Chrysanthemum TSWV virus field rapid detection method based on ERA technology

Abstract

The invention belongs to the field of molecular biology, and particularly relates to a probe, a primer group, a kit and a detection method for rapidly detecting a chrysanthemum TSWV virus. The primer group is selected from at least one of a primer group 1 and a primer group 2; the probe is provided with at least one fluorophore; the kit comprises the probe and the primer group, and further comprises freeze-dried microspheres and an activating agent, according to the method, whether a chrysanthemum sample contains the TAV virus or not is detected through an enzymatic recombinant isothermal amplification (ERA) technology. According to the invention, the experimental material can be detected at normal temperature without depending on laboratory conditions; the fluorescent probe and the primer have strong specificity and high sensitivity; the method is relatively low in cost and simple to operate, and results can be displayed in an extremely short time.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology, and particularly relates to a kit and a detection method for rapid detection of chrysanthemum TSWV virus. Background Art

[0002] Chrysanthemum (Chrysanthemum morifolium) has multiple economic values ​​such as ornamental, edible and medicinal. Viral diseases are important diseases in the growth process of chrysanthemum. Tomato spotted wilt virus (TSWV) is a membrane-bound single-stranded negative-sense RNA virus. The virus particle is spherical with a diameter of 85nm. The end point of virus dilution is 10 -2 ~10 -3 The passivation temperature is 43°C and it can survive in vitro for 2 to 5 hours at room temperature.

[0003] TSWV is one of the viruses with the widest range of host plants. It can infect more than 1,000 species of plants from 84 families, including Cucurbitaceae, Solanaceae, Asteraceae, Leguminosae and other plants. It is one of the more important economic diseases. TSWV is mainly spread persistently through thrips. Currently, 12 species of thrips are known to spread TSWV, including western flower thrips and tobacco thrips (Thrips tabaci), among which western flower thrips has the highest transmission rate. TSWV can also be transmitted through sap contact, etc. TSWV has an extremely short life cycle of the vector, rapid generational alternation and a wide range of hosts, making it difficult to cut off the source of infection of TSWV by burning infected plants.

[0004] Chrysanthemums infected with TSWV will have blackened stems, irregular necrotic spots on leaves, significantly shortened internodes, and wilting or even death of plants. TSWV is one of the most harmful viruses in chrysanthemum production in Japan, South Korea and other places. In 2017, chrysanthemums were first reported to be infected with TSWV in Beijing.

[0005] Currently known methods for detecting chrysanthemum TSWV virus include:

[0006] 1. The virus reverse transcriptase recombinase polymerase isothermal amplification (RPA) detection method is limited to laboratory operation and is not convenient for field operation.

[0007] 2. Multiplex RT-PCR detection method. This method must rely on experimental detection equipment and test materials, such as centrifuge, PCR instrument, electrophoresis instrument, ultra-micro spectrophotometer, ELISA instrument, computer, ice, dry ice, ice box, etc.; this method has high detection cost and strict experimental conditions, and can only be carried out in professional laboratories.

[0008] 3. TSWV virus double antigen one-step sandwich enzyme-linked immunosorbent assay (ELISA). This method has the disadvantages and shortcomings of being limited by the laboratory, expensive experimental costs and long detection time. Summary of the invention

[0009] In order to solve the above problems existing in the prior art, the inventor team of the present invention investigated the types and distribution characteristics of chrysanthemum virus disease in Beijing, and after a lot of creative work, established a handheld fluorescent probe gene mirror rapid open-field detection system and detection method for TSWV virus.

[0010] The present invention provides a probe and primer set for rapid detection of chrysanthemum TSWV virus, wherein the nucleotide sequence of the probe is shown in sequence 5 of a sequence table; the primer set is selected from at least one of primer set 1 and primer 2; the upstream primer of primer set 1 is shown in sequence 1 of the sequence table, and the downstream primer is shown in sequence 2 of the sequence table; the upstream primer of primer set 2 is shown in sequence 3 of the sequence table, and the downstream primer is shown in sequence 4 of the sequence table.

[0011] The present invention also provides a rapid detection kit for chrysanthemum TSWV virus, wherein the kit contains the above-mentioned probe and primer set.

[0012] The present invention also provides a method for rapid detection of chrysanthemum TSWV virus, which adopts the above-mentioned probe, primer, and kit.

[0013] The present invention also provides a probe, a primer set, a kit, and a detection method for rapid detection of chrysanthemum TSWV virus, and their application in rapid detection of chrysanthemum TAV virus.

[0014] The beneficial effects of the present invention are as follows:

[0015] 1. The present invention utilizes enzymatic recombinant isothermal amplification technology (ERA), which can detect experimental materials at room temperature without relying on laboratory conditions; the fluorescent probes and primers of the present invention have strong specificity and high sensitivity; the kit and detection method of the present invention can obtain the same detection results as traditional RT-PCR and ELISA methods, with extremely high accuracy.

