligation probe hybridization

[0072] Add 50 μL of hybridization mixture containing 0.1 μM dual-ligation probe (Shanghai Bioengineering, the same probe below), 6×SSC (Sigma), and 10% formamide (Sigma) to the tissue, and hybridize at 46°C for 4 h to allow the probes designed for different target genes to fully bind to their targets, then wash the tissue three times with PBST; then use a probe washing solution containing 2×SSC and 20% formamide to wash the tissue three times at 46°C for 5 min each time, and then wash the tissue three times with PBST.

[0073] The probe sequences used are shown in Table 1, specifically: the nucleotide sequences shown in SEQ ID NO: 1-30.

[0074] Table 1 Probe sequences used

[0075] SEQ ID NO: Name Sequence Information (5' to 3') 1 Hsa-DLP-UBC-L1 TGCGACCCAAATCCCGTCTCGTTTTCTGAACTGCATCGGTATCAAG 2 Hsa-DLP-UBC-R1 CTGTTTAAGAAGCAGCGAACCATACGTGACATCCACAAACAAGAAC 3 Hsa-DLP-UBC-L2 TTCACGAAGATCTGCATCTCGTTTTCTGAACTGCATCGGTATCAAG 4 Hsa-DLP-UBC-R2 CTGTTTAAGAAGCAGCGAACCATACGTGACCTTACCAGTCAGGGTC 5 Hsa-DLP-UBC-L3 TGCAGAGTGGACTCTTTCTCGTTTTCTGAACTGCATCGGTATCAAG 6 Hsa-DLP-UBC-R3 CTGTTTAAGAAGCAGCGAACCATACGTGACCAAGCGCAGGACCAAG 7 Hsa-DLP-UBC-L4 AGTCAGACAGGGTGCGTCTCGTTTTCTGAACTGCATCGGTATCAAG 8 Hsa-DLP-UBC-R4 CTGTTTAAGAAGCAGCGAACCATACGTGACTCTTTCTGGATGTTGT 9 Hsa-DLP-UBC-L5 TTGCCAGTGAGTGTCTTCTCGTTTTCTGAACTGCATCGGTATCAAG 10 Hsa-DLP-UBC-R5 CTGTTTAAGAAGCAGCGAACCATACGTGACCTCAAGGGTGATGGTC 11 Hsa-DLP-PPIB-L1 TTTGGGCCCCTTCTTCTCTCGTTTTCTGAACTGCTACGGTATCAAG 12 Hsa-DLP-PPIB-R1 CTGTTTAAGAAGTAGCCGTGACTATCGACTACACCTTGACGGTGAC 13 Hsa-DLP-PPIB-L2 TCCGCCCTGGATCATGTCTCGTTTTCTGAACTGCTACGGTATCAAG 14 Hsa-DLP-PPIB-R2 CTGTTTAAGAAGTAGCCGTGACTATCGACTCTCCCCTGGTGAAGTC 15 Hsa-DLP-PPIB-L3 TGTCTTGGTGCTCTCCTCTCGTTTTCTGAACTGCTACGGTATCAAG 16 Hsa-DLP-PPIB-R3 CTGTTTAAGAAGTAGCCGTGACTATCGACTGTTTATCCCGGCTGTC 17 Hsa-DLP-PPIB-L4 TCAAAGAAAGATGTCCTCTCGTTTTCTGAACTGCTACGGTATCAAG 18 Hsa-DLP-PPIB-R4 CTGTTTAAGAAGTAGCCGTGACTATCGACTCTGCACAGACGGTCAC 19 Hsa-DLP-PPIB-L5 TGTGGAATGTGAGGGGTCTCGTTTTCTGAACTGCTACGGTATCAAG 20 Hsa-DLP-PPIB-R5 CTGTTTAAGAAGTAGCCGTGACTATCGACTAGTGAGTCCATGGGCC 21 DLP-dapB-L1 TTCAGATACGCCATGATCTCGTTTTCTGAACTATCGCGGTATCAAG 22 DLP-dapB-R1 CTGTTTAAGAGGGCCTTATTCCGGTGCTATATGGATGGCCAAACGC 23 DLP-dapB-L2 TTGACGCACCAAGCGGTCTCGTTTTCTGAACTATCGCGGTATCAAG 24 DLP-dapB-R2 CTGTTTAAGAGGGCCTTATTCCGGTGCTATCATCATGACCAGAAGC 25 DLP-dapB-L3 AACAACCGGTTTCTCATCTCGTTTTCTGAACTATCGCGGTATCAAG 26 DLP-dapB-R3 CTGTTTAAGAGGGCCTTATTCCGGTGCTATTCCGTCCAGTTGTCGG 27 DLP-dapB-L4 TTGGCAGAACGAACACTCTCGTTTTCTGAACTATCGCGGTATCAAG 28 DLP-dapB-R4 CTGTTTAAGAGGGCCTTATTCCGGTGCTATGCAGGAAGCTGTTAAA 29 DLP-dapB-L5 TCCGTCTTCCGGGACTTCTCGTTTTCTGAACTATCGCGGTATCAAG 30 DLP-dapB-R5 CTGTTTAAGAGGGCCTTATTCCGGTGCTATATTCGCTTGCACAGCG

