Rapid screening detection primer, probe and kit for vibrio parahaemolyticus in food and application of rapid screening detection primer, probe and kit

Abstract

The invention provides an RPA primer, a probe, a kit and a detection method for detecting vibrio parahaemolyticus in food. According to the invention, primers are designed and optimized for toxS genes of vibrio parahaemolyticus. The designed primer can effectively detect the vibrio parahaemolyticus from different food matrixes and has excellent specificity, sensitivity and inclusiveness, and the primer and the detection method can be used for rapid detection of the vibrio parahaemolyticus in food.

Description

Technical Field

[0001] The invention belongs to the field of rapid microbial detection, and in particular relates to rapid detection of Vibrio parahaemolyticus in food. Background Art

[0002] Vibrio parahaemolyticus is a major marine pathogen and the main pathogen of bacterial food poisoning in seafood worldwide. Vibrio parahaemolyticus belongs to the genus Vibrio of the family Chytridaceae. It is a Gram-negative halophilic marine bacterium. Vibrio parahaemolyticus mainly exists in shallow sea areas and can grow and reproduce in large numbers in almost all aquatic organisms. Clinically, it can cause abdominal pain, vomiting, diarrhea and other symptoms in humans, and even lead to death. The world's first recorded case of Vibrio parahaemolyticus food poisoning occurred in Japan. In 1950, an outbreak of food poisoning caused by eating dried herring occurred in Osaka, Japan, causing 272 people to become ill and 20 people to die. The Japanese Fujino first isolated Vibrio parahaemolyticus from dried herring. It was officially named by Japanese Sakazaki et al. in 1963. According to statistics from my country's Foodborne Disease Monitoring Network, Vibrio parahaemolyticus has become the leading pathogen of food poisoning in my country. In coastal areas, food poisoning caused by Vibrio parahaemolyticus accounts for as high as 50% to 70%. In 2016, the National Food Safety Risk Assessment Center released "Foodborne Pathogens That Cannot Be Neglected - Vibrio parahaemolyticus", pointing out that in recent years Vibrio parahaemolyticus has jumped to the top of the list of microbial pathogens of foodborne diseases in my country.

[0003] At present, my country has formulated relevant inspection standards, such as the national standard GB4789.7-2013 "National Food Safety Standard Food Microbiology Inspection Vibrio parahaemolyticus Inspection", etc. However, the main detection process of this inspection method includes pre-enrichment, selective enrichment, isolation and cultivation of target strains, serological biochemical identification and other steps, which are time-consuming. It takes a week to determine the experimental results of positive samples, which cannot meet the needs of rapid food safety detection.

[0004] In 2022, Li Darong (Li Darong. Establishment and application of RAA-LFD rapid detection method for Vibrio parahaemolyticus and Vibrio cholerae in aquatic products. Master, 2022.) established a rapid detection method for the tox R gene of Vibrio parahaemolyticus based on multiple recombinase-mediated isothermal amplification technology and lateral flow chromatography test strips (RAA-LFD). The rapid detection can be completed in 20 minutes at 36℃~38℃. Without enrichment, the sensitivity of RAA-LFD method for Vibrio parahaemolyticus in aquaculture water, shrimp, clams and fish is 7.4×10 3 CFU / mL, 7.4×10 4 CFU / g, 7.4×10 4 CFU / g and 7.4×10 5CFU / g. After 4 hours of enrichment, low contamination (7.4 CFU / g) of Vibrio parahaemolyticus can be detected. In the actual sample detection, the detection results of RAA-LFD method, national standard GB4789.72013 and PCR method showed good consistency, reaching 90.6% and 94.1% respectively, and the results had high consistency (K>0.75).

