Pentavalent phosphorylcholine ligand as well as preparation method and application thereof

Abstract

The invention belongs to the technical field of biological materials, and particularly relates to a pentavalent phosphorylcholine ligand as well as a preparation method and application thereof. The pentavalent phosphorylcholine ligand comprises a central chain which is annular; the complementary chain and the central chain are assembled to form a DNA skeleton in which single chains and double chains are alternately arranged, and the secondary structure of the DNA skeleton is a regular pentagon; the double chains are rigid double chains, and the connecting part between the rigid double chains is a flexible short chain; the tail end of the complementary chain comprises a phosphorylcholine ligand and a small molecule part, and the phosphorylcholine ligand is connected with the DNA skeleton through the small molecule part. The invention also provides a preparation method of the pentavalent phosphorylcholine ligand. The pentavalent phosphorylcholine ligand is formed by assembling single-stranded nucleic acids with nucleotide sequences as shown in SEQ ID No.1 and SEQ ID No.2. The invention also provides a preparation method of the pentavalent phosphorylcholine ligand. The invention solves the problem of weak binding capacity of monovalent phosphorylcholine and C-reactive protein, and can be applied to detection of C-reactive protein in clinical samples related to infection, inflammation and cardiovascular diseases.

Description

Technical Field

[0001] The invention belongs to the technical field of biomaterials, and in particular relates to a pentavalent phosphorylcholine ligand and a preparation method and application thereof. Background Art

[0002] In the biomedical field, C-reactive protein (CRP) is a key acute phase responder protein, and its level changes are widely used as an important indicator for evaluating inflammation, infection and cardiovascular disease in the body. In recent years, with the in-depth study of the relationship between the structure and function of C-reactive protein, it has been found that the five phosphorylcholine ligand (PC) binding sites on C-reactive protein are crucial for its biological activity and interaction with ligands. However, the traditional phosphorylcholine ligand has a weak binding ability with C-reactive protein, which limits its potential in diagnostic and therapeutic applications.

[0003] To solve this problem, researchers have adopted the design ideas of low-cost ligands or flexible skeletons, but these designs cannot meet the precise requirements of spatial orientation and distance during the binding process, resulting in unnecessary entropy loss or unfavorable enthalpy change when forming CRP-ligand complexes, thereby reducing the overall binding ability. Summary of the invention

[0004] In view of this, the purpose of the present invention is to provide a pentavalent phosphorylcholine ligand and its preparation method and application, so as to solve the problem of weak binding ability of monovalent phosphorylcholine with C-reactive protein, and to design a pentavalent phosphorylcholine ligand based on the crystal structure of the C-reactive protein-phosphocholine complex to optimize the entropy change and enthalpy change in the binding process, thereby improving the binding ability of the two.

[0005] In order to achieve the above object, the technical solution adopted by the present invention is as follows:

[0006] A pentavalent phosphorylcholine ligand comprising:

[0007] A central chain, wherein the central chain is ring-shaped;

[0008] A complementary chain, wherein the complementary chain is assembled with the central chain to form a DNA backbone in which single-stranded and double-stranded chains are alternately arranged, and the secondary structure of the DNA backbone is a regular pentagon;

[0009] The double strand is a rigid double strand, and the rigid double strand tail is a tail of 1 to 3 bases;

[0010] The complementary chain end includes a phosphorylcholine ligand and a small molecule connecting part, and the phosphorylcholine ligand is connected to the DNA backbone through the small molecule connecting part.

[0011] According to the above technical means, DNA nanotechnology is used to design a rigid DNA skeleton, and the rigid pentavalent phosphorylcholine ligand is connected through the rigid DNA skeleton to simultaneously target 5 binding sites, thereby improving the affinity and significantly improving the binding ability of phosphorylcholine to C-reactive protein. This effectively solves the problem of weak binding ability of monovalent phosphorylcholine to C-reactive protein.

[0012] The central strand is a circular single-stranded nucleic acid, and the 5' end or 3' end of the complementary strand is modified with a phosphorylcholine ligand (PC).

[0013] In the regular pentagonal pentavalent phosphorylcholine ligand, at the connection between the rigid double chains, the two unpaired tail short chains of the complementary chain use the same base type to maintain a certain repulsive force, so that they face the two sides of the pentavalent phosphorylcholine ligand respectively. Among them, one side of the modified phosphorylcholine ligand faces the receptor (target) as the binding surface; the other side faces the receptor (target) as the reporting surface, which can be modified with signal groups, such as FAM, DNAzyme, which can indicate the number of bound receptors (targets).

[0014] Preferably, the pentavalent phosphorylcholine ligand is assembled from at least 6 single-stranded nucleic acids.

[0015] Preferably, the side length of the regular pentagon is 4.4 nm.

[0016] Preferably, there is one central chain.

[0017] Preferably, the complementary strand is the same strand repeated five times, or is 2 to 5 different strands.

[0018] Preferably, the rigid double strand consists of 12 to 14 identical base pairs.

[0019] Preferably, the flexible short chain portion of the central chain consists of the same sequence of 1 to 2 bases.

[0020] Preferably, the tail consists of 1 to 3 bases.

[0021] Preferably, the free bases in the tail are 1 to 3 identical bases.

[0022] Among them, in the phosphorylcholine ligand, the bases A and T / U account for 40-60%, and the bases C and G account for 40-60%. In particular, it should be noted that the content of bases C and G should not be too high, otherwise G-quadruplex or i-motif may be formed.

[0023] Preferably, in the nucleic acid phosphorylcholine ligand, bases A and T / U account for about 50%, and bases C and G account for about 50%.

[0024] Preferably, the phosphorylcholine ligand (PC) is a phosphorylcholine ligand (PC) for the phosphorylcholine binding site on C-reactive protein (CRP).

[0025] The present invention also provides a method for preparing a pentavalent phosphorylcholine ligand, wherein the pentavalent phosphorylcholine ligand is assembled from a single-stranded nucleic acid having a nucleotide sequence as shown in SEQ ID No. 1-2.

[0026] SEQ ID No.1 Single-stranded nucleic acid: (N2N1 13 )5, length 70nt;

[0027] SEQ ID No.2 Single-stranded nucleic acid: PC-N2N1' 13 N2, 15 nt in length;

[0028] N1 is any base among A, T, C, G; N2 is all base A or all base T; N1' 13 With N1 13 Complementary pairing.

[0029] Preferably, the 5' end or 3' end of the single-stranded nucleic acid shown in SEQ ID No. 2 is coupled with a phosphorylcholine ligand.

[0030] Among them, the SEQ ID No.1 used is assembled by the single-stranded nucleic acids shown in SEQ ID No.3-4 at a molar ratio of 1:5-6, and cyclized under the catalysis of T4 DNA ligase; the SEQ ID No.2 used is synthesized by SEQ ID No.5 and 3-butynyl (2-(trimethylammonium)ethyl) phosphate by copper-catalyzed azide-alkyne Husigen cycloaddition reaction (CuAAC).

