Application of peripheral blood cell mitochondrial copy number in evaluation of oocyte quality
By detecting the mitochondrial copy number of peripheral blood cells and using rt-qPCR technology combined with specific primers, the problem of lack of non-invasive assessment of oocyte quality in the prior art is solved, and effective evaluation of oocyte quality and prediction of embryo quality are achieved.
Patent Information
- Application Number
- CN202410760337.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-13
- Publication Date
- 2024-12-13
AI Technical Summary
The prior art lacks a non-invasive and easy-to-get-available method to comprehensively evaluate oocyte quality, affecting the success rate of assisted reproductive technology.
Using mitochondrial copy number of peripheral blood cells as markers of oocyte quality, mitochondrial DNA copy number was detected by rt-qPCR, combined with Ct analysis, and providing primers for MT-TL1, MT-ND4 and β2 microglobulin genes, which was used for menstruation in women. Tests were conducted for 2-3 days and on the 5th day of controlled ovulation induction.
This method is simple and non-invasive, can effectively reflect the quality of oocytes and guide subsequent treatment. The mitochondrial copy number of peripheral blood cells on the 2nd and 3rd days of menstruation is highly positively correlated with the mitochondrial copy number of granule cells, improving the prediction of oocytes and embryos quality accuracy.
Smart Images
Figure FT_1 
Figure FT_2
Abstract
Description
Technical Field
[0001] The invention relates to the field of bioengineering, and in particular to the application of peripheral blood cell mitochondrial copy number in evaluating oocyte quality. Background Art
[0002] Mitochondria are the main energy-supplying organelles of organisms, providing more than 95% of the body's energy. They are also the energy source for the synchronous maturation of the oocyte nucleus and cytoplasm and further fertilization. Mitochondria have their own genome, which exists in multiple copies in each cell, and the number varies between individuals and tissues. The mitochondrial DNA copy number is the number of mitochondrial DNA in the mitochondrial genome. Each mitochondria contains 2-10 mitochondrial DNA copies. The normal number of mitochondrial DNA copies per somatic cell is 10. 3 -10 4 , which has certain specificity in different types of tissues.
[0003] The quality of oocytes and embryos is one of the key factors affecting the success rate of human assisted reproductive technology. There are many methods and standards for evaluating oocyte quality. At present, the morphological method is the most commonly used method to evaluate the developmental potential of oocytes. The morphology of the cumulus-oocyte complex (COCs), the first polar body morphology, the size of the perivitelline space, the cytoplasm morphology, the spindle morphology, etc. are mainly used to judge the quality of oocytes. It has been found that the mitochondrial DNA copy number of oocytes and embryos is correlated with the quality of oocytes and embryos. The high mitochondrial DNA copy number in oocytes and early embryos is positively correlated with good quality of oocytes and embryos.
[0004] There is still an urgent need for a non-invasive and easily available marker that can reflect oocyte quality, so as to more comprehensively evaluate patients before treatment and guide subsequent treatment. Summary of the invention
[0005] Since the mitochondrial DNA copy number of peripheral blood cells is highly correlated with the mitochondrial DNA copy number of cumulus granulosa cells, based on this, the present application uses the mitochondrial DNA copy number of peripheral blood cells as a possible marker for predicting oocyte quality. In order to achieve the above-mentioned invention object, the technical scheme of the present invention is as follows: First, the present invention provides a marker for evaluating oocyte quality, wherein the marker comprises the mitochondrial copy number of peripheral blood cells.
[0006] Secondly, the present invention provides a suitable time to detect the above-mentioned markers, namely, day 2-3 of the female menstrual period and day 5 of controlled ovulation induction.
[0007] Thirdly, the present invention provides a suitable method for detecting and reporting the above-mentioned markers, namely, detecting the mitochondrial DNA copy number by rt-qPCR and analyzing the data using the comparative Ct method. The data is normalized to nuclear deoxyribonucleic acid (nDNA) and reported as mtDNA / nDNA.
[0008] Fourth, the present invention provides primers required for the above detection method, namely MT-TL1 (encoding mitochondrial transfer RNA leucine 1, forward sequence: TGGCCATGGGTATGTTGTTA, reverse sequence: CACCCAAGAACAGGGTTTGT), MT-ND4 (encoding mitochondrial NADH dehydrogenase 4, forward sequence: TCCTCCTATCCCTCAACCCC, reverse sequence: CACAATCTGATGTTTTGGTTAAAC) and β2 microglobulin gene (forward sequence: TGCTGTCTCCATGTTTGATGTATCT, reverse sequence: TCTCTGCTCCCCACCTCTAAGT).