[0076] (2) First step of ligation of dual ligation probes

[0077] 50 μL of a ligation reaction mixture containing 25% glycerol (Sigma), 0.2 μg / μL BSA, 1× SplintR buffer (NEB), 0.25 U / μL SplintR ligase (NEB), and 1 U / μL RiboLock RNase inhibitor (Thermo) was added to the tissue and incubated at 37°C for 30 min, followed by washing the tissue three times with PBST.

[0078] (3) Circularization of dual-ligation probes

[0079] Add 50 μL of a circularization mixture containing 0.5 μM circularization template sequence ST, 2 mM ATP, 0.2 μg / μL BSA, 1×T4 DNA Ligase buffer, 1 U / μL T4 DNA Ligase and 1 U / μL RiboLock RNase inhibitor to the tissue, incubate at 37°C for 30 min, and then wash the tissue three times with PBST. Wherein, the circularization template sequence is the nucleotide sequence shown in SEQ ID NO: 31, specifically: TCTTAAACAGCTTGATACCG.

[0080] (4) Rolling circle amplification

[0081] Add 50 μL of rolling circle amplification reaction solution containing 1 mM dNTP (Thermo), 5% glycerol, 0.2 μg / μL BSA, 1×phi29 buffer, 1 U / μL phi29 DNA polymerase and 1 U / μL RiboLock RNase inhibitor to the tissue, incubate at 30°C for 12-16 hours, and then wash the tissue three times with PBST.

[0082] (5) Fluorescent probe detection

[0083] Add 50 μL of detection reaction solution containing 2×SSC, 20% formamide, and 0.1 μM fluorescent detection probe to the tissue and incubate at room temperature for 30 min. Then wash the tissue three times with PBST. After the tissue is naturally air-dried, add Slowfade anti-fluorescence quencher (Thermo) containing 0.5 μg / mL DAPI. After incubation at room temperature for about 5 min, fluorescence microscopy imaging can be performed.

[0084] The fluorescent detection probe sequences used are shown in Table 2, specifically: the nucleotide sequences shown in SEQ ID NOs: 32-35.

[0085] Table 2 Fluorescence detection probe sequences used

[0086] SEQ ID NO: Name Sequence Information (5' to 3') 5' Modification 32 DP-1-Cy3 AGTAGCCGTGACTATCGACT Cy3 33 DP-2-TXR GGGCCTTATTCCGGTGCTAT TXR 34 DP-3-Cy5 AGCAGCGAACCATACGTGAC Cy5 35 DP-4-Cy7 TGCGTCTATTTAGTGGAGCC Cy7

[0087] Example 2

[0088] This embodiment provides an in-situ detection method.

[0089] The difference from Example 1 is that the enzymes used for target repair of tissue pretreatment of paraffin sample are 1.25 U / mL proteinase K and 0.5 mg / mL elastase. The rest is the same as Example 1.

[0090] Example 3

[0091] This embodiment provides an in-situ detection method.

[0092] The difference from Example 1 is that the enzymes used for target repair of tissue pretreatment of paraffin samples are 1.25 U / mL proteinase K and 1 mg / mL elastase. The rest is the same as Example 1.

[0093] Comparative Example

[0094] Comparative Example 1

[0095] This comparative example provides an in-situ detection method.

[0096] The difference from Example 1 is that the enzyme used for target repair of tissue pretreatment of paraffin sample is 1.25 U / mL proteinase K. The rest is the same as Example 1.

[0097] Test result 1

[0098] The test results of the above examples 1-3 and comparative example 1 are as follows: Figures 1-4 (Image results including DAPI channel (blue signal) and other signal channels) are shown.