[0016] 2. The present invention is to conduct experimental analysis on the corresponding organs of chrysanthemums in the field in the open air. It is a method and system for determining whether a plant carries the chrysanthemum virus within a few tens of seconds for positive results in 0.5min-19min, and a very few weak negative results are known to be negative in about 100-200S, but because of the setting of the detection instrument program, it will not display "-" until 1139 seconds. All detection operations only require a portable virus detection kit, which includes disposable gloves, a spray bottle filled with alcohol (optional), a 100μL pipette with about 50-100 gun tips, a plant lysis reagent, a special test kit, a handheld detector and a centrifuge tube, so that the virus can be quickly detected anytime and anywhere in the field.

[0017] 3. The cost of testing each sample in the present invention is relatively low, the operation is simple, it can be performed at room temperature without being restricted by environmental conditions, the results can be displayed in a very short time, and the probability of false positive test results is low. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is a photo of the experimental material of Example 1.

[0019] Figure 2 This is the electrophoresis diagram of the specific detection amplification band of Detection Example 1.

[0020] Figure 3 This is the electrophoresis diagram of the sensitivity detection amplification band of detection example 1.

[0021] Figure 4 This is the electrophoresis diagram of the bands amplified by RT-PCR in detection example 2. DETAILED DESCRIPTION

[0022] To make the technical solution, purpose and advantages of the present invention clearer, the present invention is further described in detail below through specific implementation examples. It should be understood that the specific implementation methods described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention.

[0023] In a first aspect, the present invention provides a probe and primer for rapid detection of chrysanthemum TSWV virus.

[0024] The nucleotide sequence of the probe is as follows:

[0025] 5'-ATCTACCTGTTGGAAGTACATGAAGACCTGCGTGATTCTCCTGG CGA-3' (sequence 5).

[0026] Wherein, the probe carries at least one fluorescent group; preferably, the fluorescent group can be at least one of FAM, THF, BHQ1 and C3-SPACER; in a preferred embodiment, the 29th T at the 5' end of the probe is connected to the fluorescent group FAM, the 31st C is connected to the fluorescent group THF, the 33rd T is connected to the fluorescent group BHQ1, and the A at the 3' end is connected to the fluorescent group C3-SPACER.

[0027] The nucleotide sequence of the primer is composed of any one of the following:

[0028] Primer Set 1:

[0029] F: 5′-CACCAAGAGCACCAACATCGAGGACCCGTA-3′ (SEQ ID NO: 1);

[0030] R: 5'-TGTTGTAGGCCGAGTAGGGCTGGTAGGGGA-3' (sequence 2);

[0031] Primer set 2:

[0032] F: 5'-CATCCCGAAGTTCCCCAACTGGTTCTACGT-3' (sequence 3);

[0033] R: 5'-TAGTAGTAGTAGGGGTAGATGGGGGCGGTC-3' (sequence 4).

[0034] The target band amplified by the primer set 1 is 312 bp in size, and its nucleotide sequence is shown as sequence 6 in the sequence list; the target band amplified by the primer set 2 is 454 bp in size, and its nucleotide sequence is shown as sequence 7 in the sequence list.

[0035] Sequence 6:

[0036] 5'-CACCAGAGCACCAACATCGAGGACCCGTACCTCACGATCCTCA TGTACATCTACCTGTTGGAAGTACATGAAGACCTGCGTGATTCTCCTGGCGATGGCCGCGGCCTGTGCGGCGTTTCCCCACCCGGGGCCCCCCGCGCCCCCTGGCCCCATGCCCCCGACGCCGCACGCCATGCCGC CCCCCGCGCCCCCGGGCCTTGGCACGGAGATGGGCAAGCAGGGCGCGACGTCGGACCTGAAGGGCGAGGAGGCCCTGTACCTGGCCAGCCCGTACTCGGCGCTCCCCTACCAGCCCTACTCGGCCTACAACA-3';

[0037] Sequence 7:

[0038] 5'-CATCCCGAAGTTCCCCAACTGGTTCTACGTGTACACCAAGAGCA CCAACATCGAGGACCCGTACCTCACGATCCTCATGTACATCTACCTGTTGGAAGTACATGAAGACCTGCGTGATTCTCCTGGCGATGGCCGCGGCCTGTGCGGCGTTTCCCCACCCGGGGCCCCCCGCGCCCCCTGGCCCCATGCCCCCGACGCCGCACGCCATGCCGCCCCCCGCGCCCCCGGGCCTTGGCACGGAGATGGGCAAG CAGGGCGCGACGTCGGACCTGAAGGGCGAGGAGGCCCTGTACCTGGCCAGCCCGTACTCGGCGCTCCCCTACCAGCCCTACTCGGCCTACAACATCCGCGCCCCGGGCTACGGGGCCATCGGCGGCCTCGGCGGCCTCGGCTACTCGTCGTACGGACTGCAGACCGCCCCCATCTACCCCTACTACTACTA-3'.

[0039] In a second aspect, the present invention provides a kit for rapid detection of chrysanthemum TSWV virus, the kit comprising the probe and primers described in the first aspect of the present invention.

[0040] The kit also includes freeze-dried microspheres and an activator.