[0005] In 2020, Li Jiali et al. (Li Jiali. Research on Rapid Detection Technology of Foodborne Pathogens by Multiple Recombinase Polymerase Amplification. Master, 2020.) used the nuc gene of Staphylococcus aureus (GenBank accession number: EF529607.1), the toxR gene of Vibrio parahaemolyticus (GenBank accession number: GQ228073.1), and the fimY gene of Salmonella (GenBank accession number: JQ665438.1) as detection targets, and established a rapid detection technology for Staphylococcus aureus, Vibrio parahaemolyticus, and Salmonella based on RPA-LFD technology. The optimal reaction temperature was 37°C, and the optimal reaction time was 10min (excluding the detection time of LFD). The multiple LFD-RPA method has high detection sensitivity, and the detection limits of Staphylococcus aureus, Vibrio parahaemolyticus, and Salmonella are 2.6×10 1 CFU / mL, 7.6×10 1 CFU / mL, 1.3×10 1 In the artificial contaminated sample detection experiment, the detection limits of Staphylococcus aureus, Vibrio parahaemolyticus and Salmonella enteritidis in artificially contaminated food samples by the multiple LFD-RPA method were 4.5×10 1 CFU / mL, 8.3×10 1 CFU / mL and 2.7×10 1 CFU / mL.

[0006] In 2020, Liu Xiaoqing et al. (Liu Xiaoqing et al., Detection of Vibrio parahaemolyticus by RPA isothermal amplification technology, Food Industry Science and Technology, 2020, 41(01), 112-118) established a rapid detection method for Vibrio parahaemolyticus based on the recombinant polymerase-fluorescent probe (RPA-exo) method. The results can be obtained in 15 minutes, with high specificity and no cross-reaction; the sensitivity is 1.0×10 3 CFU / mL, the DNA detection limit is 0.35pg / μL, and the final concentration in the simulated contamination experiment is 1.36×10 3 CFU / mL, it can be detected without bacterial growth; in the actual sample testing, 3 out of 10 aquatic products were detected, and the test results were consistent with the national standard GB4789.7-2013.

[0007] In 2024, Xu et al. (Xu, Y. et al., 3D-Printed Integrated Handheld Biosensor for the Detection of Vibrio parahaemolyticus. Foods 2024, 13(11).) developed a detection technology for Vibrio parahaemolyticus based on RPA-LFD technology, and also developed a handheld result interpretation device to judge the results. The sensitivity of the detection using this technology can reach 4.9 CFU / mL.

[0008] In 2022, Jin et al. (Jin, B. et al., Simultaneous Detection of Five Foodborne Pathogens Using a Mini Automatic Nucleic Acid Extractor Combined with Recombinase Polymerase Amplification and Lateral Flow Immunoassay. Microorganisms 2022, 10 (7).) established a multiple RPA amplification technology based on RPA-LFD technology that can simultaneously detect Vibrio parahaemolyticus, Staphylococcus aureus, Salmonella, Escherichia coli O157:H7 and Listeria monocytogenes. This technology can complete the amplification reaction at 37°C in 15 minutes. The detection limit of the optimized RPA-LFIA can reach 10 1 CFU / mL. The average recoveries in spiked food samples were 90.5-104.5%.

[0009] In 2021, Wu (Wu, H. et al., Areversible valve-assisted chip coupling within integrated sample treatment and CRISPR / Cas12a for visual detection of Vibrioparahaemolyticus. Biosens Bioelectron 2021, 188, 113352.) et al. developed a multiple RPA rapid detection technology based on RPA-fluorescent lateral flow test strip technology that can simultaneously detect Listeria monocytogenes, Vibrio parahaemolyticus and Escherichia coli O157:H7. The entire experimental process can be completed within 20 minutes at 37°C. The detection limits of LFIA-RPA based on EuNP are 9.0 colony forming units (CFU) / mL for Listeria monocytogenes, 7.0 CFU / mL for Vibrio parahaemolyticus, and 4.0 CFU / mL for Escherichia coli O157:H7.

[0010] In 2020, Yang et al. (Yang, X. et al., An improved recombinase polymerase amplification assay for visual detection of Vibrio parahaemolyticus with lateral flow strips. J Food Sci 2020, 85(6), 1834-1844.) established a rapid detection technology for Vibrio parahaemolyticus based on RPA-LFS. The detection reaction can be completed in just 25 minutes at 35 to 45°C. After 2 hours of enrichment, the sensitivity can reach 10 CFU / 10g food.