[0031] SEQ ID No.3 Phosphorylated single-stranded nucleic acid: p-N2N1 13 N2N1 13 N2N1 13 N2N1 13 N2N1 13 , length is 70nt;

[0032] SEQ ID No.4 Single-stranded nucleic acid: N3 12 , length is 12nt;

[0033] SEQ ID No.5 Single-stranded nucleic acid: Azide (N3)-N13N2N1' 13 N2, 15 nt in length;

[0034] N1 is any base among A, T, C, G; N2 is all base A or all base T; N1' 13 With N113 Complementary pairing, N3 12 It is complementary to the 6 bases at the 5' end and the 6 bases at the 3' end of SEQ ID No.3.

[0035] Preferably, in the method for preparing a pentavalent phosphorylcholine ligand, the pentavalent phosphorylcholine ligand is assembled from single-stranded nucleic acids having nucleotide sequences such as those shown in SEQ ID No.6 and SEQ ID No.7.

[0036] Among them, SEQ ID No.6 single-stranded nucleic acid: (attcgctccctacc)5;

[0037] SEQ ID No.7 Single-stranded nucleic acid: Phosphocholine (PC)-aggtagggagcgaaa.

[0038] Preferably, a phosphorylcholine ligand (PC) is coupled to the 5' end or the 3' end of the single-stranded nucleic acid shown in SEQ ID No. 7.

[0039] When coupling the phosphorylcholine ligand, the coupling site can be adjusted as needed, and can be at the 5' end or the 3' end of the complementary chain. The phosphorylcholine ligand must be modified at the same end of the complementary chain.

[0040] Preferably, the single-stranded nucleic acid shown in SEQ ID No.6 is assembled through nucleotide sequences such as single-stranded nucleic acids shown in SEQ ID No.8 and SEQ ID No.9, and is cyclized and synthesized under the catalysis of T4 DNA ligase, and the molar ratio of the single-stranded nucleic acid shown in SEQ ID No.8 to the single-stranded nucleic acid shown in SEQ ID No.9 is 1:6.

[0041] Preferably, the single-stranded nucleic acid shown in SEQ ID No.7 is synthesized by reacting a single-stranded nucleic acid with a nucleotide sequence such as that shown in SEQ ID No.10 with 3-butynyl (2-(trimethylammonium)ethyl) phosphate by copper-catalyzed azide-alkyne Husigen cycloaddition reaction (CuAAC).

[0042] Among them, SEQ ID No.8 phosphorylated single-stranded nucleic acid:

[0043] p-attcgctccctaccattcgctccctaccattcgctccctaccattcgctccctaccattcgctccctacc;

[0044] SEQ ID No.9 single-stranded nucleic acid: gcgaatggtagg;

[0045] SEQ ID No.10 Single-stranded nucleic acid: Azide(N3)-aggtagggagcgaaa.

[0046] Preferably, the buffer used for assembling the pentavalent phosphorylcholine ligand of C-reactive protein (CRP) is Tris-HCl + 2mM Ca 2+ , the buffer Tris-HCl + 2mM Ca 2+ The formula is: 50 mM Tris, 150 mM NaCl, 1.5 mM MgCl, 2 mM CaCl, pH 7.4.

[0047] Preferably, the molar ratio of the single-stranded nucleic acid shown in SEQ ID No.6 to the single-stranded nucleic acid shown in SEQ ID No.7 is 1:5.

[0048] Preferably, the reaction procedure for assembling the pentavalent phosphorylcholine ligand of C-reactive protein (CRP) is: 95°C for 5 min, 65°C for 30 min, 50°C for 30 min, 37°C for 30 min, 25°C for 30 min, and 4°C for 2 h.

[0049] Preferably, the method for preparing the pentavalent phosphorylcholine ligand comprises the following steps:

[0050] (a) Find the crystal structure of the complex of phosphorylcholine ligand and target protein, and determine the spatial position, orientation and distance between the binding sites of C-reactive protein (CRP) and phosphorylcholine ligand (PC) in the crystal structure;

[0051] (b) designing a suitable regular pentagonal rigid DNA backbone so that the side length of the backbone is equal to the distance between the binding sites on the target protein;

[0052] (c) determining the sequence length and base types of the central strand and complementary strand, and connecting phosphorylcholine ligands (PC) to the ends of the complementary strands so that each ligand is evenly distributed at the vertices of the DNA backbone;

[0053] (d) Retention by connecting the backbone and ligands with a carbon-carbon single chain The flexibility range of the ligand is such that the ligand can rotate to a suitable configuration through a single bond within the flexibility range; the maximum flexibility range does not exceed Otherwise, the rigid skeleton affinity will decrease rapidly;

[0054] (e) The rigid double chain of the central chain and the complementary chain is used as the backbone component, and the flexible short chain of the central chain is used as the backbone corner; the two unpaired tails of the complementary chain repel each other and point to the two sides of the DNA backbone, thus obtaining the design unit of the multivalent phosphorylcholine ligand, i.e., the pentavalent phosphorylcholine ligand. Part of the carbon chain is retained between the DNA and the ligand.

[0055] Among them, the rigid double chain paired with the central chain and the complementary chain serves as the main component of the skeleton and plays a supporting role; the flexible short chain unpaired with the central chain serves as the skeleton corner to maintain a certain angle between the rigid double chains; and the two unpaired tail chains of the complementary chain repel each other.

[0056] The present invention also provides an application of the pentavalent phosphorylcholine ligand as a target molecule.

[0057] Beneficial effects of the present invention:

[0058] The present invention provides a method for constructing a pentavalent phosphorylcholine ligand: (1) A rigid double-stranded chain consisting of a central chain and a complementary chain is used as the main component of the skeleton to play a supporting role and maintain structural stability; the flexible short chain can bring a certain degree of freedom to the DNA skeleton, so that the rigid double-stranded chains maintain a certain angle, and the shorter flexible short chain connection will not destroy the overall rigidity of the DNA skeleton. (2) The size of the DNA skeleton and the distribution of ligands: The rigid DNA skeleton controls the distribution of ligands and can pre-organize phosphorylcholine ligands that interact with target proteins, which is thermodynamically favorable; the size of the skeleton matches the distance between the binding sites on the protein (target), which effectively ensures that the ligand binds to the protein, promotes favorable entropy changes and enthalpy changes during binding, and greatly improves affinity. (3) The length of the carbon-carbon single chain: The skeleton and the ligand are connected by a carbon-carbon single chain to retain The flexible range of about 1.5 allows the ligand to rotate to a suitable conformation through a single bond within a smaller range, so that the spatial orientation of the ligand when binding is consistent with the crystal structure, making the enthalpy change favorable and improving the binding affinity.

[0059] The pentavalent phosphorylcholine ligand prepared by the present invention has a clear direction and distance when binding to a protein, and has high affinity and high specificity binding to C-reactive protein, so it can play an application value in the fields of drug design, formulation development, analysis and detection, and drug delivery of the interaction between the ligand and the corresponding protein, pathogenic microorganisms, small molecules and other targets. And the preparation method of the pentavalent phosphorylcholine ligand of the present invention has the advantages of simple operation, strong universality, mild reaction conditions of the synthesis method, no need for high temperature and high pressure, cheap and easy to obtain raw materials, and high product yield.