[0041] The freeze-dried microspheres include: a buffer, an excipient, a reaction enzyme agent, and other agents.

[0042] The buffer comprises at least one of the following: tris(hydroxymethyl)aminomethane, sodium ions, potassium ions, chloride ions, acetate ions, and sulfate ions.

[0043] The excipients include at least one of the following: trehalose, raffinose, dextran, dextrin, polyethylene glycol, mannitol, glycerol, alanine, lysine, sodium glutamate, bovine serum albumin, casein, Triton X-100, Tween-80, ethylphenyl polyethylene glycol-40, dimethyl sulfoxide (DMSO), and N,N-dimethylformamide (DMF).

[0044] The reaction enzyme agent includes at least one of the following: Escherichia coli SSB protein, bacteriophage uvsX protein, bacteriophage uvsY protein, klenow polymerase large fragment, nuclease exonuclease, reverse transcriptase, creatine kinase, and 10U of RNAse inhibitor.

[0045] The other agents include: dNTP, and at least one of the following: dithiothreitol, creatine phosphate, imidazole, and adenosine triphosphate.

[0046] The activator is selected from one or more of the following: magnesium ion salt, nickel ion salt, manganese ion salt; preferably magnesium acetate.

[0047] The preparation method of the freeze-dried microspheres comprises the following steps:

[0048] Step 1: Prepare the above-mentioned buffer, excipients, reaction enzyme agent and other agents into microsphere stock solution.

[0049] As a preferred microsphere stock solution, the final concentration of each raw material is as follows:

[0050] Triscarboxymethyl alkane-acetic acid (pH 8.0) 10-50mM, preferably 30mM; potassium acetate 50-150mM, preferably 100mM; polyethylene glycol (molecular weight 20000) 1-10%, preferably 5%; ATP 1-3mM, preferably 2mM; creatine phosphate 10-30mM, preferably 20mM; imidazole 10-30, preferably 20mM; dNTP 0.1-1.0mM, preferably 0.45mM; trehalose 5-8%, preferably 6.5%; raffinose 1-3%, preferably 2%; glycerol 1-3%, preferably 2%;

[0051] Escherichia coli SSB protein 50-150ng / μL, preferably 100ng / μL; bacteriophage uvsX protein 100-200ng / μL, preferably 150ng / μL; bacteriophage uvsY protein 10-40ng / μL, preferably 25ng / μL; klenow polymerase large fragment (exo-) 50-130ng / μL, preferably 80ng / μL; nuclease III 10-100ng / μL, preferably 50ng / μL; reverse transcriptase 100-300U, preferably 200U; creatine kinase 50-150ng / μL, preferably 100ng / μL; RNase inhibitor 5-15U, preferably 10U.

[0052] The freeze-dried microspheres may also be commercially available products.

[0053] Step 2: dropping the microsphere stock solution into liquid nitrogen to obtain solidified microspheres;

[0054] Step 3: freeze-dry the solidified microspheres to obtain freeze-dried microspheres. The freeze-drying process can be: -45°C, 0 Pa, 1 hour; -40°C, 1 Pa, 6 hours; -30°C, 1 Pa, 20 minutes; -20°C, 1 Pa, 20 minutes; -10°C, 1 Pa, 20 minutes; 0°C, 1 Pa, 1.5 hours; 10°C, 1 Pa, 30 minutes; 20°C, 1 Pa, 30 minutes; 25°C, 1 Pa, 1 hour.

[0055] The third aspect of the present invention provides a method for rapid detection of chrysanthemum TSWV virus, which comprises the use of the probe and primers provided by the first aspect of the present invention, or the kit provided by the second aspect of the present invention.

[0056] According to the third aspect of the present invention, the method for rapid detection of chrysanthemum TSWV virus comprises the following steps:

[0057] 1. Prepare a reaction premix solution, wherein the final concentration of each component in the premix solution is as follows:

[0058] Forward primer (F): 0.25-0.65 μM, preferably 0.44 μM;

[0059] Reverse primer (R): 0.25-0.65 μM, preferably 0.44 μM;

[0060] Fluorescent probe: 0.1-0.15 μM, preferably 0.125 μM;

[0061] Template RNA: 10-600 μg / mL, preferably 20.83-416.67 μg / mL;

[0062] ddH2O: balance.

[0063] 2. Mix the premix with the freeze-dried microspheres and then with the activator to obtain a reaction mixture, wherein the volume of the freeze-dried microspheres is the same as that of the template RNA; and the final concentration of the activator in the reaction mixture is 10-20 mM, preferably 14 mM.

[0064] 3. The reaction mixture is subjected to constant temperature amplification at a temperature of 40-45°C, preferably 45°C; the time is 10-30 minutes, preferably 20 minutes (the use time is determined according to the actual situation); and the presence of chrysanthemum TSWV virus is determined based on the fluorescent signal generated by the amplification reaction. For example, if a fluorescent signal can be generated at the excitation wavelength of the fluorescent group used, it can be determined that the chrysanthemum TSWV virus is contained. Specifically, for example, when the FAM fluorescent group is used, if a fluorescent signal is collected at an excitation wavelength of 520nm, it is determined that the chrysanthemum TSWV virus is contained; if no fluorescent signal is collected, it is determined that the chrysanthemum TSWV virus is not contained.

