Molecular marker group, primer and detection method for detecting acetamiprid pesticide residues and application

Abstract

The invention relates to the technical field of pesticide residue detection, and particularly discloses a molecular marker group for detecting acetamiprid pesticide residues, a primer, a detection method and application, the molecular marker group is a combination of ND1, ND4 and ND5, the nucleotide sequence of the ND1 is as shown in SEQ ID NO.1, the nucleotide sequence of the ND4 is as shown in SEQ ID NO.2, and the nucleotide sequence of the ND5 is as shown in SEQ ID NO.3. The invention further discloses a method for detecting acetamiprid pesticide residues. The molecular marker group and the primer provided by the invention can detect acetamiprid pesticide residues with high sensitivity, the detection limit is 5 [mu] g / L and is approximately equal to 5 * 10 <-3 > mg / kg, the solution concentration is very low, and the density can be approximate to the density rho of water and is equal to 1kg / L.

Description

Technical Field

[0001] The present invention relates to the technical field of pesticide residue detection, and in particular to a molecular marker group, primers, a detection method and an application for detecting acetamiprid pesticide residue. Background Art

[0002] Chromatography is the most widely used method for pesticide residue detection. Various highly sensitive detectors are used in chromatographic analysis, such as the flame photometric detector (FPD), which is selective for sulfur and phosphorus and is often used to detect organophosphorus pesticide residues in crops; the electron capture detector (ECD), which is used to detect electronegative substances and is often used to detect organochlorine pesticide residues in crops. It can be seen that chromatographic detection can often only determine the residue of the target element in crops, but cannot determine the specific type of pesticide. Currently, chromatographic detection is combined with mass spectrometry to solve this problem. Before chromatographic separation, crop samples need to go through extraction, purification, concentration and other steps. Due to the differences in the matrix and structure of different samples, such as high or low fat content, high or low water content, high or low chlorophyll content, etc., the solvents used for extraction must be different, which leads to different samples having their own suitable extraction solvent systems. The universality and promotion of this method are lacking. In addition, due to the different target pesticides to be extracted, the selection of extraction solvents and extraction methods changes accordingly. This method can only detect a certain type of pesticide each time, and the efficiency of checking the comprehensive application of multiple types of pesticides is low.

[0003] Enzyme inhibition method often uses the inhibitory effect of pesticides on crop acetylcholinesterase (AChE) to determine the pesticide residue in the test sample by the degree of color development in the enzyme-catalyzed substrate reaction. AChE is sensitive to organophosphorus pesticides, and the determination is sensitive and selective, but it is expensive, and some pesticides do not inhibit it significantly, so it needs to add oxidizing agents or pretreatment to improve the sensitivity of pesticide detection. Immunoassay is an analytical method based on the specific reaction between protein antigens and antibodies or between small molecule haptens and antibodies. Enzyme immunoassay (ELISA) is often used for pesticide residue detection, and the detection level can reach ng or even pg level, but because the pesticide antibodies used are difficult to prepare and the development cost is high, immunoassay is only suitable for the analysis and detection of a single type of pesticide residue, and is not suitable for multi-residue analysis. At present, most biosensors used for pesticide residue detection are designed based on enzyme inhibition method and immunoassay.

[0004] A biosensor is a stand-alone device that integrates an immobilized biological element (e.g., enzyme, DNA probe, antibody) that recognizes an analyte (e.g., enzyme substrate, complementary DNA, antigen) and a transduction element that converts the (bio)chemical signal generated by the interaction of the analyte with a biological receptor into an electronic signal. Based on the signal transduction technology, biosensors are divided into electrochemical, optical, piezoelectric, and mechanical biosensors.