[0011] In 2020, Ma et al. (Ma, B. et al., Multiplex Recombinase Polymerase Amplification Assay for the Simultaneous Detection of Three Foodborne Pathogens in Seafood. Foods 2020, 9(3).) established a multiplex RPA detection method based on RPA-LFS technology that can simultaneously complete Staphylococcus aureus, Vibrio parahaemolyticus and Salmonella enteritidis. The entire process, including amplification and reading, can be completed within 15 minutes at 37°C. The detection limits are 26 CFU / mL for Staphylococcus aureus, 76 CFU / mL for Vibrio parahaemolyticus, and 12.9 CFU / mL for Salmonella enteritidis. The method showed good recovery rates (92.00%-107.95%) in tests on spiked food samples.

[0012] In 2020, Jiang et al. (Jiang, W. et al., Recombinase polymerase amplification-lateral flow (RPA-LF) assay combined with immunomagnetic separation for rapid visual detection of Vibrio parahaemolyticus in raw oysters. Anal Bioanal Chem 2020, 412 (12), 2903-2914.) first attempted to optimize a recombinase polymerase amplification (RPA) and lateral flow (LF) assay combined with immunomagnetic separation (IMS) for the detection of Vibrio parahaemolyticus in oysters. The RPA-LF assay can complete the detection of V. parahaemolyticus within 15 minutes, including 10 minutes of RPA DNA amplification at 37°C and 5 minutes of visualization of the amplicon by LF bands. For the added oyster samples, the detection sensitivity of V. parahaemolyticus was increased to 2 CFU / g after 4 hours of enrichment by IMS-RPA-LF.

[0013] In 2019, Geng et al. (Geng, Y. et al., Development and evaluation of arapid and sensitive RPA assay for specific detection of Vibrio parahaemolyticus in seafood. BMC Microbiol 2019, 19(1), 186.) used Realtime RPA technology to establish a rapid detection method for Vibrio parahaemolyticus. The detection reaction can be completed in 20 minutes at 38°C. For standard strains, the detection limit is 10 2 copy / reaction, for artificially contaminated samples, at different bacterial concentrations, after 6 h of enrichment, the detection limit could detect Vibrio parahaemolyticus within 5-12 min by real-time RPA at concentrations as low as 4 CFU / 25 g, 1 CFU / 25 g, and 7 CFU / 25 g in soy sauce, cod, and hairtail, respectively.

[0014] In addition, there are some patented technologies for RPA detection of Vibrio parahaemolyticus. For example, CN106967816A discloses a RPA specific primer and kit and application for detecting Vibrio parahaemolyticus in food. Specific detection primers are designed based on the toxR gene of Vibrio parahaemolyticus, and the detection sensitivity is 3×10 3CFU / mL. CN110804670A discloses a specific primer pair, a kit and an application for rapid detection of Vibrio parahaemolyticus based on RPA-LFS. Primers are designed based on the genes of Vibrio parahaemolyticus thermolabile hemolytic toxin (TLH), thermostable direct hemolytic toxin (TDH) and relatively thermostable direct hemolytic toxin (TRH) as target sequences. The test results can be obtained within 20 minutes at 35°C-45°C, and the detection limit is 1CFU / reaction. CN109680079A discloses RPA primers, probes, kits and methods for detecting Vibrio parahaemolyticus, using irgb as the target gene, and selecting its specific conserved region as the target region for primer probe design. It can be used to quickly detect whether there is nucleic acid of Vibrio parahaemolyticus in a sample, and the amplification results can be obtained in 15 minutes, and the detection limit can reach 0.002ng / reaction.