[0065] 4. After the above isothermal amplification reaction is completed, save the data.

[0066] The various reagents, materials, etc. used in the following examples, unless otherwise specified, are all products that can be obtained from commercial channels; the various tests and detection methods used in the following examples, unless otherwise specified, are all conventional tests and detection methods in the art and can be obtained from textbooks, reference books or academic journals.

[0067] The experimental materials of the following examples are as follows: In June 2024, unknown chrysanthemums suspected of containing chrysanthemum virus disease were collected from three places in Beijing as samples, and 10 samples were collected in a scattered manner from each plot (such as Figure 1 Each sample was simultaneously subjected to the handheld fluorescent probe gene mirror open field detection of Example 1, the TSWV virus single RT-PCR detection of Detection Example 2, and the ELISA detection of Detection Example 3.

[0068] Example 1

[0069] This example is used to illustrate the preparation and method for rapid detection of chrysanthemum TSWV virus provided by the present invention.

[0070] Main instruments: Constant temperature nucleic acid amplification instrument, purchased from Suzhou Xianda Gene Technology Co., Ltd. Handheld solar mobile power supply, 20000mAh, purchased from Shantou Junai Charge Electronics Co., Ltd.

[0071] 1. Design and synthesis of fluorescent probe primers and probes for detecting chrysanthemum TSWV virus

[0072] (I) Design and synthesis of fluorescent probe primers

[0073] The gene sequence of chrysanthemum TSWV virus was downloaded from the NCBI database (NCBI gene accession number is XM_026416013.2), and the fluorescent probe specific primers (i.e., fluorescent probe primers) were designed using the Primer5 online tool. The fluorescent probe specific primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The primer sequences, product sizes, and annealing temperatures of TSWV virus are shown in Table 1.

[0074] 1. Primer design: In the nucleotide region of chrysanthemum TSWV virus (between two primers, and avoid overlapping regions with primers), find the base sequence with the maximum allowed single nucleotide repeat length (such as "CCCC") of 4. The "PCR Product Size" is generally identified as 100-300, and all primer sequences are selected from high to low according to the synthesis rate;

[0075] 2. Primer selection: From the designed primer table, "Dimer" and "CrossDimer" appear in the corresponding left table, indicating that this primer is not ideal. The best situation is that "Hairpin", "Dimer", "False Priming" and "Cross Dimer" do not appear, that is, the maximum allowable single nucleotide repeat length (such as "CCCC") is 4 base sequences selected at a synthesis rate of 100, avoiding the repetitive sequences in a specific genome to ensure the uniqueness of the target; that is, it is synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0076] Table 1: Fluorescent probe specific primers required for the detection of chrysanthemum TSWV virus and viroid

[0077]

[0078] (II) Design and synthesis of probes

[0079] Based on the ideal upstream and downstream primers of the chrysanthemum TSWV virus fluorescent probe screened above, the fluorescent probe was designed using the CRISPOR online tool and synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0080] The probe sequence is: 5'-ATCTACCTGTTGGAAGTACATGAAGACCTGCGTGAT TCTCCTGGCGA-3'; the 29th T at the 5' end of the probe is connected to the fluorescent group FAM, the 31st C is connected to the fluorescent group THF, the 33rd T is connected to the fluorescent group BHQ1, and the A at the 3' end is connected to the fluorescent group C3-SPACER; among them, FAM is a fluorescent emission group, BHQ is a fluorescent quenching group, and the other two groups are markers.

[0081] 2. A method for detecting chrysanthemum TSWV virus in the open field using a handheld fluorescent probe gene microscope includes the following steps.

[0082] (I) The method for preparing the template RNA is as follows:

[0083] Sample pretreatment: At room temperature, take 50-100 mg of the fresh chrysanthemum leaves collected above and wear disposable plastic gloves and squeeze them with the thumb and index finger until the tissue fluid overflows, or squeeze an appropriate amount of fresh chrysanthemum leaves and squeeze 2-3 drops of leaf juice into a 1.5mL or 2mL centrifuge tube for later use.

[0084] Sample lysis: At room temperature, add 500-1000 μL of lysis reagent to the sample centrifuge tube to lyse RNA, blow it repeatedly with a pipette and let it stand for 3-5 minutes for use to obtain template RNA (concentration is 500-2000 μg / mL). The sample volume should not exceed 10% of the volume of the lysis solution added. The lysis solution includes: Tris-HCl 50mM, sodium chloride 20mM, Tween-100 2%.

[0085] (II) Preparation of premix:

[0086] Add the following reagents respectively into the probe-type centrifuge tube to form a premix for each sample to be tested.

[0087] Prepare a master mix for each sample in a total volume of 48 μL as follows:

[0088] Forward primer (10μM): 2.1μL; reverse primer (10μM): 2.1μL; fluorescent probe (10μM): 0.6μL; template RNA: 2μL≤x≤10μL; ddH2O: make up to 48μL.