[0005] Among them, enzyme biosensors are widely used in pesticide detection. The design of enzyme biosensors is based on the immobilization method, that is, the enzyme is adsorbed by van der Waals forces, ionic bonds or covalent bonds. This immobilized enzyme consumes substrates or analytes and co-substrates and obtains products. Then, the response of the biosensor is achieved by measuring the co-substrate consumption or product yield, or evaluating substances or inhibitors that specifically interact with the immobilized enzyme and inhibit its biocatalytic properties. This inhibitor binds to the enzyme or enzyme-substrate complex and further interferes with the enzyme's reaction. Commonly used enzymes for this purpose are cholinesterase, oxidoreductase, polyphenol oxidase, peroxidase and ammonia oxidase. Based on this basic process, the enzyme biosensor method has poor detection specificity, a limited number of environmental pollutants of the enzyme substrate, a high detection limit, and a low sensitivity (generally around 20 μg / kg). It is difficult to accurately monitor low-concentration pesticide residues and can often only play a qualitative monitoring function.

[0006] Acetamiprid is a chlorinated nicotinoid compound. Its common name in English is acetamiprid. Its chemical name is N-(N-cyano-ethylimino)-N-methyl-2-chloropyridine-5-methylamine. Its chemical formula is C 10 H 11 ClN4, acetamiprid is a new type of insecticide. It is a new type of pyridine insecticide with stomach poison, contact killing and strong penetration, and shows fast-acting insecticidal power and long residual effect. It is also an insecticide with certain acaricidal activity, and its mode of action is a systemic insecticide for soil and branches and leaves. It is widely used in the prevention and control of aphids, planthoppers, thrips, and some lepidopteran pests in rice, especially vegetables, fruit trees, and tea. It mainly acts on contact killing and stomach poison, and has a certain repellent and antifeedant effect on pests, but has no systemic and fumigation effects. It acts on the nicotinic acetylcholine receptors at the synaptic site of the insect nervous system, interferes with the stimulation conduction of the insect nervous system, causes the blockage of the nervous system pathway, and causes the accumulation of the neurotransmitter acetylcholine at the synaptic site, thereby causing insect paralysis and eventual death. With the development of molecular biotechnology and its wide application, molecular markers have been used in the field of detection, but the sensitivity needs to be improved, and there are few studies on molecular markers for detecting acetamiprid. Summary of the invention

[0007] In order to provide a method for detecting pesticide residues with low detection limit and high sensitivity, the present invention provides a molecular marker group, primers, detection method and application for detecting acetamiprid pesticide residues. Residual pesticides in the body, ND1, ND4 and ND5 were all significantly expressed, which could be judged as the presence of acetamiprid residues.

[0008] The present invention provides a molecular marker group for detecting acetamiprid pesticide residues, wherein the molecular marker group is a combination of ND1, ND4 and ND5;

[0009] The nucleotide sequence of the ND1 is shown in SEQ ID NO.1;

[0010] The nucleotide sequence of the ND4 is shown in SEQ ID NO.2;

[0011] The nucleotide sequence of the ND5 is shown in SEQ ID NO.3.

[0012] The present invention also provides primers for amplifying the molecular marker group for detecting acetamiprid pesticide residues, wherein the primers include a primer pair for amplifying the ND1, a primer pair for amplifying the ND4, and a primer pair for amplifying the ND5;

[0013] The primer pair sequence for amplifying the ND1 is shown in SEQ ID NO.4-5;

[0014] The primer pair sequence for amplifying the ND4 is shown in SEQ ID NO.6-7;

[0015] The primer pair sequences for amplifying the ND5 are shown in SEQ ID NO.8-9.

[0016] The present invention also provides a detection kit comprising the primers.

[0017] Furthermore, the detection kit also includes a total RNA extraction reagent, an RNA reverse transcription reagent, an internal reference gene amplification primer set, and a real-time fluorescence quantitative PCR amplification reagent.

[0018] Furthermore, the real-time fluorescence quantitative PCR amplification reagent includes ROX dye and fluorescent dye.

[0019] The present invention also provides a method for detecting acetamiprid pesticide residues using the molecular marker group, the primers or the detection kit, comprising the following steps:

[0020] The pesticide to be tested was mixed with the leaf horn After 24 h of stress culture, the leaf angle short anus was treated with pure water 24h was the control group;

[0021] Extract the leaf horn short anus RNA;

[0022] Then with the short anus of the leaf angle RNA is used as a template, and RT-qPCR reaction is performed using the primers described in claim 2;

[0023] If the expression levels of ND1, ND4 and ND5 after the test pesticide stress culture are significantly upregulated compared with the control group, it is considered that acetamiprid residues exist.