[0015] However, the detection matrix in the food field is complex, and the sugar, salt, and oil components in food have a great impact on the sensitivity of PCR detection (Schrader, C. et al., PCR inhibitors-occurrence, properties and removal. Journal of Applied Microbiology, 113 (5), 1014-1026.). Therefore, evaluating the impact of different food matrices on reaction sensitivity is an important technical component for developing rapid detection methods for food matrices. None of the above documents discloses effective detection of Vibrio parahaemolyticus in complex food matrices, nor does it provide a rapid detection technology solution with excellent specificity, sensitivity and tolerance. Summary of the invention

[0016] The present invention is based on the principle of fluorescent probe-RPA detection technology, and designs specific primers and probes for Vibrio parahaemolyticus. According to the requirements of relevant standards, the inclusiveness, exclusivity and sensitivity of the primers and probes are verified; in order to break through the technical bottleneck of too long pre-enrichment time, the present invention optimizes the pre-enrichment culture conditions of Vibrio parahaemolyticus, and uses a shaking culture method to shorten the pre-enrichment time to 6 hours; according to the relevant requirements of GB29921-2021 National Food Safety Standard "Limits of Pathogenic Bacteria in Pre-packaged Foods", fish sauce, salmon and seafood rice balls (aquatic products) are selected as food matrices to artificially contaminate samples. At the same time, GB 4789.7-2013 National Food Safety Standard "Food Microbiology Test for Vibrio parahaemolyticus" and the rapid detection method established by the present invention are used to detect contaminated samples, and the detection limit LOD of the rapid detection method is 2.384777-2017. 503-7 CFU / mL (different food matrices have a slight effect on the detection limit of the method). Overall, the rapid detection method established by the present invention can complete the rapid detection of Vibrio parahaemolyticus within 20 minutes after 6 hours of pre-enrichment, and the detection limit is no higher than 2.5 times that of the national standard method GB4789.7, which fully meets the verification requirements of the evaluation standard for rapid detection methods "Conformity Assessment-Guidelines for Validation and Validation of Microbiological Detection Methods".

[0017] In order to effectively and quickly detect Vibrio parahaemolyticus in a complex food matrix, the present invention provides an RPA primer for detecting Vibrio parahaemolyticus. The gene (AY527396.1ToxS gene) in the NCBI database is selected as the target gene for primer and probe design. Primer express software is used to carry out primer design, and the designed primers and probes are screened to screen out primers with outstanding sensitivity, specificity and tolerance for the detection of Vibrio parahaemolyticus in food. Among them, the upstream primer sequence of the primer is 5'-AAAGTTGAGCAAGTGCTTACATCAAATGAAT-3', and the downstream primer sequence is 5'-AATCGCCATTCGGCAGGTACTTAACGTTCGA-3'. Preferably, biotin modification is performed at the 5' end of the upstream primer.

[0018] The present invention also provides an RPA probe for detecting Vibrio parahaemolyticus in food, characterized in that: the sequence of the probe is 5'-GACTGTGATTACTGATAACTTGCCAGACGA[FAM-dt]AC[THF]G[BHQ1-dt]AGGCCCGTTACGTCGA[C3 Spacer]-3';

[0019] Among them, FAM-dt is the fluorescent group labeled with FAM; THF is the tetrahydrofuran residue; BHQ1-dt is the fluorescence quenching group; C3 Spacer is the C3 blocking group.

[0020] The present invention also provides a kit for detecting RPA of Vibrio parahaemolyticus in food, which comprises the aforementioned RPA primers for detecting Vibrio parahaemolyticus, and more preferably, further comprises the aforementioned RPA probe.

[0021] The present invention also provides an RPA composition for detecting Vibrio parahaemolyticus in food, wherein the composition comprises the RPA primer and the RPA probe.

[0022] At the same time, the present invention also provides a method for detecting Vibrio parahaemolyticus in food, which comprises the following steps:

[0023] (1) extracting genomic DNA of the sample to be tested;

[0024] (2) preparing an RPA reaction system, which comprises the aforementioned RPA composition and the genomic DNA of the sample to be tested extracted in step (1);

[0025] (3) performing an amplification reaction on the reaction system configured in step (2) at a constant temperature;

[0026] (4) Determine whether the genomic DNA of the sample to be tested contains Vibrio parahaemolyticus based on the amplification reaction results.

[0027] Preferably, the amplification reaction result is determined based on the fluorescence signal value; wherein the fluorescence signal is detected based on the addition of the RPA probe in the method. More preferably, a pre-enrichment step is performed before step (1), and the enrichment step is performed by shaking culture. More preferably, the shaking culture time is more than 6 hours, preferably 6 hours.