[0089] Vortex the prepared premix thoroughly and centrifuge briefly.

[0090] Add microspheres: For each sample, transfer the above 48 μL premix to a centrifuge tube dedicated to the constant temperature amplification instrument and add lyophilized microspheres with the same volume as the template RNA, which is 2 to 10 μL; then use the thumb and the thumb or middle finger to repeatedly tap the bottom of the centrifuge tube for 3 to 5 seconds to mix.

[0091] The freeze-dried microspheres were prepared by the following steps:

[0092] 1. Prepare the microsphere stock solution. The final concentration of each raw material in the microsphere stock solution is as follows:

[0093] Tris(carboxymethyl)-acetic acid (pH 8.0) 30 mM, potassium acetate 100 mM, polyethylene glycol (molecular weight 20000) 5%, ATP 2 mM, creatine phosphate 20 mM, imidazole 20 mM, dNTP 0.45 mM, trehalose 6.5%, raffinose 2%, glycerol 2%; Escherichia coli SSB protein 100 ng / μL, bacteriophage uvsX protein 150 ng / μL, bacteriophage uvsY protein 25 ng / μL, klenow polymerase large fragment (exo-) 80 ng / μL, exonuclease III 50 ng / μL, reverse transcriptase 200 U, creatine kinase 100 ng / μL, RNase inhibitor 10 U; all the above raw materials are configured into microsphere stock solution with ddH2O.

[0094] 2. Take the mixed solution according to the amount of a single reaction system, drop it into a thermos cup filled with liquid nitrogen in a volume of 50 μL (or the amount required for a single isothermal amplification reaction). The droplets will quickly solidify into small balls in the liquid nitrogen;

[0095] 3. Collect the solidified beads and put them into the pre-cooled freeze dryer (Xinzhi PI8070) Model: freeze-drying, freeze-drying conditions and procedures are: minus 45℃, 0 Pa, 1 hour; minus 40℃, 1 Pa, 6 hours; minus 30℃, 1 Pa, 20 minutes; minus 20℃, 1 Pa, 20 minutes; minus 10℃, 1 Pa, 20 minutes; 0℃, 1 Pa, 1.5 hours; 10℃, 1 Pa, 30 minutes; 20℃, 1 Pa, 30 minutes; 25℃, 1 Pa, 1 hour. After the freeze-drying is completed, package in a nitrogen environment to obtain freeze-dried microspheres. 3. Add activator: For each sample, add 2μL of activator magnesium acetate to the reaction tube cap (the final concentration of the activator in the reaction system of each centrifuge tube is 14mM), carefully cover the tube cap, and use the thumb combined with the thumb or middle finger to repeatedly tap the bottom of the centrifuge tube for 3 to 5 seconds to mix.

[0096] 4. Constant temperature detection: Place the reaction tube in a 45℃ constant temperature instrument to start the detection. Use a handheld fluorescent probe mirror to collect fluorescence signals at an excitation wavelength of 520nm. If the instrument displays "+" for positive, it is judged to contain chrysanthemum TSWV virus; if no fluorescence signal is collected, the instrument displays "-" for negative, it is judged to not contain chrysanthemum TSWV virus.

[0097] 5. After the reaction is completed, save the data and discard the sample tube.

[0098] (III) Test results

[0099] The above three groups of samples of the same species and the same place were tested for chrysanthemum TSWV virus by fluorescent probe microsphere thermostatic amplification instrument, and the results are as follows. The results show that when each group of chrysanthemum samples was tested using primer set 1 and primer set 2, the test results of each chrysanthemum sample in each group of 10 chrysanthemum samples using each of the two primer sets were consistent (for example: the result of one chrysanthemum sample in the first group of chrysanthemum samples using primer set 1 was positive (+), and the result of using primer set 2 was also positive (+)).

[0100] Table 2: Test results

[0101]

[0102]

[0103] Test Example 1

[0104] This detection example is a specificity test and sensitivity test of the chrysanthemum TSWV virus rapid detection method of Example 1.

[0105] Total RNA from chrysanthemum leaves was extracted according to the instructions of Vazyme's RNA extraction kit, and then cDNA from chrysanthemum leaves was obtained according to the instructions of the reverse transcription kit.

[0106] 1. Specificity detection

[0107] S1. Preparation of primers: Centrifuge the newly synthesized centrifuge tubes containing the above two sets of primer powders at 4000rpm for 30-60s; slowly open the lid, and according to the primer instructions, add 52.1μL of sterile water to each tube of primers to prepare a 100μM storage solution, shake well to mix, and store at -20℃.

[0108] Primer dosage of S2 and TSWV (100 μM): The three primer sets were set to three concentration gradients of 0.2 μL, 0.5 μL, and 0.8 μL, respectively. The template cDNA dosage was 1 μL, and the annealing temperature was 55.3°C.

[0109] Add the following components to a 0.2 mL centrifuge tube: upstream primer (100 μM): 0.2 μL / 0.5 μL / 0.8 μL; downstream primer (100 μM): 0.2 μL / 0.5 μL / 0.8 μL; 2×Taq plus master mix: 10 μL; cDNA: 1 μL; sterile deionized water: make up to 20 μL.