[0060] The pentavalent phosphorylcholine ligand designed by the present invention provides a new idea for the multivalent ligand of the DNA backbone. Based on the design idea of ​​the present invention, a multivalent ligand with high affinity, high specificity, high binding degree and good stability can be further designed according to the crystal structure of the target molecule, which has the value of promotion and application in the field of biomaterial technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0061] Figure 1The three-dimensional structure diagram, in which (a) is the crystal structure of the complex of C-reactive protein (CRP) and phosphorylcholine; (b) is a pentavalent phosphorylcholine ligand, which is assembled by a ring-shaped central chain and five complementary chains of modified phosphorylcholine ligands; (c) is the crystal structure of the complex of the pentavalent phosphorylcholine ligand and the target C-reactive protein (CRP);

[0062] Figure 2 is a schematic diagram of the structure, wherein (a) is the secondary structure after five single-stranded nucleic acids are assembled, wherein SEQ ID No. 1 and SEQ ID No. 2 are single-stranded nucleic acids, respectively, and P1PC5 is a pentavalent phosphorylcholine ligand assembled by the present invention; (b) is the end of the complementary chain, including: a phosphorylcholine ligand and a small molecule connecting part;

[0063] Figure 3 The secondary structures of different ligands, wherein SEQ ID No.1: (N2N1 13 )5; SEQ ID No.2: PC-N2N1' 13 N2,;SEQ ID No.5:Azode(N3)-N2N1' 13 N2; SEQ ID No.14: PC-N2N1' 13 N2-FAM; SEQ ID No.15: N2'N1 13 N2'; SEQ ID No.16: Azode(N3)-N2N1' 13 N2-FAM. N1 and N1' are any of A, T, C, and G; N2 and N2' are both A or T; N1' 13 With N1 13 Complementary pairing, N2' and N2 complementary pairing;

[0064] Figure 4 Schematic diagram of the structure, wherein (a) is the secondary structure after five single-stranded nucleic acids are assembled, C-J70 and J15-PC are the single-stranded nucleic acids shown in SEQ ID No.6 and SEQ ID No.7, respectively, and P1PC5 is the pentavalent phosphorylcholine ligand assembled in this embodiment; (b) is the end of the complementary chain, including: a phosphorylcholine ligand and a small molecule connecting part;

[0065] Figure 5Schematic diagram of the secondary structure of different ligands, wherein the cyclization chain C-J70 sequence: (attcgctccctacc)5 (SEQ ID No.6); the complementary chain J15-PC sequence: Phosphocholine (PC) -aggtagggagcgaaa (SEQ ID No.7); J15 sequence: Azide (N3) -aggtagggagcgaaa (SEQ ID No.10); J15F-PC sequence: Phosphocholine (PC) -aggtagggagcgaaa-FAM (SEQ ID No.11); JS15 sequence: tttcgctccctacct (SEQ ID No.12); JF15 sequence: Azide (N3) -aggtagggagcgaaa-FAM (SEQ ID No.13)

[0066] Figure 6 is the hydrogen nuclear magnetic resonance spectrum of 3-butynyl (2-(trimethylammonio)ethyl) phosphate;

[0067] Figure 7 The coupling of DNA and phosphorylcholine ligand was analyzed by 20% denaturing polyacrylamide gel electrophoresis, wherein the reactant is SEQ ID No.10 (J15), and the coupling product is SEQ ID No.7 (J15-PC);

[0068] Figure 8 The results of gel electrophoresis, wherein (a) is 8% non-denaturing polyacrylamide gel electrophoresis to verify that SEQ ID No. 9 (J12) assisted SEQ ID No. 8 (J70) in cyclization; (b) is 20% denaturing polyacrylamide gel electrophoresis to verify the cyclization product; reactant: SEQ ID No. 8 (J70); cyclization product: SEQ ID No. 6 (C-J70); auxiliary chain: SEQ ID No. 9 (J12);

[0069] Fig. 9 The figure is the result of 8% denaturing polyacrylamide gel electrophoresis to verify the self-assembly of pentavalent phosphorylcholine ligand (P1PC5); Central chain: SEQ ID No.6 (C-J70); Complementary chain: SEQ ID No.7 (J15-PC);

[0070] Fig.10 Atomic force microscopy characterization of the nanostructure (a) and size measurement (b) of pentavalent phosphorylcholine ligand (P1PC5);

[0071] Fig.11The result diagram of 8% non-denaturing polyacrylamide electrophoresis analysis of the binding of ligands to proteins; wherein the concentrations of P1PC5 and P1S5 are 2 μM, the concentrations of D1PC1 and D1S1 are 10 μM, and the concentration of C-reactive protein (CRP) is 2 μM;

[0072] Fig.12 The graph shows the changes of binding rate of different ligands with the concentration of C-reactive protein (CRP); wherein the concentrations of P1PC5 and P1S5 are 2 μM, the concentrations of D1PC1 and D1S1 are 10 μM, and the concentration gradient of C-reactive protein (CRP) is 0, 0.5, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0;

[0073] Fig.13 The figure shows the result of immunoprecipitation reaction between light scattering detection ligands (P1PC5, P1S5, D1PC1 and D1S1) and C-reactive protein (CRP);

[0074] Fig.14 The figure shows the structure characterization of the pentavalent phosphorylcholine ligand after fluorescence labeling; wherein, (a) is the analysis of the coupling of DNA and phosphorylcholine ligand by 20% denaturing polyacrylamide gel electrophoresis, reactant: SEQ ID No.13 (J15F), coupling product: SEQ ID No.11 (J15F-PC); (b) is the characterization of P1PCF5 self-assembly by 8% non-denaturing polyacrylamide gel electrophoresis; (c) is the characterization of P1PCF5 nanostructure by atomic force microscopy; (d) is the size determination of P1PCF5; P1PCF5: pentavalent phosphorylcholine ligand labeled with FAM fluorescent group;

[0075] Fig.15 Figures are fluorescence detection results; (a) is the fluorescence decay analysis of the binding of fluorescently labeled ligands (P1PCF5 and D1PCF1) to CRP; (b) is the fluorescence intensity curve of the binding of different concentrations of ligands (P1PCF5 and D1PCF1) to CRP determined by fluorescence immunosorbent assay;

[0076] Fig.16 The figures are the specific analysis results of the binding of pentavalent phosphorylcholine ligand to C-reactive protein (CRP), wherein (a) is the result of fluorescent immunosorbent assay, and (b) is the result of 8% non-denaturing polyacrylamide gel electrophoresis for specificity characterization. DETAILED DESCRIPTION

[0077] Sources of the main reagents or instruments used in the following examples:

[0078] Main instruments: American Bruker atomic force microscope, Infinite M200 PRO multifunctional microplate reader, Hitachi F-7000 fluorescence spectrophotometer, HOEFER SE600 vertical electrophoresis instrument.

[0079] Main reagents: All DNAs were purchased from Shanghai Sangon Biotechnology Co., Ltd.; Stains-all dye was purchased from Sigma Aldrich; C-reactive protein and C-reactive protein antibody were purchased from Nanjing Okai Biotechnology Co., Ltd.; T4 DNA ligase was purchased from Shandong Parker Biotechnology Co., Ltd.; poly-lysine was purchased from TedPella, USA; other reagents used for buffer were purchased from Shanghai Sangon Biotechnology Co., Ltd., Shanghai Yuanye Biotechnology Co., Ltd., Sichuan Chengdu Kelon Reagent Factory, and Chongqing Chuandong Chemical Co., Ltd.