[0028] At the same time, the present invention also provides an RPA reaction system, wherein the reaction system is:

[0029] RPA reaction buffer: 29.4 μL

[0030] The upstream primer (10 μM) 2 μL

[0031] The downstream primer (10 μM) 2 μL

[0032] The probe (10 μM) 0.6 μL

[0033] ddH2O 12.5μL

[0034] Mg 2+ 2.5μL

[0035] Template: 1 μL.

[0036] Preferably, Mg in the system 2+ The final concentration is 2-15 mM, more preferably 14 mM. Further, the Mg 2+ It can be a magnesium chloride solution or a magnesium acetate solution, preferably a magnesium acetate solution.

[0037] The positive and progressive effects of the present invention are:

[0038] 1. The primers and probes designed by the present invention have excellent specificity and tolerance.

[0039] 2. The results of the present invention show that different food matrices have a slight effect on the sensitivity of the rapid detection method. When designing primers and probes at different sites on the same target, the amplification efficiency is completely different. When designing multiple sets of primers and performing primer sensitivity tests, the present invention selects primers and probes with excellent sensitivity, specificity and tolerance, and tests them with standard strains. The LOD 50 The sensitivity of the detection method established after bacterial enrichment was 3-7 CFU / mL.

[0040] 3. The validation of the rapid test method established in the present invention is in full compliance with the relevant requirements of GB4789.45-2023 "General Rules for Validation of National Standard Microbiological Test Methods for Food Safety", and the selected food matrix is ​​relatively complete.

[0041] 4. The rapid test method established by the present invention can complete the whole process from sample collection to test completion within 7 hours (enrichment + testing). The RLOD of the rapid test method and the national standard test method is no higher than 2.5, which fully complies with the relevant requirements of GB4789.45-2023 "General Rules for Validation of National Standard Microbiological Test Methods for Food Safety". BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1A-1B This is an inclusive test of RPA primers and probes for the detection of Vibrio parahaemolyticus. Figure 1A : Inclusiveness test of the first set of primers and probes; Figure 1B : Inclusivity test of the second set of primers and probes.

[0043] Figure 2A-2B This is an inclusive test of RPA primers and probes for the detection of Vibrio parahaemolyticus. Figure 2A : Exclusivity test of the first set of primers and probes; Figure 2B : Exclusivity test of the second set of primers and probes.

[0044] Figure 3A-3B This is a sensitivity test of two sets of primers and probes for Vibrio parahaemolyticus. Figure 3A Sensitivity testing of the first pair of primers and probes; Figure 3B The sensitivity test of the second pair of primers and probes; (1) represents the bacterial concentration of 4x10 4 CFU / mL; (2) represents the bacterial concentration of 4x10 3 CFU / mL; (3) represents the bacterial concentration of 4x10 2 CFU / mL; DETAILED DESCRIPTION

[0045] The present invention will be further described in detail below in conjunction with the accompanying drawings and embodiments. It is to be understood that the specific embodiments described herein are only used to explain the present invention, rather than to limit the present invention. It should also be noted that, for ease of description, only the parts related to the present invention are shown in the accompanying drawings, rather than all.

[0046] Example 1: DNA extraction

[0047] 1.1 DNA extraction methods for samples without food matrix

[0048] Use standard strains to streak culture on Vibrio chromogenic medium, pick characteristic colonies, dilute in phosphate buffer, take 1mL of bacterial solution, centrifuge at 12000g for 10min to collect bacteria, and remove supernatant. Add 100μL of pathogenic bacteria nucleic acid extraction and lysis solution (Yizhi Technology, YZV0802) to the precipitate, boil at 100℃ for 5min. Centrifuge at 1000g for 3min, take supernatant, use as RPA amplification template, and store at -20℃ for later use.