[0110] S3. Mix gently, centrifuge slightly, remove bubbles, and place in a PCR instrument. The reaction procedure is as follows: pre-denaturation at 94°C for 4 min; denaturation at 94°C for 30 s, low-temperature annealing (the annealing temperature of primer sets 1 to 3 is 55.3°C) for 30 s, extension at 72°C for 1 min, and perform 35 cycles; further extension at 72°C for 10 min; and storage at 12°C.

[0111] S4. After the PCR reaction was completed, 2 μL of PCR product was taken for 2% agarose gel electrophoresis detection and photographed using a UV gel imaging system. It can be seen that both sets of primers can amplify target bands with fragment sizes of 312 bp and 454 bp, and the specificity and sensitivity of the above two sets of primers are good.

[0112] like Figure 2 , the 1st and 21st columns from the left in the upper part are all 500 markers (500, 400, 300, 200, 150, 100, 50 from top to bottom), and the 2nd column from the left is the negative control (water). The primer dosage of columns 3-8 from the left is 0.2μL; among them, columns 3-5 are the amplified bands of primer set 2, which are displayed relatively clearly; columns 6-8 are the amplified bands of primer set 1, which are displayed clearly. The primer dosage of columns 9-14 from the left is 0.5μL; among them, columns 9-11 are the amplified bands of primer set 2, which are displayed clearly; columns 12-14 are the amplified bands of primer set 1, which are displayed clearly. Columns 15-17 from the left are the amplified bands of primer set 2 when the primer dosage is 0.8μL, which are displayed clearly. Columns 18-20 are the amplified bands of primer set 1 when the primer dosage is 0.8μL, which are displayed clearly. It can be seen that the two sets of primers shown in Table 1 have good specificity.

[0113] The target bands were recovered by gel excision, ligated with pGEM-T Easy vector, transformed into E. coli DH5α competent cells, screened by blue-white spots and identified by bacterial liquid PCR, and the positive clones were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The sequencing results were analyzed by NCBI's Blast, and the results were correct, indicating that primers 1-3 had good specificity.

[0114] 2. Sensitivity test

[0115] The RNA of the sample with positive test result in Example 1 was diluted 10 0 , 10 1 , 10 2 , 10 3 , 10 4 Use 50 μL of dHO as template RNA to prepare the premix: forward primer of primer 1 (10 μM): 2.1 μL; reverse primer of primer 1 (10 μM): 2.1 μL; template RNA: 5 μL; ddH2O: make up to 48 μL.

[0116] Referring to the method of Example 1, freeze-dried microspheres and activators were added to the reaction system of each reaction tube, and then the reaction tube was placed in a thermostat for constant temperature detection.

[0117] After the test, 5 μL of the amplified product was taken for electrophoresis using DL500 marker and 2% agarose gel, and observed and photographed using a UV gel imaging system. The results showed that 10 0～ 10 2 It can still be detected after dilution, 10 times of RNA stock solution 3～ 10 4 The end of the dilution was 10 times (undetectable), indicating that the ERA detection technology used in Example 1 has high sensitivity. Figure 3 In the figure, from left to right, the first column is the 500DL marker (from top to bottom, they are 500, 400, 300, 200, 150, 100, 50), the second column is the H2O control, and the third to seventh columns are the 10 diluted TSWV RNA. 0 , 10 1 , 10 2 , 10 3 , 10 4 The last column is the 500DL marker.

[0118] Test Example 2

[0119] This detection example is used to illustrate the method of detecting chrysanthemum TSWV virus using a single RT-PCR method in the prior art.

[0120] Main reagents: RNA extraction kit ( Universal Plant Total RNA Isolation Kit, Vazyme); Reverse transcription cDNA kit (Reverse transcription system, Promega); DNA product purification kit ( SV grl and PCR clean-up system, Promega); TwistAmp Basic kit (Twistamp basic kit, Shanghai Murray Biotechnology Co., Ltd.); 2×Taq Plus Master Mix (Novozyme); T4 DNA ligase kit (Promega); DL500DNA Marker (Takara); DL2000 DNA Marker (Takara); Ampicillin (Ampicillin, Amp) was purchased from Solarbio; Escherichia coli competent cells DH5α were purchased from Tiangen Biochemical Technology Co., Ltd.

[0121] The detection method of this detection example is as follows:

[0122] 1. Primer design and synthesis

[0123] The gene sequence of chrysanthemum TSWV virus was downloaded from the NCBI database, and the sequence was aligned using Clustal X software. The relatively conservative region of the gene was selected and specific primers were designed using Primer Premier 5.0 software. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The primer sequences, product sizes and annealing temperatures of TSWV virus are shown in Table 3.

[0124] Table 3: Specific primers required for the detection of chrysanthemum TSWV virus and viroids

[0125]

[0126] 2. RT-PCR amplification

[0127] Centrifuge the newly synthesized centrifuge tube containing dry powder primers at 4000 rpm for 30-60 seconds; slowly open the lid, add an appropriate amount of sterile ddH2O to adjust the concentration to 10 μmol / L; shake thoroughly to mix.