[0024] The present invention also provides the use of the molecular marker group, the primer or the detection kit in detecting acetamiprid pesticide residues, wherein the minimum detection limit of acetamiprid is 5 μg / L≈5×10 -3 mg / kg (the concentration of the solution is very low, and the density can be approximated to the density of water ρ=1kg / L).

[0025] The present invention also provides the use of the molecular marker group, the primer or the detection kit in identifying the types of pesticide residue pollution, and the types of pesticide residue pollution include acetamiprid, chlorpyrifos and cyfluthrin.

[0026] Furthermore, the tested pesticides were used to stress the cultured leaf angle short anus Cultivation of Psoralea corylifolia in pure water As the control group, the leaf horn short anus was extracted after the culture RNA was used as a template, and RT-qPCR reactions were performed using SEQ ID NO.4-5, SEQ ID NO.6-7, and SEQ ID NO.8-9 sequences as primers. If the expression levels of ND1, ND4, and ND5 were significantly upregulated compared with the control group, it was considered that acetamiprid residues were present.

[0027] Furthermore, the expression levels of ND1, ND4 and ND5 were significantly upregulated compared with the control group as shown in the following:

[0028] The expression level of ND1 was upregulated by 1.67±0.18 times, the expression level of ND4 was upregulated by 1.43±0.16 times, and the expression level of ND5 was upregulated by 1.66±0.10 times compared with the control group.

[0029] Compared with the prior art, the present invention has the following beneficial effects:

[0030] 1. The molecular markers and primer sets provided by the present invention have the advantages of low detection limit and high sensitivity. Under low concentration (5 μg / L) of acetamiprid pesticide stress, its mitochondrial protein encoding genes ND1, ND4 and ND5 were significantly expressed. The detection limit of acetamiprid was 5 μg / L≈5×10 -3mg / kg (the concentration of the solution is very low, and the density is close to the density of water ρ=1kg / L), which is lower than the maximum residue limit of acetamiprid for each food category in the national food safety standards.

[0031] 2. The detection method provided by the present invention has the following advantages:

[0032] (1) High sensitivity: Mitochondria are important sites for cellular respiration and are sensitive to environmental changes. They can respond quickly to environmental stresses and can also express significant differences in response to lower concentrations of pesticides. At the same time, fluorescent quantitative PCR is very sensitive to the detection of target DNA and can reliably detect low concentrations of pesticide residues, thereby improving the sensitivity of detection.

[0033] (2) Real-time monitoring: Fluorescence quantitative PCR allows real-time monitoring of the accumulation of PCR products during the reaction. This real-time monitoring feature helps to improve detection speed and accuracy.

[0034] (3) High specificity: Specific primers are designed for the target gene fragments, and the introduction of fluorescent probes or dyes makes the detection of PCR products more specific, reduces the possibility of nonspecific reactions, and improves the accuracy of detection.

[0035] (4) Multiplex detection: Fluorescence quantitative PCR can detect the expression of multiple mitochondrial genes at the same time, which is very beneficial for the comprehensive detection of multiple pesticide residues that may exist in the environment.

[0036] (5) Automation: Fluorescence quantitative PCR can be combined with automated equipment to achieve high-throughput pesticide residue detection and improve detection efficiency.

[0037] (6) High efficiency: Fluorescence quantitative PCR is highly efficient and rapid, and can quickly detect a large number of pesticide residue samples.

[0038] (7) Cost reduction: Real-time monitoring enables data to be acquired while the PCR reaction is ongoing, thereby shortening the experimental cycle and reducing the cost of pesticide residue testing.

[0039] (8) Qualitative analysis: Fluorescence quantitative PCR can be used to quantitatively analyze mitochondrial gene expression through the strength of the fluorescence signal, thereby performing a qualitative analysis of pesticide residues and providing more information.