[0009] Compared with the prior art, the present invention has the following positive and beneficial effects: The mitochondrial copy number of peripheral blood cells on the 2nd-3rd day of menstruation is highly positively correlated with the mitochondrial copy number of granulosa cells. 5 ml of peripheral blood is obtained on the 2nd-3rd day of the female menstruation period to measure the mitochondrial copy number of peripheral blood cells. The acquisition method is simple and non-invasive, does not add extra burden to the patient, and has reference value for reflecting the quality of oocytes and can guide subsequent treatment. BRIEF DESCRIPTION OF THE DRAWINGS
[0010] Figure 1 This is a graph showing the differences in mitochondrial copy numbers in peripheral blood cells of different oocyte quality groups on the 2nd to 3rd day of menstruation and the 5th day of controlled ovulation induction.
[0011] Figure 2 The mitochondrial copy number of peripheral blood cells on the 2nd to 3rd day of menstruation is an independent influencing factor of the high-quality embryo rate. DETAILED DESCRIPTION
[0012] The present invention will be further described in detail below in conjunction with specific examples. The following examples are not intended to limit the present invention, but are only intended to illustrate the present invention. The experimental methods used in the following examples are generally conventional, unless otherwise specified, and the materials, reagents, etc. used in the following examples are commercially available, unless otherwise specified.
[0013] 1. Study population inclusion It includes the sample size of the study, inclusion / exclusion / exit criteria, control methods and grouping methods, intervention measures, effect evaluation indicators, safety indicators, risk analysis, follow-up arrangements, data management and statistical analysis methods, informed consent, ethical considerations, etc.
[0014] Study sample size: Approximately 120 peripheral blood cells on day 2-3 of the menstrual period corresponding to IVF / ICSI.
[0015] Inclusion criteria: 1. Infertile women who meet IVF indications; 2. IVF cycles ≤ 3 times; 3. Male semen is normal; 4. No history of infectious diseases.
[0016] Exclusion criteria: 1. Previous ovarian surgery history; 2. Combined endocrine or autoimmune diseases (such as diabetes, thyroid disease or positive anti-thyroid antibodies); 3. Chromosomal abnormalities; 4. Uterine malformations; 5. Subjects with more than 3 IVF cycles.
[0017] Grouping method: Grouped according to oocyte quality.
[0018] Safety indicators: The cumulus cells required for this study are unused waste products of IVF / ICSI in clinical practice and will not cause harm to patients. The peripheral blood cells required for this study are obtained in a simple and non-invasive manner, without adding extra burden or risk to patients.
[0019] This study has been approved by ethics committee and informed consent was obtained from patients.
[0020] Meet ethical requirements.
[0021] Data management and statistical analysis methods: Measurement data were described in the form of mean ± standard deviation. The comparison between the means of two groups of measurement data that met the normal distribution and homogeneity of variance was performed using the t test; if it did not meet the normal distribution, the rank sum test of the means was used. Categorical variables were expressed as percentages (%), and inter-group comparisons were performed using the chi-square test. 2 Linear analysis was performed to screen predictive factors. P<0.05 was considered statistically significant.
[0022] Basic experimental methods: basic methods such as DNA extraction, PCR, RNA extraction, rt-qPCR, Western Blotting, etc., can refer to the conventional experimental methods in the existing technology.
Claims
1. A marker for evaluating oocyte quality, characterized in that: The markers include the copy number of mitochondrial DNA in peripheral blood cells.
2. Use of a reagent for detecting the biomarker according to claim 1 in preparing an oocyte quality assessment product.
3. An oocyte quality assessment product, characterized in that: The product comprises a reagent for detecting the marker according to claim 1.
4. The product according to claim 3, characterized in that: The products include independent reagents, test kits or chips.
5. Use of a reagent for detecting the marker according to claim 1 in preparing a product for predicting pregnancy outcomes in IVF / ICSI patients.
6. A product for predicting pregnancy outcomes of IVF / ICSI patients, characterized by: The product comprises a reagent for detecting the marker according to claim 1.
7. The product according to claim 6, characterized in that: The products include independent reagents, test kits or chips.