[0080] The present invention intends to disclose a pentavalent phosphorylcholine ligand and a preparation method and application thereof, so as to solve the problem that the binding ability of monovalent phosphorylcholine to C-reactive protein is weak. The pentavalent phosphorylcholine ligand is designed based on the crystal structure of the C-reactive protein-phosphocholine complex to optimize the entropy change and enthalpy change in the binding process, thereby improving the binding ability of the two.

[0081] Wherein, the preparation method of pentavalent phosphorylcholine ligand comprises the following steps:

[0082] Based on the known crystal structure of the C-reactive protein-phosphocholine complex, the three-dimensional simulated structure is as follows Figure 1 a. Analysis of the spatial position, orientation and distance between the binding sites of CRP and PC in the crystal structure.

[0083] Five ligands are connected by a rigid regular pentagonal DNA backbone so that each ligand is evenly coupled to the vertices of the DNA backbone. The rigid double-stranded DNA serves as the main component of the backbone to play a supporting role. Shorter single-stranded DNA serves as the backbone turning point to provide the backbone with appropriate flexibility, maintain a certain angle between the double strands, and rationally design the length of the rigid backbone.

[0084] Retained by carbon-carbon single chain connecting the backbone and ligand The flexible range of about 1.5 allows the ligand to rotate to a suitable configuration through a single bond within a smaller range, so that the spatial orientation of the ligand when binding is consistent with the crystal structure, making the enthalpy change favorable and improving the binding affinity.

[0085] The DNA backbone design was simulated in 3D by Pymol, and a centrosymmetric regular pentagonal structure was obtained, as shown in Figure 1 As shown in b.

[0086] The pentavalent phosphorylcholine ligand and the crystal structure of C-reactive protein (CRP) were simulated and docked, and the three-dimensional structures at different angles were as follows: Figure 1 As shown in c.

[0087] Determine the base sequence, according to 10bp≈3.4nm calculation, the rigid double strand of the backbone is 13bp, connected with 1nt sequence A, the backbone side length is about 4.4nm, the distance between the pentavalent ligand and CRP when binding is highly consistent with the distribution of CRP binding sites, promote favorable entropy change, improve the thermodynamic stability of binding, the secondary structure of the pentavalent phosphorylcholine ligand is as follows Figure 2 As shown in a.

[0088] A shorter carbon-carbon single chain structure is reserved, which is normally folded and the flexibility range is controlled within Within a small range, the rigidity of the structure as a whole is not affected, so that the ligand can form a suitable binding conformation through single bond rotation. The structure at the end of the complementary chain is as follows Figure 2 As shown in b.

[0089] To explore the effect of multivalent interactions on affinity regulation, it is necessary to compare the ability of pentavalent ligands and monovalent ligands to bind proteins. In the present invention, three groups of structures are used, the secondary structures such as Figure 3 As shown: (1) Pentavalent ligand (P1PC5) and monovalent ligand (D1PC1): P1PC5 is constructed by connecting five PC molecules on a regular pentagonal DNA backbone, and is assembled from SEQ ID No.1 and SEQ ID No.2 in a ratio of 1:5 (Figure a); D1PC1 is constructed by connecting a PC molecule to the end of the DNA double strand, and is assembled from SEQ ID No.16 and SEQ ID No.2 in a ratio of 1:1 (Figure d). (2) DNA backbones of pentavalent ligands and monovalent ligands (P1S5 and D1S1) ( Figure 3 b, e): The DNA backbone without PC coupling is intended to exclude the formation of potential aptamer structures after self-assembly and serves as a blank control to exclude errors in the binding reaction. (3) Fluorescently labeled pentavalent ligand (P1PCF5) and monovalent ligand (D1PCF1): P1PCF5 is obtained by coupling a FAM group to the reporter surface of P1PC5 ( Figure 3 c); D1PCF1 is obtained by coupling the FAM group to D1PC1 ( Figure 3 f). Fluorescent labeling was achieved by coupling a FAM group to the 3' end of SEQ ID No. 2 for subsequent fluorescence immunosorbent assay of K d value.

[0090] In order to make the technical problems, technical solutions and beneficial effects solved by the present application clearer, the preparation method of the pentavalent phosphorylcholine ligand of the present invention will be further described in detail below in conjunction with specific embodiments and drawings. Obviously, the specific embodiments described are only part of the embodiments of the present application, rather than all of the embodiments. The following description of at least one exemplary embodiment is actually only illustrative and is by no means intended to limit the present application and its application. Based on the specific embodiments in the present application, all other embodiments obtained by ordinary technicians of the art without creative work are within the scope of protection of the present application.

[0091] If no specific techniques or conditions are specified in the specific embodiments, the techniques or conditions described in the literature in the field or the product instructions are used. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased commercially.

[0092] Embodiment 1 The preparation method of pentavalent phosphorylcholine ligand comprises the following steps:

[0093] Based on the known crystal structure of the C-reactive protein-phosphocholine complex, the three-dimensional simulated structure is as follows Figure 1 a. Analysis of the spatial position, orientation and distance between the binding sites of CRP and PC in the crystal structure.

[0094] Five ligands are connected by a rigid regular pentagonal DNA backbone so that each ligand is evenly coupled to the vertices of the DNA backbone. The rigid double-stranded DNA serves as the main component of the backbone to play a supporting role. Shorter single-stranded DNA serves as the backbone turning point to provide the backbone with appropriate flexibility, maintain a certain angle between the double strands, and rationally design the length of the rigid backbone.

[0095] Retained by carbon-carbon single chain connecting the backbone and ligand The flexible range of about 1.5 allows the ligand to rotate to a suitable configuration through a single bond within a smaller range, so that the spatial orientation of the ligand when binding is consistent with the crystal structure, making the enthalpy change favorable and improving the binding affinity.

[0096] The DNA backbone design was simulated in 3D by Pymol, and a centrosymmetric regular pentagonal structure was obtained, as shown in Figure 1 As shown in b.

[0097] The pentavalent phosphorylcholine ligand and the crystal structure of C-reactive protein (CRP) were simulated and docked, and the three-dimensional structures at different angles were as follows: Figure 1 As shown in c.

[0098] Determine the base sequence, according to 10bp≈3.4nm calculation, the rigid double strand of the backbone is 13bp, connected with 1nt sequence A, the backbone side length is about 4.4nm, the distance between the pentavalent ligand and CRP when binding is highly consistent with the distribution of CRP binding sites, promote favorable entropy change, improve the thermodynamic stability of binding, the secondary structure of the pentavalent phosphorylcholine ligand is as follows Figure 4 As shown in a.

[0099] A shorter carbon-carbon single chain structure is reserved, which is normally folded and the flexibility range is controlled within Within a small range, the rigidity of the structure as a whole is not affected, so that the ligand can form a suitable binding conformation through single bond rotation. The structure at the end of the complementary chain is as follows Figure 4 As shown in b.