[0099] contrast Figures 1-4 From the test results, it can be seen that comparative example 1 is a condition using only a single enzyme 1.25U / mL proteinase K, and the results show that each channel has the least signal points (different colored dots are signals); while Examples 1-3 are conditions using proteinase K compounded with different concentrations of elastase, and the results show that each channel has a similar high signal detection amount, especially when treated with "1.25U / mL proteinase K and 0.25mg / mL elastase", i.e., the 1× working solution described in this application, for 5 minutes, the detection performance is the best, which is manifested as a relatively lower spontaneous background and a higher signal intensity.

[0100] Continuous adjacent sections of human breast cancer FFPE samples were used to perform in situ detection of RNA for target repair using a combination working solution of proteinase K and elastase at different concentrations to test the target repair performance of the present application.

[0101] Example 4

[0102] This embodiment provides an in-situ detection method.

[0103] The difference from Example 1 is that the enzymes used for target repair of tissue pretreatment of paraffin sample are 1.25 U / mL proteinase K and 0.25 mg / mL elastase. The rest are the same as Example 1.

[0104] Example 5

[0105] This embodiment provides an in-situ detection method.

[0106] The difference from Example 1 is that the enzymes used for target repair of tissue pretreatment of paraffin sample are 2.5 U / mL proteinase K and 0.25 mg / mL elastase. The rest are the same as Example 1.

[0107] Example 6

[0108] This embodiment provides an in-situ detection method.

[0109] The difference from Example 1 is that the enzymes used for target repair of tissue pretreatment of paraffin sample are 5 U / mL proteinase K and 0.25 mg / mL elastase. The rest are the same as Example 1.

[0110] Test result 2

[0111] The test results of the above-mentioned embodiments 4-6 are as follows: Figures 5-7 (Image results without DAPI channel, only other signal channels) are shown.

[0112] contrast Figures 5-7 The test results show that no negative gene signals were detected under all conditions in the above examples. When the 1× working solution of "1.25 U / mL proteinase K and 0.25 mg / mL elastase" was used for 5 minutes, there was a higher positive signal detection amount and a more complete tissue morphology. The tissue morphology under other conditions showed varying degrees of damage.

[0113] Continuous adjacent sections of mouse heart FFPE samples were used to perform in situ detection of RNA for target repair using a combination working solution of proteinase K and elastase at different concentrations to test the target repair performance of the present application.

[0114] Example 7

[0115] This embodiment provides an in-situ detection method.

[0116] The difference from Example 1 is that the enzymes used for target repair of tissue pretreatment of paraffin sample are 1.25 U / mL proteinase K and 0.25 mg / mL elastase (1× working solution) for 5 min. The rest is the same as Example 1.

[0117] In addition, the probe sequences used in (1) double-ligation probe hybridization in the in situ detection process are shown in Table 3, specifically: the nucleotide sequences shown in SEQ ID NOs: 36-45.

[0118] Table 3 Probe sequences used

[0119] SEQ ID NO: Name Sequence Information (5' to 3') 36 Mmu-DLP-Ubc-L1 TTTGCCTTGACATTCTTCTCGTTTTCTGAACTGCATCGGTATCAAG 37 Mmu-DLP-Ubc-R1 CTGTTTAAGAAGCAGCGAACCATACGTGACCTCCTTGTCCTGGATC 38 Mmu-DLP-Ubc-L2 AGTCTGACAGGGTGCGTCTCGTTTTCTGAACTGCATCGGTATCAAG 39 Mmu-DLP-Ubc-R2 CTGTTTAAGAAGCAGCGAACCATACGTGACTCTTTCTGGATGTTGT 40 Mmu-DLP-Ubc-L3 TCTGAGGCGAAGGACTTCTCGTTTTCTGAACTGCATCGGTATCAAG 41 Mmu-DLP-Ubc-R3 CTGTTTAAGAAGCAGCGAACCATACGTGACAGATCTGCATCCCACC 42 Mmu-DLP-Ubc-L4 ATGGTGTCACTGGGCTTCTCGTTTTCTGAACTGCATCGGTATCAAG 43 Mmu-DLP-Ubc-R4 CTGTTTAAGAAGCAGCGAACCATACGTGACTGCCTTGACATTCTCT 44 Mmu-DLP-Ubc-L5 TTCCTGTTTGACCTTCTCTCGTTTTCTGAACTGCATCGGTATCAAG 45 Mmu-DLP-Ubc-R5 CTGTTTAAGAAGCAGCGAACCATACGTGACGGAAGGTACGTCTGTC

[0120] Example 8

[0121] This embodiment provides an in-situ detection method.

[0122] The difference from Example 1 is that the enzymes used for target repair of tissue pretreatment of paraffin sample are 2.5 U / mL proteinase K and 0.5 mg / mL elastase (2× working solution) for 5 min. The rest is the same as Example 1.