[0049] 1.2 DNA extraction methods for Vibrio parahaemolyticus in food matrices

[0050] Weigh 25g of sample into a conical flask containing 225mL of 3% sodium chloride alkaline peptone water, and shake and culture at 180rpm for 6h. After enrichment, take 1mL of enrichment solution, centrifuge at 500rpm for 1min to precipitate food impurities, and take the supernatant. Centrifuge at 12000rpm for 10min, take the precipitate to obtain bacteria. After discarding the supernatant, add lysis solution (Yizhi Technology, YZV0802) to the precipitate, boil at 100℃ for 5min. Centrifuge at 1000g for 3min, take the supernatant, use it as RPA amplification template, and store at -20℃ for later use.

[0051] Example 2: Design of primers and probes

[0052] The template sequences used in the primer design of the present invention are all from the National Center for Biotechnology Information (NCBI) database, and the primer design work is carried out using the primer express software. The gene (AY527396.1ToxS gene) in the NCBI database is selected as the target gene for primer and probe design. The primer design work is carried out using the primer express software, and the designed primers and probes are screened, and finally two pairs of primers and probes that can perform RPA amplification detection on Vibrio parahaemolyticus are obtained, and the sequences of the primers and probes are shown in Table 1.

[0053] Table 1 Primer and probe sequences for RPA detection of Vibrio parahaemolyticus

[0054]

[0055] Example 3: Reaction system and reaction conditions

[0056] The RPA amplification reaction was carried out using a fast isothermal amplification reagent (EXO-probe) (YZL0103, Yizhi Technology). The specific reaction system and reaction conditions are as follows: template 1μL, RPA reaction buffer 29.4μL, upstream primer (10μM) 2μL, downstream primer (10μM) 2μL, probe (10μM) 0.6μL, ddH2O 12.5μL, magnesium acetate solution 2.5μL, of which Mg 2+ The final concentration is 14 mM. After adding the system, mix well, centrifuge, react at 39°C for 20 min, and collect FAM fluorescence signals every 30 s.

[0057] Example 4: Inclusion Test

[0058] According to the "GB4789.45-2023 General Rules for Validation of National Food Safety Standard Microbiological Examination Methods", the designed primers and probes were subjected to inclusive testing experiments, and the standard strain Vibrio parahaemolyticus (ATCC17802) and Vibrio parahaemolyticus isolated from food were selected for inclusive testing. Among them, 8 clones were selected for the standard strain and 24 clones were selected for Vibrio parahaemolyticus isolated from food for inclusive verification experiments. When conducting the inclusive test, the inoculation level was approximately 100 times the minimum detection level of "GB 4789.7-2013 National Food Safety Standard Food Microbiological Examination Vibrio parahaemolyticus Examination" (approximately 100-1000 CFU / mL).

[0059] The primers and probes obtained by screening were tested for inclusiveness using the standard strain of Vibrio parahaemolyticus (ATCC17802), the standard strain of Vibrio parahaemolyticus (CICC21617) and Vibrio parahaemolyticus isolated from food, a total of 30 strains. The results are as follows Figure 1A-1B As shown in Figure 3, the primers and probes obtained by screening showed good inclusiveness.

[0060] Example 5: Exclusivity Test

[0061] According to the "GB4789.45-2023 National Food Safety Standard Microbiological Test Method Validation General Rules", bacterial species closely related to Vibrio parahaemolyticus were selected for exclusive experiments, and 30 strains of non-target microorganisms were selected for the exclusive experiment.

[0062] The samples were ① Vibrio alginolyticus (CICC10889), ② Vibrio vulnificus (ATCC27562), ③ Vibrio choleraesuis (ATCC7001), ④ Vibrio mimicus (CICC10474), ⑤ Vibrio freundii (CICC24882), ⑥ Photobacterium mermanii (CGMCC13753), ⑦ Vibrio campbellii (CGMCC13753), ⑧ Vibrio harveyi (CGMCC18773), ⑨ Pseudomonas aeruginosa (ATCC27853), ⑩ Staphylococcus aureus (ATCC25923), Listeria monocytogenes (ATCC19115), Streptococcus faecalis (ATCC29212), Vibrio parahaemolyticus (ATCC17802), Pseudomonas putida (CGMCC1.2309), Two sets of primers and probes for Vibrio parahaemolyticus obtained by screening were used to conduct exclusive tests on two strains of Pseudomonas fluorescens (CICC20066). The results are as follows Figure 2A-2B The primers and probes screened have good exclusivity and have no cross-reaction with all the test strains mentioned above.