[0128] The reaction system is as follows: add the following components into a 0.2 mL centrifuge tube: upstream primer (10 μmol / L): 1 μL; downstream primer (10 μmol / L): 1 μL; 2×Taq plus master mix: 10 μL; cDNA: 1 μL; sterile deionized water: 7 μL; total volume: 20 μL.

[0129] Mix gently, centrifuge slightly, remove bubbles, place in PCR instrument, and the reaction program is as follows: 94℃ pre-denaturation: 4min; 94℃ denaturation: 30s; annealing (temperature see Table 3): low temperature annealing for 30s; 72℃ extension: 1min; 72℃ re-extension: 10min; 12℃ storage. Set the denaturation to extension steps to 35 cycles.

[0130] After the PCR reaction was completed, 2 μL of the PCR product was taken for 2% agarose gel electrophoresis detection and photographed using a UV gel imaging system. Figure 4 The results showed that A5, A6, A9, B7, B8, C1, C5, C6, C9, and C10 were positive, indicating that they were suspected of carrying the chrysanthemum TSWV virus.

[0131] 3. Recycling, connection and transformation

[0132] (1) Recovery and purification of PCR fragments

[0133] The target fragment was recovered according to the instructions of the DNA product purification kit of Promega, and the recovered target fragment was connected to the pGEM-T Easy vector, and then transformed into the competent E. coli cell DH5α, cloned by the blue-white screening method, and the positive strains were detected by PCR in the bacterial liquid and sent to Sangon Biotechnology (Shanghai) Co., Ltd. for sequencing, and the sequencing results were analyzed for homology by NCBIBlast software. The analysis showed that the results of whether the sample contained TSWV virus were the same as those in Example 1.

[0134] Test Example 3

[0135] This detection example is used to illustrate the method of detecting chrysanthemum TSWV virus using double antigen one-step sandwich enzyme-linked immunosorbent assay (ELISA) in the prior art.

[0136] Detection principle: This kit uses a double-antigen one-step sandwich enzyme-linked immunosorbent assay (ELISA). The specimen and HRP-labeled detection antigen are added to the coated microwells pre-coated with tomato spotted wilt virus antibodies, incubated and thoroughly washed. The substrate TMB is used for color development. TMB is converted into blue under the catalysis of peroxidase and into the final yellow under the action of acid. The absorbance (OD value) is measured at a wavelength of 450nm using an enzyme reader and compared with the CUTOFF value to determine the presence or absence of tomato spotted wilt virus (TSWV) in the specimen.

[0137] Sample collection, processing and storage methods:

[0138] (1) Cell supernatant: Centrifuge at 3000 rpm for 10 min to remove particles and aggregates.

[0139] (2) Tissue homogenization: Add an appropriate amount of physiological saline to the tissue and mash it. Centrifuge at 3000 rpm for 10 minutes and collect the supernatant.

[0140] (3) Storage: If the sample is not tested immediately after collection, please divide it into aliquots according to the amount for single use and freeze it at -20°C to avoid repeated freezing and thawing. Thaw it at room temperature and ensure that the sample is evenly and fully thawed.

[0141] ELISA test method steps:

[0142] (1) After equilibration at room temperature for 20 min, take out the required strips from the aluminum foil bag and seal the remaining strips in a ziplock bag and place them back at 4°C.

[0143] (2) Set up negative and positive control wells and sample wells, and add 50uL of negative control and positive control to each of the negative and positive control wells;

[0144] (3) First add 10 μL of the sample to be tested to the sample well, and then add 40 μL of sample diluent;

[0145] (4) Then, add 100 μL of horseradish peroxidase (HRP)-labeled detection antigen to each of the negative and positive control wells and sample wells, seal the reaction wells with a sealing film, and incubate at 37°C in a water bath or incubator for 60 min.

[0146] (5) Discard the liquid, pat dry on absorbent paper, fill each well with washing solution, let it stand for 1 min, shake off the washing solution, pat dry on absorbent paper, and repeat this process 5 times (you can also use a plate washer to wash the plate).

[0147] (6) Add 50 μL of substrate A and B to each well and incubate at 37°C in the dark for 15 min.

[0148] (7) Add 50 μL of stop solution to each well and measure the OD value of each well at a wavelength of 450 nm within 15 min.

[0149] Calculation and result judgment:

[0150] (1) Test validity: The average OD value of the positive control wells is ≥1.00, and the average OD value of the negative control wells is ≤0.15.

[0151] (2) Calculation of cutoff value: cutoff value = average value of negative control wells + 0.15.

[0152] (3) Negative judgment: If the sample OD value is less than the critical value (Cutoff), the sample is negative.

[0153] (4) Positive judgment: If the sample OD value > the cutoff value, the sample is positive.

[0154] Kit performance:

[0155] 1. Accuracy: The average OD value of the positive control wells is ≥1.00; the average OD value of the negative control wells is <0.15, indicating that the test results are valid.