[0123] Example 9

[0124] This embodiment provides an in-situ detection method.

[0125] The difference from Example 1 is that the enzymes used for target repair of tissue pretreatment of paraffin sample are 1.25 U / mL proteinase K and 0.25 mg / mL elastase (1× working solution) for 10 min. The rest is the same as Example 1.

[0126] Example 10

[0127] This embodiment provides an in-situ detection method.

[0128] The difference from Example 1 is that the enzymes used for target repair of tissue pretreatment of paraffin sample are 0.625 U / mL proteinase K and 0.125 mg / mL elastase (0.5× working solution) for 5 min. The rest is the same as Example 1.

[0129] Embodiment 11

[0130] This embodiment provides an in-situ detection method.

[0131] The difference from Example 1 is that the enzymes used for target repair of tissue pretreatment of paraffin sample are 0.625 U / mL proteinase K and 0.125 mg / mL elastase (0.5× working solution) for 10 min. The rest is the same as Example 1.

[0132] Comparative Example 2

[0133] This comparative example provides an in-situ detection method.

[0134] The difference between this method and Example 1 is that no target repair treatment is performed in the tissue pretreatment of the paraffin sample. The rest is the same as Example 1.

[0135] Comparative Example 3

[0136] This comparative example provides an in-situ detection method.

[0137] The difference from Example 1 is that the enzyme used for target repair of the tissue pre-treatment of the paraffin sample is 0.25 U / mL elastase for 30 min. The rest is the same as Example 1.

[0138] Comparative Example 4

[0139] This comparative example provides an in-situ detection method.

[0140] The difference from Example 1 is that the enzyme used for target repair of tissue pretreatment of paraffin sample is 1.25 U / mL proteinase K for 20 min. The rest is the same as Example 1.

[0141] Test result three

[0142] The test results of the above examples 7-11 and comparative examples 2-4 are as follows: Figures 8-15 shown.

[0143] contrast Figures 8-15 The test results show that no negative gene signals were detected in all conditions.

[0144] From the results of Comparative Examples 3-4, it can be seen that using only any protease alone for target repair requires a longer time or a higher enzyme concentration to achieve a better detection effect, but none of them is as good as the repair effect of the 1× working solution of the present application. Using the 1× working solution of "1.25U / mL proteinase K and 0.25mg / mL elastase" of the present application for 5 minutes to repair the target, the highest signal intensity and signal detection amount can be obtained.

[0145] In addition, since there are also organizational differences in continuous sections, relatively good detection results can also be obtained by treating with the 2× working solution of the present application for 5 minutes and the 1× working solution of the present application for 10 minutes.

[0146] In summary, the target repair system developed in this application combines the cleavage capabilities of multiple proteases on different amino acid chemical bonds, can be adapted to different tissue types, and has better repair effects and higher signal detection efficiency.

[0147] In the description of this specification, the description with reference to the terms "one embodiment", "some embodiments", "example", "specific example" or "some examples" etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present application. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art may combine and combine the different embodiments or examples described in this specification and the features of the different embodiments or examples, without contradiction.

[0148] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present application, rather than to limit it. Although the present application has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present application.

Claims

1. A sample target repair system for in situ detection of nucleic acids or proteins, characterized in that: The target repair system includes 1-50 U / mL proteinase K and 1-10 mg / mL elastase.

2. The target repair system according to claim 1, characterized in that: The concentration of the proteinase K is 0.625-5U / mL; Optionally, the concentration of the proteinase K is 1.25-2.5 U / mL.

3. The target repair system according to claim 1, characterized in that: The concentration of the elastase is 0.125-1 mg / mL; Optionally, the concentration of elastase is 0.25-0.5 mg / mL.

4. A method for preparing a target repair system according to any one of claims 1 to 3, characterized in that: The specific steps include: Dissolve 1-50 U / mL proteinase K and 1-10 mg / mL elastase in a solution of pH A 20× stock solution was prepared from 7.6% Tris-EDTA solution.

5. A sample target repair method for in situ detection of nucleic acids or proteins, characterized in that: The target repair method is accomplished using the target repair system described in any one of claims 1-3.

6. The target repair method according to claim 5, characterized in that: The sample type is FFPE sample.

7. The target repair method according to claim 1, characterized in that: The target repair system is added to the sample and repaired for 5-10 minutes.

8. The target repair method according to claim 1, characterized in that: The repair method is carried out at room temperature.

9. Use of the target repair system according to any one of claims 1 to 3 in sample pretreatment for in situ detection of nucleic acids or proteins.

Images