[0063] Example 6: Sensitivity test

[0064] The standard strain was used as the test object. According to GB4789.45, 24 samples were used for sensitivity testing and the sensitivity was calculated. The specific process is as follows: Vibrio parahaemolyticus (ATCC17802) was used to prepare a bacterial suspension and the suspension was adjusted to a McFarland turbidity of 1. The bacterial suspension was diluted 10 times and the colony count of the dilution was performed. 10 samples were taken respectively. -1 ~10 -10 1 mL of diluent was centrifuged at 12000 g for 10 min, the supernatant was removed, and lysis buffer (YZV0802, Yizhi Technology) was added to prepare the RPA template, and the RPA experiment was carried out according to 2.3. After selecting the appropriate concentration of bacterial lysis buffer and carrying out 24 test reactions in parallel, the LOD was calculated using formula (1) 50 Calculation of the detection level at which 50% positive results are expected at a certain contamination level.

[0065]

[0066] In order to test the sensitivity of the two sets of primers and probes obtained by screening, Vibrio parahaemolyticus (ATCC17802) was selected and added to phosphate buffer to prepare a bacterial suspension with a McFarland turbidity of 1. The bacterial suspension was serially diluted 10 times, and the dilutions were plate counted. Different concentrations of dilutions were taken to prepare RPA templates according to the method of this example, and sensitivity tests were performed. The test results are shown in Figure 3A-3BThe sensitivity of the two pairs of primers and probes is very similar. When the bacterial concentration is 400 CFU / mL, the amplification reaction of RPA is close to the limit value. The results are shown in Figure 3.

[0067] In order to further determine the LOD of the two pairs of primers and probes 50 , select bacterial lysate with a bacterial concentration of 200 CFU / mL as the template for RPA amplification, conduct 24 RPA experiments in parallel, and calculate the number of positive test results obtained by each set of primers and probes. The number of positive test results obtained by the first set of primers and probes is 17. According to formula 1, its LOD 50 The value is 114 CFU / mL. The number of positive test results for the second set of primers and probes is 14. According to formula 1, its LOD 50 The value of the two sets of primers and probes is 160CFU / mL. 50 The values ​​were similar, and the sensitivity of the first set of primers was slightly higher than that of the second set.

[0068] Example 7: Sensitivity testing in food matrices

[0069] According to the relevant requirements of "GB 29921-2021 National Food Safety Standard Limits of Pathogenic Bacteria in Pre-packaged Foods", Vibrio parahaemolyticus testing is required in aquatic products. According to GB4789.45-2023 "General Rules for Validation of Microbiological Testing Methods in National Food Safety Standards", "If the scope of application of the method to be validated is "food", at least 5 types of food should be selected. If the scope of application is less than 5 types of food, all should be selected. Therefore, fish sauce, salmon and seafood rice balls were selected to carry out sensitivity testing experiments, and the inoculation amount of each sample was 1-10 CFU / mL.

[0070] After the food was sterilized, 25 g of the food sample was weighed into a sterile conical flask containing 225 mL of 3% sodium chloride alkaline peptone water, and an appropriate amount of Vibrio parahaemolyticus (ATCC17802) was added (the McFarland turbidity of the bacterial suspension of the standard strain was adjusted to 1 and then serially diluted 10 times, and the dilution with a bacterial concentration of 0-10 CFU / mL was selected for inoculation), and the culture was shaken at 200 rpm for 2 h, 4 h, 5 h, and 6 h, respectively, and 1 mL of the enrichment solution was taken, centrifuged at 12000 rpm for 10 min, the supernatant was removed, and 200 μL of lysis solution (YZV0802, Yizhi Technology) was added to the precipitate to prepare the RPA template, and the RPA experiment was carried out according to the reaction system and reaction conditions of Example 3. Twenty test experiments were carried out in parallel, and control tests were carried out in accordance with GB 4789.4-2024 National Food Safety Standard Microbiological Examination of Food - Salmonella Test. Then, according to GB4789.45-2023 National Food Safety Standard Microbiological Examination Method Validation General Rules, RLOD (relative detection level) was calculated according to formula (2) to evaluate the rapid screening technology developed for the invention.