[0100] To explore the effect of multivalent interactions on affinity regulation, it is necessary to compare the ability of pentavalent ligands and monovalent ligands to bind proteins. In this example, three sets of structures were used, with secondary structures such as Figure 5 As shown: (1) Pentavalent ligand (P1PC5) and monovalent ligand (D1PC1): P1PC5 is constructed by connecting five PC molecules on a regular pentagonal DNA backbone, and is composed of the nucleotide sequence shown in SEQ ID No.6 and the nucleotide sequence shown in SEQ ID No.7 in a ratio of 1:5 ( Figure 5 a); D1PC1 is assembled by connecting a PC molecule to the end of the DNA double strand, and the nucleotide sequence shown in SEQ ID No.12 and the nucleotide sequence shown in SEQ ID No.7 are assembled in a 1:1 ratio ( Figure 5 d). (2) DNA backbones of pentavalent and monovalent ligands (P1S5 and D1S1) ( Figure 5 b and 5e): The DNA backbone without PC coupling is intended to exclude the formation of potential aptamer structures after self-assembly and serves as a blank control to exclude errors in the binding reaction. (3) Fluorescently labeled pentavalent ligand (P1PCF5) and monovalent ligand (D1PCF1): P1PCF5 is obtained by coupling a FAM group to the reporter surface of P1PC5 ( Figure 5 c); D1PCF1 is obtained by coupling the FAM group to D1PC1 ( Figure 5 f). Fluorescent labeling is achieved by coupling a FAM group to the 3' end of the nucleotide sequence shown in SEQ ID No. 7, and is used for subsequent fluorescence immunosorbent assay to determine K d value.

[0101] Example 2 Alkyne modification of small ligand molecules

[0102] The synthetic reaction formula is as follows:

[0103]

[0104] Among them, compound 1 is 3-butyn-1-ol, compound 2 is 2-chloro-2-oxo-1,3,2-dioxaphospholane, compound 3 is 2-(3-butynyl)-2-oxo-1,3,2-dioxaphospholane, and compound 4 is 3-butynyl (2-(trimethylammonium)ethyl) phosphate.

[0105] The specific synthesis method comprises the following steps:

[0106] Under argon conditions, in a 50mL round-bottom flask, the compound 3-butyn-1-ol (10.0mmol, 0.757mL) was fully dissolved in anhydrous tetrahydrofuran (20mL), anhydrous triethylamine (1.5mL) was added, and the compound 2-chloro-2-oxo-1,3,2-dioxaphosphatolane (13.0mmol, 1.2mL) was slowly added at a temperature of -20°C, and the mixture was warmed to room temperature and stirred for 7h. The obtained white suspension was filtered through a sintered funnel, and the filtrate was concentrated with a rotary evaporator and then dried in a vacuum to obtain a yellow oily crude product 2-(3-butynyl)-2-oxo-1,3,2-dioxaphosphatolane. Since 2-(3-butynyl)-2-oxo-1,3,2-dioxaphosphatolane is unstable on silica gel, the next step of the reaction can be started without further purification.

[0107] Subsequently, under argon conditions, anhydrous acetonitrile (20 mL) was poured into a 100 mL flask, and the crude product 2-(3-butynyl)-2-oxo-1,3,2-dioxaphosphacyclopentane (10.0 mmol, 1.8 g) was added and fully dissolved, and then trimethylamine (16.0 mmol, 8.0 mL, 2 M in THF) was added. The mixture was fully mixed, the flask was sealed, and the mixture was heated to 80 ° C for 60 h.

[0108] Then, the reaction mixture was concentrated under vacuum, and separated and purified by column chromatography (water-methanol-dichloromethane=1:4:5, v / v).

[0109] The filtrate was concentrated by rotary evaporation and dried in vacuum to obtain a slightly yellow oily product, 3-butynyl (2-(trimethylammonio)ethyl) phosphate. The product was characterized by hydrogen nuclear magnetic resonance spectroscopy. The results were as follows: Figure 6 As shown, 1 HNMR(400MHz,D2O)δ4.29(tq,J=6.9,2.7Hz,2H),3.96(q,J=6.8Hz,2H),3.65- 3.67(m,2H),3.24(s,9H),2.54(td,J=6.8,2.8Hz,2H),2.33(t,J=2.6Hz,1H).

[0110] Example 3 Coupling DNA and PC based on CuAAC reaction

[0111] The reaction equation for coupling DNA with phosphorylcholine ligands through the copper-catalyzed azide-alkyne cycloaddition (CuAAC) reaction commonly used in click chemistry is as follows:

[0112]

[0113] The specific preparation method comprises the following steps:

[0114] In a 1.5 mL brown centrifuge tube, add J15 (25 nmol, 4 OD), then add 3-butynyl (2-(trimethylammonium) ethyl) phosphate (100 nmol, 50 μL, 2 mM), sodium bicarbonate solution (1000 nmol, 50 μL, 20 mM) and cuprous iodide powder (1200 nmol, 0.228 mg) in sequence, add primary water to make up the system to 200 μL and mix thoroughly, cover the centrifuge tube, seal the tube mouth with sealing film and fix it on a vortexer and shake vigorously, react at room temperature for 4 h.

[0115] Since cuprous iodide will undergo oxidation or disproportionation reactions, the generated copper (II) ions will destroy the tris-pentaphosphate diester bond and cause DNA decomposition. Therefore, the reaction time should not exceed 6 hours.

[0116] After the reaction, the product was separated and purified by denaturing polyacrylamide gel electrophoresis, and the coupling product was analyzed by 20% denaturing polyacrylamide gel electrophoresis. Figure 7 Wherein, the reactant is SEQ ID No.10 (J15), and the coupling product is SEQ ID No.7 (J15-PC).

[0117] from Figure 7 From the analysis, we can see that the mobility of the coupling product is significantly lower than that of the reactant, indicating that the molecular weight of the coupling product is greater than that of the reactant, proving that J15 successfully couples the phosphorylcholine small molecule.

[0118] Example 4 Synthesis of cyclized central chain

[0119] Pre-assembly of the circularized chain and the auxiliary chain: Add 2.4 mL of 10×T4 DNALigaseBuffer to a 50 mL centrifuge tube, add the circularized chain (J70, 3.43 nmol, 72 μg) and the auxiliary chain (J12, 20.58 nmol, 77.18 μg), add first-grade water to 24 mL and mix thoroughly. Add 1 mL of the reaction solution to 24 1.5 mL centrifuge tubes and perform conventional annealing in a metal bath. Annealing procedure: 95°C, 5 min; 65°C, 30 min; 50°C, 30 min; 37°C, 30 min; 25°C, 30 min; 4°C, 2 h. Analyzed by 8% non-denaturing polyacrylamide gel electrophoresis, the results are as follows Figure 8 As shown in a.

[0120] from Figure 8 From the analysis in a, it can be seen that as the proportion of the auxiliary chain increases, the number of structures assembled at a high ratio gradually increases. When the molar ratio of J70:J12 is 1:1 to 1:2, J70, J70-(J12)1, J70-(J12)2 and J70-(J12)3 are the main assembly structures; when the molar ratio is 1:4 to 1:5.6, J70-(J12)4 is the main assembly structure, and the proportion of J70-(J12)5 gradually increases; when the molar ratio is 1:6, the assembly structure is basically completely composed of J70-(J12)5. 1:6 is the optimal assembly molar ratio of the cyclized chain (J70) and the auxiliary chain (J12).