[0040] (9) Strong practicality: the concentration is 5 μg / L≈5×10 -3 mg / kg (the concentration of the solution is very low, and the density can be approximated to the density of water ρ=1kg / L) is less than or equal to the maximum residue limit of acetamiprid for each food category in the national food safety standards. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0042] Figure 1 Short anus Changes in gene expression before and after acetamiprid stress.

[0043] Figure 2 Short anus Changes in gene expression before and after different pesticide stresses;

[0044] In the figure, A shows the changes in ND1 gene expression before and after different pesticide stresses, where Control represents the control group, DCM represents the acetamiprid group, DSP represents the chlorpyrifos group, and FLQ represents the cyfluthrin group;

[0045] B is the changes in ND4 gene expression before and after different pesticide stresses, where Control represents the control group, DCM represents the acetamiprid group, DSP represents the chlorpyrifos group, and FLQ represents the cyfluthrin group;

[0046] C shows the changes in ND5 gene expression before and after different pesticide stresses, where Control represents the control group, DCM represents the acetamiprid group, DSP represents the chlorpyrifos group, and FLQ represents the cyfluthrin group. DETAILED DESCRIPTION

[0047] The specific embodiments of the present invention are described in detail below, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the scope of protection of the present invention. The experimental methods described in the embodiments of the present invention are conventional methods unless otherwise specified, and the materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0048] Example 1: Molecular markers, primer sets, and detection methods and applications for detecting acetamiprid pesticide residues.

[0049] 1. Experimental Methods

[0050] 1. Sample collection

[0051] The samples were collected from Wenshan, Yunnan. The laboratory has been breeding pure line leaf horn short anus for two years and four generations.

[0052] 2. Study on mitochondrial genome expression

[0053] ① Pesticide stress culture

[0054] Pseudocerma brachyphyllum After the nymphs were adapted to culture in an artificial incubator for one month, 18 healthy individuals with a body length of 6.5 to 8.5 cm (average body length 7.24 cm, in the old nymph stage) were selected and divided into two groups (control group and acetamiprid group), with 9 samples in each group. Then, the leaf horn short anus was cultured with acetamiprid at an active ingredient concentration of 5 μg / L. An equal amount of pure water was used as control.

[0055] Weigh 0.0010g of 5% acetamiprid (Xianglong Biochemical Co., Ltd.) with an active ingredient content of 5% using an analytical balance, add purified water to prepare 0.10L of 0.0005g / L acetamiprid stock solution, dilute to 5μg / L, and use a pipette to draw 10mL into a spray bottle with a corresponding label. Use the differential method to reduce the error caused by the residue in the spray bottle, and evenly spray 5mL of purified water and 5mL of acetamiprid dilution in the corresponding incubator, and perform stress culture for 24h.

[0056] After stress culture, remove the leaf horn short anus The intestines of the first four abdominal segments were dissected and extracted and placed in 1.5 mL centrifuge tubes. The samples were divided into sealed bags, marked, and quickly frozen in liquid nitrogen and stored in a -80°C refrigerator.

[0057] ② Fluorescence quantitative PCR

[0058] (a) RNA extraction

[0059] Take the leaf horn short anus stored in -80℃ refrigerator Intestinal tissue samples were placed in 1.5 mL centrifuge tubes, and total RNA was extracted using the TaKaRa Mini BEST Universal RNA Extraction Kit (TaKaRa, Tokyo, Japan). The specific steps were carried out according to the instructions of the kit. All extracted sample RNAs were detected by gel electrophoresis (120 V electrophoresis for 30 min). After the electrophoresis, they were observed on a blue light gel cutter. The 18S and 28S rRNA bands were clear to verify the integrity of the RNA. The RNA concentration was quantified using a micro-ultraviolet spectrophotometer and stored in a -80 °C refrigerator.