[0071]

[0072] The test results show that the RLOD values ​​detected after 2-5 hours of shaking culture are all higher than 2.5, which does not meet the relevant requirements of GB4789.45-2023 "General Rules for Validation of Microbiological Testing Methods of National Food Safety Standards". Shaking culture for 6 hours is the shortest bacterial growth time, and shaking culture for 6 hours is the shortest bacterial growth time. Therefore, the present invention adopts shaking culture for 6 hours for testing.

[0073] For the rapid detection method developed by the present invention, after the contaminated sample is prepared, it is shaken and cultured in a conical flask at 200rpm for 6 hours, and then the sample is sampled for RPA detection and analysis. The control sample is detected and analyzed according to the method specified in GB 4789.7-2013 National Food Safety Standard Food Microbiology Test Vibrio parahaemolyticus Test. The specific test results are shown in Table 2.

[0074] Table 2 Analysis of sensitivity test results of the rapid screening method for Vibrio parahaemolyticus in food matrices

[0075]

[0076] It can be seen from Table 2 that the rapid test method established in the present invention can complete the whole process from sample collection to detection within 7 hours (enrichment + detection), and the RLOD of the rapid test method and the national standard test method is no higher than 2.5, which fully complies with the relevant requirements of GB4789.45-2023 "General Rules for Validation of National Standard Microbiological Test Methods for Food Safety".

[0077] The above content is a further detailed description of the present invention in combination with a specific preferred embodiment. It cannot be determined that the specific embodiments of the present invention are limited to this. For ordinary technicians in the technical field to which the present invention belongs, several simple deductions or substitutions can be made without departing from the concept of the present invention, which should be regarded as belonging to the protection scope of the present invention determined by the submitted claims.

Claims

1. An RPA primer for detecting Vibrio parahaemolyticus in food, characterized in that: The upstream primer sequence is 5'- AAAGTTGAGCAAGTGCTTACATCAAATGAAT-3', and its downstream primer sequence is 5'-AATCGCCATTCGGCAGGTACTTAACGTTCGA-3'.

2. The primer according to claim 1, characterized in that: The 5' end of the upstream primer is modified with biotin.

3. An RPA probe for detecting Vibrio parahaemolyticus in food, characterized in that: The sequence of the probe is 5'- GACTGTGATTACTGATAACTTGCCAGACGA[FAM-dt]AC[THF]G[BHQ1-dt]AGGCCCGTTACGTCGA[C3 Spacer]-3'; Among them, FAM-dt is the fluorescent group labeled with FAM; THF is the tetrahydrofuran residue; BHQ1-dt is the fluorescence quenching group; C3Spacer is the C3 blocking group.

4. An RPA kit for detecting Vibrio parahaemolyticus in food, characterized in that: Comprising the primers as claimed in claim 1.

5. The kit according to claim 4, characterized in that: The kit further comprises the probe according to claim 3.

6. A RPA composition for detecting Vibrio parahaemolyticus in food, characterized in that: The composition comprises the RPA primer according to claim 1 or 2 and the RPA probe according to claim 3.

7. A method for detecting Vibrio parahaemolyticus in food, comprising the following steps: (1) extracting genomic DNA of the sample to be tested; (2) preparing an RPA reaction system, which comprises the composition of claim 6 and the genomic DNA of the sample to be tested extracted in step (1); (3) performing an amplification reaction on the reaction system configured in step (2) at a constant temperature; (4) Determine whether the genomic DNA of the sample to be tested contains Vibrio parahaemolyticus based on the amplification reaction results.

8. The method of claim 7, wherein: It further includes: Before step (1), a pre-enrichment step is performed, wherein the enrichment step is performed by shaking culture, and the shaking culture time is more than 6 hours.

Images