[0121] T4 DNA ligase catalysis: Add 7 μL of T4 DNA ligase (350U / μL) to each centrifuge tube, invert the centrifuge tube up and down repeatedly to mix the ligase, incubate in a metal bath and inactivate the ligase at high temperature. Annealing program: 16°C, 16h; 65°C, 30min. The product was separated and purified by denaturing polyacrylamide gel electrophoresis, and the cyclized product was analyzed by 20% denaturing polyacrylamide gel electrophoresis. The results are as follows Figure 8 As shown in b.

[0122] from Figure 8 From the analysis in b, we can see that after the circularized chain (J70) is catalyzed by T4 DNA ligase for circularization, the mobility of the circularized product (C-J70) changes significantly, indicating that the structure of the circularized chain has changed, proving that the circularization is successful.

[0123] Example 5 Self-assembly of pentavalent phosphorylcholine ligands

[0124] In a 200 μL centrifuge tube, add the central chain (C-J70) and the complementary chain (J15-PC) at a molar ratio of 1:5, add 10× Tris-HCl buffer and primary water, configure the system to an appropriate concentration and volume as needed, and perform self-assembly in a metal bath with conventional annealing operation. The buffer used is Tris-HCl + 2mM Ca2+ ; The molar ratio of the single-stranded nucleic acid shown in SEQ ID No.6-7 used was 1:5; the buffer Tris-HCl+2mM Ca 2+ The formula is: 50mM tris(hydroxymethyl)aminomethane, 150mM sodium chloride, 1.5mM magnesium chloride, 2mM calcium chloride, pH 7.4. Program settings: 95℃, 5min; 65℃, 30min; 50℃, 30min; 37℃, 30min; 25℃, 30min; 4℃, 2h. The results are as follows: Fig. 9 shown.

[0125] from Fig. 9 From the analysis, it can be seen that when the molar ratio of the central chain (C-J70) and the complementary chain (J15-PC) is 1:2 and 1:3, C-70, P1PC1, P1PC2, P1PC3 and P1PC4 are the main assembly structures. As the proportion of the complementary chain increases, the number of structures assembled at a high ratio gradually increases. When the molar ratio is 1:5, P1PC5 is the main assembly structure. 1:5 is the optimal assembly molar ratio of the central chain (C-J70) and the complementary chain (J15-PC).

[0126] Detection and analysis

[0127] 1) Characterization of pentavalent phosphorylcholine ligands by atomic force microscopy

[0128] The specific operations are:

[0129] The assembled pentavalent phosphorylcholine ligand was in a buffer solution of Tris-HCl + 2 mM Ca 2+ The molar ratio of the single-stranded nucleic acid shown in SEQ ID No.6 to the single-stranded nucleic acid shown in SEQ ID No.7 was 1:5; the buffer solution was Tris-HCl + 2mMCa 2+ The formula is: 50 mM Tris, 150 mM NaCl, 1.5 mM MgCl2, 2 mM CaCl2, pH 7.4.

[0130] Add 20μL of 5μg / μL poly-lysine solution on the mica surface, blow dry with nitrogen after 10 minutes and wash the surface twice with primary water; take 5μL of the sample diluted to 50nM, drop it on the mica surface, spread it evenly to allow the sample to adsorb, and let it stand for 3 to 5 minutes; finally, add 20μL of buffer solution on the sample surface, place the sample under an atomic force microscope for scanning, and the results are as follows Figure 8 shown.

[0131] The nanostructure of pentavalent phosphorylcholine ligand (P1PC5) is as follows Fig.10 As shown in a, from Fig.10From the analysis in a, we can see that the self-assembled nanostructure is a regular pentagon, which is the main observable structure.

[0132] The nanometer size of pentavalent phosphorylcholine ligand (P1PC5) is as follows Fig.10 As shown in b, from Fig.10 From the analysis in b, we can see that the side length of the self-assembled nanostructure is about 4.3nm and the height is about 1.8nm.

[0133] 2) Analysis of ligand-protein binding by non-denaturing polyacrylamide gel electrophoresis

[0134] The specific operations are:

[0135] The total amount of ligands was kept equal among the multivalent ligands, with the concentrations of P1PC5 and P1S5 at 2 μM, D1PC1 and D1S1 at 10 μM, and C-reactive protein (CRP) at 2 μM. 2+ The ligands were assembled and incubated with C-reactive protein (CRP) at 25°C for 2 hours. Fig.11 shown.

[0136] from Fig.11 From the analysis, we can see that when the total amount of ligands is the same, the binding ability of the pentavalent ligand (#P1PC5) is significantly higher than that of the monovalent ligand (#D1PC1), the DNA backbone (#P1S5 and #D1S1) has no interaction with CRP, and PC is an essential group in the binding process.

[0137] The total amount of ligands among the multivalent ligands was kept equal, the concentrations of P1PC5 and P1S5 were 2 μM, the concentrations of D1PC1 and D1S1 were 10 μM, and the concentration gradient of C-reactive protein (CRP) was 0, 0.5, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0. In the buffer Tris-HCl + 2 mM Ca 2+ The ligands were assembled and incubated with C-reactive protein (CRP) at 25°C for 2 hours. The curves of the binding rates of different ligands versus the concentration of C-reactive protein (CRP) are shown in Fig.12 shown.

[0138] from Fig.12 From the analysis, we can see that at all CRP concentrations, the binding rate of the monovalent ligand (#D1PC1) is always lower than that of the pentavalent ligand (#P1PC5), and the binding rate of the DNA backbone (#P1S5 and #D1S1) is close to 0. At a CRP concentration of 3.5 μM, the binding rate of the pentavalent ligand is close to 100%, while the binding rate of the monovalent ligand is less than 10%.

[0139] 3) Effect of fluorescent groups on the binding of multivalent ligands to C-reactive protein

[0140] The specific operations are:

[0141] All light scattering experiments were performed using a Hitachi F-7000 fluorescence spectrometer (scanning speed 240 nm / min, excitation wavelength 468 nm, EX Slit × EM Slit = 5 nm × 5 nm) and a quartz fluorescence cuvette (3 mm × 3 mm). The final concentration of CRP was 0.5 μM, and the final concentration gradient of ligands (P1PC5, P1S5, D1PC1, and D1S1) was 0, 0.05, 0.1, 0.15, 0.2, 0.3, 0.4, 0.5, 0.6, and 0.7 μM. In the buffer Tris-HCl + 2 mM Ca 2+ The cells were assembled and incubated with C-reactive protein (CRP) at 25°C for 2 hours. Three replicates were set for each concentration. After the incubation, the scattered light intensity of the solution was detected and the data was fitted using analysis software. The results are shown in Figure 2. Fig.13 shown.

[0142] from Fig.13 From the analysis, we can see that when the CRP concentration remains unchanged at 0.5μM, with the increase of #P1PC5 concentration, the scattered light intensity shows a trend of first increasing and then decreasing, while #P1S5, #D1PC1 and #D1S1 cannot cause changes in the scattered light intensity.