[0060] (b) Synthesis of cDNA

[0061] Referring to the reverse transcription kit of PrimeScriptTM RT reagent Kit (Takara), the extracted leaf horn short anus RNA was tested according to the steps in the experiment. The genomic DNA in the extracted RNA solution was removed and reverse transcribed to form cDNA:

[0062] Prepare the reaction mixture on ice according to the ingredients in Table 1. To ensure the accuracy of the reaction mixture preparation, when performing each reaction, prepare the Master Mix according to the amount of reaction attribute + 2, and then divide it into each reaction tube (for example: if you make 3 tubes, prepare the Master Mix amount for 5 tubes, and then divide it into 3 tubes), and finally add the RNA sample.

[0063] Table 1 DNA removal reaction system

[0064]

[0065]

[0066] Prepare the reaction mixture on ice according to the ingredients in Table 2. To ensure the accuracy of the reaction mixture preparation, when performing each reaction, in order to avoid errors caused by tube wall residues, the Master Mix should be prepared according to the number of reaction tubes + 2, and then divided into each reaction tube (for example: if you make 3 tubes, prepare the Master Mix amount for 5 tubes, and then divide it into 3 tubes). After gently mixing, immediately proceed with the reverse transcription reaction.

[0067] Table 2 Reverse transcription reaction system

[0068]

[0069] (c) Design and synthesize primers

[0070] According to the leaf angle short anus provided by the laboratory Three protein-coding gene sequences were obtained, and fluorescent quantitative primers for protein-coding genes were designed using Primer premier6.0. For the internal reference gene, the β-actin gene sequence of species similar to the stick insect order was obtained through literature search, and the sequence was compared using Mega 7.0 software. Primers were designed based on the conserved region of the sequence (see Table 3) to amplify the short anus of the leaf horn The internal reference gene β-actin. All primers were synthesized by Shanghai Bioengineering Biotechnology Co., Ltd.

[0071] (d) Determination of fluorescence quantitative primer standard curve

[0072] Extract the leaf horn short anus of the control group according to the above steps RNA was used to reverse synthesize cDNA 10 μL, and appropriate amount of template cDNA was diluted with EASY Dilution by 1, 10, 100, 1000, and 10000 times, and then a 20 μL reaction system was prepared (see Table 4). Each sample was repeated 3 times in an Applied Biosystems 7500 instrument, and the reaction program was as follows: pre-denaturation at 95°C for 30 s, [denaturation at 95°C for 5 s, annealing at 52°C for 30 s] for 40 cycles, and finally 95°C for 15 s, 60°C for 1 h, and 95°C for 15 s for melting curve drawing. StepOne Software v2.2.2 (Applied Biosystems, Foster City, CA, USA) was used to select the "standard curve" program for data statistics, analysis, and drawing of standard curves. According to the single peak of the melting curve and the standard curve R 2 Four pairs of fluorescence quantitative primers were screened with E values ​​above 0.980 and between 90 and 110 (see Table 3).

[0073] Table 3 List of primers for RT-qPCR gene and β-actin gene amplification

[0074]

[0075] ND1:

[0076] AATACTCTGTGCTACTGCCCGTAAACCACCTAATAAAGAATAATTAGAATTTGATGACCAACCAGCAATTAT(SEQ ID NO.1);

[0077] ND4:

[0078] GGTGGTGCTGCTATATTATATGAACTTAACAAAAATCATCATAAAGATATTGAAGGTATTAAATTAATTAAACCCTTAATAATTAATAATCTTCGTCTACCTAA TCGC (SEQ ID NO. 2);

[0080] ND5:

[0081] CCCAATACGATTTGATAGTGCAGTAATTATCCCAGCATTATAAGATTTAACATTCGATAATAAATTACTAAACAATAAGAAACTAACCCTAAGCCATCTCAA CCTAAT (SEQ ID NO. 3).