[0156] In this test case, the results of ELISA TSWV virus detection on 30 chrysanthemum samples are as follows:

[0157] Table 4: First test results

[0158]

[0159] Table 5: Second test results

[0160]

[0161] Table 6: Results of the third test

[0162]

[0163]

[0164] The results showed that in the three tests, the test results of each chrysanthemum sample were consistent, achieving the expected test purpose.

[0165] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. Probe and primer set for rapid detection of chrysanthemum TSWV virus, Features: The nucleotide sequence of the probe is shown in Sequence 5 of the sequence listing; The primer set is selected from at least one of primer set 1 and primer 2; The upstream primer of the primer set 1 is shown as Sequence 1 in the sequence listing, and the downstream primer is shown as Sequence 2 in the sequence listing; the upstream primer of the primer set 2 is shown as Sequence 3 in the sequence listing, and the downstream primer is shown as Sequence 4 in the sequence listing.

2. The probe and primer set for rapid detection of chrysanthemum TSWV virus according to claim 1, Features: The probe carries at least one fluorescent group; Preferably, the fluorescent group is at least one of FAM, THF, BHQ1 and C3-SPACER; More preferably, the 29th T at the 5' end of the probe is connected to a fluorescent group FAM, the 31st C is connected to a fluorescent group THF, the 33rd position is connected to a fluorescent group BHQ1, and the G at the 3' end is connected to a fluorescent group C3-SPACER.

3. Rapid detection kit for chrysanthemum TSWV virus, Features: The kit comprises the probe and primer set according to claim 1 or 2.

4. The rapid detection kit for chrysanthemum TSWV virus according to claim 3, Features: The kit also includes freeze-dried microspheres and an activator.

5. The rapid detection kit for chrysanthemum TSWV virus according to claim 4, Features: The freeze-dried microspheres include: a buffer, an excipient, a reaction enzyme agent, and other agents; The activator is selected from one or more of the following: magnesium ion salt, nickel ion salt, manganese ion salt; Preferably, the activator is magnesium acetate.

6. The rapid detection kit for chrysanthemum TSWV virus according to claim 5, Features: The buffer comprises at least one of the following: tris(hydroxymethyl)aminomethane, sodium ions, potassium ions, chloride ions, acetate ions, and sulfate ions; The excipients include at least one of the following: trehalose, raffinose, dextran, dextrin, polyethylene glycol, mannitol, glycerol, alanine, lysine, sodium glutamate, bovine serum albumin, casein, Triton X-100, Tween-80, ethylphenyl polyethylene glycol-40, dimethyl sulfoxide, N,N-dimethylformamide; The reaction enzyme agent includes at least one of the following: Escherichia coli SSB protein, bacteriophage uvsX protein, bacteriophage uvsY protein, klenow polymerase large fragment, nuclease exonuclease, reverse transcriptase, creatine kinase, 10U of RNAse inhibitor; The other agents include: dNTP, and at least one of the following: dithiothreitol, creatine phosphate, imidazole, and adenosine triphosphate.

7. The rapid detection kit for chrysanthemum TSWV virus according to claim 5, Features: The preparation method of the freeze-dried microspheres comprises the following steps: S1: preparing the buffer, excipient, reaction enzyme agent and other agents into a microsphere stock solution; S2: dropping the microsphere stock solution into liquid nitrogen to obtain solidified microspheres; S3: freeze-drying the solidified beads to obtain freeze-dried microspheres.

8. A rapid detection method for chrysanthemum TSWV virus, Features: The method adopts the probe and primer set described in claim 1 or 2, or the kit described in any one of claims 3-7.

9. The method for rapid detection of chrysanthemum TSWV virus according to claim 8, Features: The detection method comprises the following steps: S1: prepare reaction premix; S2: mixing the premixed solution with the freeze-dried microspheres, and then mixing with the activator to obtain a reaction mixture; S3: subjecting the reaction mixture to a constant temperature amplification reaction; S4: Collecting fluorescent signals to determine whether chrysanthemum TSWV virus is present; Preferably, the reaction premix comprises: Forward primer: the final concentration in the reaction premix is ​​0.25-0.65 μM, preferably 0.44 μM; Reverse primer: the final concentration in the reaction premix is ​​0.25-0.65 μM, preferably 0.44 μM; Fluorescent probe: the final concentration in the reaction premix is ​​0.1-0.15 μM, preferably 0.125 μM; Template RNA: the final concentration in the reaction premix is ​​10-600 μg / mL, preferably 20.83-416.67 μg / mL; Preferably, the amount of the lyophilized microspheres is: the same volume as the template RNA; Preferably, the final concentration of the activator in the reaction mixture is 10-20 mM, preferably 14 mM; Preferably, in the isothermal amplification reaction, the temperature is 40-45°C, preferably 45°C; the time is 10-30 minutes, preferably 20 minutes.

10. Use of the probe and primer set of claim 1 or 2, the kit of any one of claims 3 to 7, or the detection method of claim 8 or 9 in rapid detection of chrysanthemum TSWV virus.

Images