[0143] 4) Comparison of the affinity of different ligands by fluorescence immunosorbent assay

[0144] After labeling with fluorescent groups, the effect of the added groups on the self-assembly structure needs to be eliminated. The structural characterization of the pentavalent phosphorylcholine ligand after fluorescent labeling is as follows: Fig.14 shown.

[0145] in, Fig.14 a is the coupling analysis of DNA and phosphorylcholine ligand by 20% denaturing polyacrylamide gel electrophoresis, reactant: J15F, coupling product: J15F-PC; Fig.14 b is 8% non-denaturing polyacrylamide gel electrophoresis to characterize the self-assembly of P1PCF5; Fig.14 c shows the atomic force microscopy characterization of P1PCF5 nanostructure; Fig.14 d: Size determination of P1PCF5, P1PCF5: pentavalent phosphorylcholine ligand labeled with FAM fluorescent group.

[0146] from Fig.14The analysis shows that the mobility of the coupling product J15F-PC is lower than that of the reactant J15F, indicating that the increase in the molecular weight of J15F leads to a decrease in mobility. There are no other impurity bands and the purity is good. The assembly of the pentavalent ligand was observed by 8% non-denaturing PAGE, proving that P1PCF5 can assemble to form a uniform pentavalent structure, and the optimal assembly molar ratio is 1:5.1. The results of atomic force microscopy scanning imaging show that #P1PCF5 is a regular pentagon, with a nanostructure side length of about 4.2nm and a height of about 1.8nm. In summary, fluorescently labeled pentavalent ligands will not cause changes in the structure of the pentavalent ligands.

[0147] The binding of fluorescent groups to proteins may produce fluorescence resonance energy transfer (FRET) or non-radiative energy transfer, resulting in fluorescence attenuation or quenching. In order to eliminate the possibility of experimental errors caused by this effect in subsequent experiments, fluorescently labeled multivalent ligands were combined with CRP solution and blank solution respectively to observe the difference in fluorescence signals. Prepare 55 μL P1PCF5 and D1PCF1 solutions, mix each with 55 μL CRP solution (the final concentration of CRP is 10 nM, and the final concentrations of P1PCF5 and D1PCF1 are 10 nM and 50 nM, respectively), and in a buffer solution of Tris-HCl + 2 mM Ca 2+ The cells were assembled and incubated with C-reactive protein (CRP) at 25°C for 2 hours. 100 μL of the solution was added to a black 96-well plate and the fluorescence signal was detected by a multifunctional microplate reader. The results were as follows: Fig.15 As shown in a.

[0148] Fig.15 a is the fluorescence decay analysis of the binding of fluorescently labeled ligands (P1PCF5 and D1PCF1) to CRP. Fig.15 From the analysis in a, it can be seen that after P1PCF5 and D1PCF1 bind to CRP, the fluorescence intensity remains stable, and no fluorescence attenuation or quenching is observed. This indicates that in this binding system, the effect of fluorescence resonance energy transfer or non-radiative energy transfer is weak and has no effect on the fluorescence signal intensity.

[0149] Comparison of the affinity of different ligands by fluorescent immunosorbent assay: 100 μL C-reactive protein antibody (20 mg / L) was coated in a highly adsorbed black 96-well plate, the plate was sealed with a plastic wrap cover, incubated overnight at 4°C, and the plate was washed 3 times after the incubation. 2+Buffer, blocked at 25°C for 2 hours, and the plate was washed 3 times after blocking. 100 μL of C-reactive protein antigen (20 μg / mL) was added to each well, the plate was sealed with a plastic wrap cover, and incubated at 25°C. After incubation, the plate was washed 3 times. 100 μL of different concentration gradients (0, 1.25nM, 2.5nM, 5nM, 10nM, 20nM, 40nM, 80nM, 160nM, 320nM and 640nM) of ligand were added to each well. Seal the plate with a plastic wrap cover, cover the plate with an opaque black 96-well plate cover, and incubate at 25°C for 2 hours. After incubation, wash the plate and measure the fluorescence intensity. The results are as follows. Fig.15 As shown in b.

[0150] Fig.15 b is the fluorescence intensity curve of different concentrations of ligands (P1PCF5 and D1PCF1) binding to CRP determined by fluorescence immunosorbent assay. Fig.15 From the analysis in b, we can see that the affinity of #P1PCF5 to CRP is significantly higher than that of #D1PCF1, and the dissociation constant (K d The values ​​were 29.06 nM and 53.81 μM, respectively, as shown in Table 1. This indicates that the affinity of the pentavalent ligand for CRP is 3 orders of magnitude higher than that of the monovalent ligand.

[0151] Table 1 Affinity K of different ligands d value

[0152] Ligand <![CDATA[K d ]]> <![CDATA[P1PCF5]]> 29.06nM <![CDATA[D1PCF1]]> 53.81μM

[0153] 5) Specificity analysis of pentavalent phosphorylcholine ligands

[0154] The specific operations are:

[0155] The proteins used in specific analysis include: C-reactive protein (CRP), bovine serum albumin (BSA), human serum albumin (HSA), plasma fibrinogen (Fg), human coagulation factor IXa (HIXa), human coagulation factor Ⅹ (HFX) and human coagulation factor XI (HFXI).

[0156] 100 μL C-reactive protein antibody (20 mg / L) was coated in a highly adsorbed black 96-well plate, the plate was sealed with a plastic wrap cover, incubated overnight at 4°C, and the plate was washed 3 times after the incubation. 2+Buffer, block at 25°C for 2 hours, and wash the plate 3 times after blocking. Add 100 μL of different proteins (20 μg / mL) to each well, seal the plate with plastic wrap, and incubate at 25°C. Wash the plate 3 times after incubation. Add 100 μL of pentavalent phosphorylcholine ligand (0.25 μM) to each well. Seal the plate with a plastic wrap cover, cover the plate with an opaque black 96-well plate cover, and incubate at 25°C for 2 hours. After incubation, wash the plate, measure the fluorescence intensity, and analyze the specificity of the pentavalent phosphorylcholine ligand and the protein. The results are as follows. Fig.16 As shown in a.

[0157] from Fig.16 From the analysis in a, it can be seen that BSA, HSA, Fg, HFⅨa, HFⅩ and HFⅪ showed fluorescence intensities similar to those of the negative control group, and none of them exceeded 10% of the experimental group (CRP), indicating that the detection specificity of the pentavalent phosphorylcholine ligand (#P1PCF5) was good.

[0158] Take 2 μM pentavalent phosphorylcholine ligand in buffer Tris-HCl + 2 mM Ca 2+ The cells were assembled and incubated with 4 μM of different proteins for 2 h at 25°C. The specificity of the pentavalent phosphorylcholine ligands to the proteins was analyzed by 8% non-denaturing polyacrylamide gel electrophoresis. The results are shown in Fig.16 As shown in b.

[0159] from Fig.16 From the analysis in b, it can be seen that #P1PCF5 binds to CRP, generating a new binding band, and the corresponding DNA band almost completely disappears. BSA, Fg, HⅨa, HFⅩ, HSA, HFⅪ have no obvious binding bands with CRP, indicating that the detection specificity of the pentavalent phosphorylcholine ligand (#P1PCF5) is good.