[0083] Table 4 20μL PCR system

[0084] Experimental reagents Usage Remark Chimeric fluorescence qPCR reagent (TB Green Premix Ex Taq II (Tli RNascH Plus) (2×)) 10μL 1x PCR Reverse Primer (10pM) 0.8μL 0.4μM Upstream primer (PCR Froward Primer (10pM)) 0.8μL 0.4μM Fluorescent quantitative PCR reference dye (ROX Reference Dye or Dye ll) 0.4μL DNA template (<100ng) 2μL <![CDATA[Double-distilled sterile water (ddH2O)]]> 6μL

[0085] (e) Determination of relative gene expression

[0086] The reaction system and procedure were consistent with the determination of the standard curve. The “Comparative CT (ΔΔCT)” program was selected using StepOne Software v2.2.2 (Applied Biosystems, Foster City, CA, USA) for statistical analysis of the data. Four samples were randomly selected from each group to determine the expression level. Each sample was technically repeated three times, and the expression level was reflected by the RQ value (RQ = 2^(-ΔΔCt)).

[0087] ③ Determination of changes in mitochondrial gene expression under low concentrations of different pesticide stresses

[0088] The leaf angle of the control group and the 5 μg / L acetamiprid stress treatment were taken. Samples were collected for RNA extraction and reverse synthesis of cDNA, and RT-qPCR was used to determine the leaf angle short anus The relative expression levels of protein-coding genes were analyzed by t-test to find out the genes ND1, ND4, and ND5 that were significantly different (P<0.05) and extremely significantly different (P<0.01) from the control group. Origin 8.0 software was used to analyze the data and create charts.

[0089] The results are as follows Figure 1 As shown, the leaf angle is short Under low concentration (5 μg / L) of acetamiprid pesticide stress, its mitochondrial protein coding genes ND1, ND4, and ND5 were significantly expressed, among which the expression level of ND1 was upregulated by 1.67±0.18 times compared with the control group, the expression level of ND4 was upregulated by 1.43±0.16 times compared with the control group, and the expression level of ND5 was upregulated by 1.66±0.10 times compared with the control group.

[0090] Example 2: Application of a primer set for detecting acetamiprid pesticide residues in detecting pesticide residues.

[0091] 1. Experimental Methods

[0092] 1. Detection method:

[0093] Collect environmental samples and extract pesticide residues from the environment;

[0094] The steps for extracting pesticide residues in the environment are as follows: accurately weigh 10.0 g of the sample (accurate to 0.1 g), continuously rinse the sample with a columnar pure water stream until the eluent reaches 0.1 L, take part of the eluent and dilute it with pure water to different concentration gradients (10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 ) of the pesticide samples to be tested, and then stress cultured the leaf angle short anus 24h;

[0095] Extract the leaf horn short anus RNA;

[0096] Then with the short anus of the leaf angle RNA was used as template, and RT-qPCR reactions were performed using the primers shown in Table 3;

[0097] If the expression levels of ND1, ND4 and ND5 are significantly upregulated compared with the control group, it is considered that acetamiprid remains. Figure 2 As shown, it is inferred that the pesticide residue concentration is close to 5 μg / L at this time, and the original pesticide residue concentration can be estimated by recording the dilution multiple.

[0098] Example 3: Application of the primer set provided in Example 1 in identifying acetamiprid pesticide residues.

[0099] 1. Experimental Methods

[0100] 1. Detection method: According to the method steps of Example 1, a control group (pure water treatment), acetamiprid group (DCM), chlorpyrifos group (DSP) and flucythrin group (FLQ) were set up.

[0101] Chlorpyrifos group (DSP): Chlorpyrifos was prepared at a concentration of 5 μg / L and the leaf angle of short anus was treated according to the method of Example 1. Stress culture for 24 h.

[0102] Flucythrin group (FLQ): Flucythrin was prepared at a concentration of 5 μg / L and the leaf angle of short anus was treated according to the method of Example 1. Stress culture for 24 h.

[0103] The control group and the acetamiprid group were treated in the same manner as in Example 1;

[0104] After the stress culture, the short anal of each group was extracted RNA;

[0105] Then with the short anus of the leaf angle RNA was used as template, and RT-qPCR reaction was performed using the primers shown in Table 3.