[0160] In summary, the pentavalent phosphorylcholine ligand of the present invention is constructed in the following ways: (1) The rigid double-stranded chain consisting of a central chain and a complementary chain is used as the main component of the skeleton to play a supporting role and maintain structural stability; the flexible short chain can bring a certain degree of freedom to the DNA skeleton, so that the rigid double-stranded chains maintain a certain angle, and the flexible short chain will not destroy the overall rigidity of the DNA skeleton. (2) The size of the DNA skeleton and the distribution of ligands: The rigid DNA skeleton controls the distribution of the ligands and can pre-organize the phosphorylcholine ligands that interact with the target protein, which is thermodynamically favorable; the size of the skeleton matches the distance between the binding sites on the protein (target), which effectively ensures that the ligand binds to the protein, promotes the favorable entropy change and enthalpy change during binding, and greatly improves the affinity. (3) The length of the carbon-carbon single chain: The skeleton and the ligand are connected by a carbon-carbon single chain to retain The flexible range of about 1.5 allows the ligand to rotate to a suitable configuration through a single bond within a smaller range, so that the spatial orientation of the ligand when binding is consistent with the crystal structure, making the enthalpy change favorable and improving the binding affinity.

[0161] The pentavalent phosphorylcholine ligand prepared by the present invention has a clear direction and distance when binding to a protein, and has high affinity and specificity, so it can play an application value in the fields of drug design, formulation development, analysis and detection, and drug delivery related to C-reactive protein. And the preparation method of the pentavalent phosphorylcholine ligand of the present invention has the advantages of simple operation, strong universality, mild reaction conditions of the synthesis method, no need for high temperature and high pressure, cheap and easy to obtain raw materials, and high product yield.

[0162] The pentavalent phosphorylcholine ligand designed by the present invention provides a new idea for the multivalent ligand of the DNA backbone. Based on the design idea of ​​the present invention, a multivalent ligand with high affinity, high specificity, high binding degree and good stability can be further designed according to the crystal structure of the target molecule, which has the value of promotion and application in the field of biomaterial technology.

[0163] Finally, it should be noted that the above preferred embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail through the above preferred embodiments, those skilled in the art should understand that various changes can be made in form and details without departing from the scope defined by the claims of the present invention.

Claims

1. A pentavalent phosphorylcholine ligand, characterized in that include: A central chain, wherein the central chain is ring-shaped; A complementary chain, wherein the complementary chain is assembled with the central chain to form a DNA backbone in which single-stranded and double-stranded chains are alternately arranged, and the secondary structure of the DNA backbone is a regular pentagon; The double chains are rigid double chains, and the connecting part between the rigid double chains is a flexible short chain; The complementary chain end includes a phosphorylcholine ligand and a small molecule connecting portion, and the phosphorylcholine ligand is connected to the DNA backbone through the small molecule connecting portion; The tail of the complementary chain is 1 to 3 bases.

2. The pentavalent phosphorylcholine ligand according to claim 1, characterized in that The pentavalent phosphorylcholine ligand is assembled from at least two single-stranded nucleic acids; And / or, the side length of the regular pentagon is 4.4 nm; And / or, there is one central chain; And / or, the complementary strand is the same strand repeated five times, or is 2 to 5 different strands.

3. The pentavalent phosphorylcholine ligand according to claim 1, characterized in that The rigid double strand contains 12 to 14 base pairs; And / or, the flexible short chain part of the central chain is composed of the same sequence of 1 to 2 bases; And / or, the tail of the complementary chain is 1 to 3 bases.

4. The pentavalent phosphorylcholine ligand according to claim 1, characterized in that The phosphorylcholine ligand is a phosphorylcholine ligand for the phosphorylcholine binding site on C-reactive protein.

5. The method for preparing a pentavalent phosphorylcholine ligand according to any one of claims 1 to 4, characterized in that: The pentavalent phosphorylcholine ligand is assembled from single-stranded nucleic acids with nucleotide sequences such as SEQ ID No. 1 and SEQ ID No.

2.

6. The method for preparing a pentavalent phosphorylcholine ligand according to claim 5, characterized in that: The single-stranded nucleic acid shown in SEQ ID No. 1 is assembled by nucleotide sequences such as single-stranded nucleic acids shown in SEQ ID No. 3 and SEQ ID No. 4, and cyclized under the catalysis of T4 DNA ligase, and the molar ratio of the single-stranded nucleic acid shown in SEQ ID No. 3 to the single-stranded nucleic acid shown in SEQ ID No. 4 is 1:5-6; And / or, the single-stranded nucleic acid shown in SEQ ID No.2 is synthesized by a copper-catalyzed azide-alkyne Husigen cycloaddition reaction of a single-stranded nucleic acid with a nucleotide sequence as shown in SEQ ID No.5 and 3-butynyl (2-(trimethylammonio)ethyl) phosphate; The 5' end or 3' end of the single-stranded nucleic acid shown in SEQ ID No. 2 is coupled with a phosphorylcholine ligand.

7. The method for preparing a pentavalent phosphorylcholine ligand according to claim 5, characterized in that: The buffer used for the assembly of the pentavalent phosphorylcholine ligand is Tris-HCl + 2 mM Ca 2+ The buffer was Tris-HCl + 2 mM Ca 2+ The formula is: 50 mM Tris, 150 mM NaCl, 1.5 mM MgCl2, 2 mM CaCl2, pH 7.4; And / or, the molar ratio of the single-stranded nucleic acid shown in SEQ ID No.1 to the single-stranded nucleic acid shown in SEQ ID No.2 is 1:5-6.

8. The method for preparing a pentavalent phosphorylcholine ligand according to claim 5, characterized in that: The reaction procedure of the assembly was: 95 °C for 5 min, 65 °C for 30 min, 50 °C for 30 min, 37 °C for 30 min, 25 °C for 30 min, and 4 °C for 2 h.

9. The method for preparing a pentavalent phosphorylcholine ligand according to claim 5, characterized in that: The steps include: (a) Find the crystal structure of the complex of phosphocholine ligand and target protein, and determine the spatial position, orientation and distance between the binding sites of C-reactive protein and phosphocholine ligand in the crystal structure; (b) Designing a suitable regular pentagonal rigid DNA backbone so that the side length of the backbone is equal to the distance between the binding sites on the target protein; (c) Determine the sequence length and base types of the central chain and complementary chain, connect the phosphorylcholine ligands to the ends of the complementary chains, and make each ligand evenly distributed at the vertices of the DNA backbone; (d) The backbone and ligand are connected by a carbon-carbon single chain to retain a 5 Å flexibility range, so that the ligand can rotate to a suitable configuration through a single bond within the flexibility range; (e) The rigid double chain with the central chain and the complementary chain paired is used as the backbone component, and the flexible short chain without the central chain paired is used as the backbone corner; The two unpaired short tail chains of the complementary chains repel each other and point to the two sides of the DNA backbone, thus obtaining the design unit of the multivalent phosphorylcholine ligand, namely the pentavalent phosphorylcholine ligand.

10. Use of the pentavalent phosphorylcholine ligand according to any one of claims 1 to 4 in the detection of C-reactive protein, the use comprising detecting clinical samples related to infection, inflammation and cardiovascular disease.

Images