[0106] The experimental results are as follows Figure 2 As shown in the figure, under the same treatment conditions, only the expression level of ND5 in the chlorpyrifos group increased significantly compared with the control group, up-regulated by 1.38±0.15 times, while ND1 and ND4 had no significant changes, and the t-test results were 0.29 and 0.14, respectively, both greater than 0.05; only the expression levels of ND1 and ND5 in the cyfluthrin group increased significantly compared with the control group, up-regulated by 1.71±0.07 times and 1.65±0.38 times, respectively, while ND4 had no significant change, and the t-test result was 0.09 greater than 0.05; only the expression levels of ND1, ND4 and ND5 in the acetamiprid group (DCM) were significantly increased compared with the control group, up-regulated by 1.67±0.18 times, 1.43±0.16 times and 1.66±0.10 times, respectively. Therefore, the combination of ND1, ND4 and ND5 can be used as the specific expression gene of acetamiprid for the identification and differentiation of acetamiprid pesticide residues.

[0107] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0108] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A molecular marker group for detecting acetamiprid pesticide residues, characterized in that: The molecular marker group is a combination of ND1, ND4 and ND5; The nucleotide sequence of the ND1 is shown in SEQ ID NO.1; The nucleotide sequence of the ND4 is shown in SEQ ID NO.2; The nucleotide sequence of the ND5 is shown in SEQ ID NO.

3.

2. A primer for amplifying the molecular marker set for detecting acetamiprid pesticide residues according to claim 1, characterized in that: The primers include a primer pair for amplifying the ND1, a primer pair for amplifying the ND4, and a primer pair for amplifying the ND5; The primer pair sequence for amplifying the ND1 is shown in SEQ ID NO.4-5; The primer pair sequence for amplifying the ND4 is shown in SEQ ID NO.6-7; The primer pair sequences for amplifying the ND5 are shown in SEQ ID NO.8-9.

3. A detection kit comprising the primers according to claim 2.

4. The detection kit according to claim 3, characterized in that The detection kit also includes a total RNA extraction reagent, an RNA reverse transcription reagent, an internal reference gene amplification primer set, and a real-time fluorescence quantitative PCR amplification reagent.

5. The detection kit according to claim 4, characterized in that Real-time fluorescence quantitative PCR amplification reagents include ROX dye and fluorescent dye.

6. A method for detecting acetamiprid pesticide residues using the molecular marker set according to claim 1, the primers according to claim 2, or the kit according to claim 3, characterized in that: The steps include: The pesticide to be tested was mixed with the leaf horn Stress culture, treatment of leaf angle short anus with pure water as the control group; After the stress culture, the leaf horn was extracted RNA; Then with the short anus of the leaf angle RNA is used as a template, and RT-qPCR reaction is performed using the primers described in claim 2; If the expression levels of ND1, ND4 and ND5 after the test pesticide stress culture are significantly upregulated compared with the control group, it is considered that acetamiprid residues exist.

7. Use of the molecular marker set according to claim 1, the primers according to claim 2, or the detection kit according to claim 3 in detecting acetamiprid pesticide residues, characterized in that: The minimum detection limit of acetamiprid is 5 μg / L.

8. Use of the molecular marker set according to claim 1, the primers according to claim 2, or the detection kit according to claim 3 in identifying the types of pesticide residue pollution, characterized in that: The types of pesticide residue pollution include acetamiprid, chlorpyrifos and cypermethrin.

9. The use according to claim 8, characterized in that: Pesticides tested were used to stress the cultured leaf angle short anus Treating Psoralea corylifolia with purified water As the control group, the leaf horn was extracted after the culture. RNA was used as a template, and RT-qPCR reactions were performed using SEQ ID NO.4-5, SEQ ID NO.6-7, and SEQ ID NO.8-9 sequences as primers. If the expression levels of ND1, ND4, and ND5 were significantly upregulated compared with the control group, it was considered that acetamiprid residues were present.

10. The use according to claim 9, characterized in that: The expression levels of ND1, ND4 and ND5 were significantly upregulated compared with the control group as shown in the following: The expression level of ND1 was upregulated by 1.67±0.18 times, the expression level of ND4 was upregulated by 1.43±0.16 times, and the expression level of ND5 was upregulated by 1.66±0.10 times compared with the control group.

Images