High-biological-activity recombinant human-derived (XVII) type collagen amino acid sequence as well as preparation method and application thereof

Abstract

The preparation method comprises the following steps: firstly, analyzing the amino acid sequence of an alpha 1 chain of the human XVII type collagen, and selecting partial amino acid fragments which are not easily degraded by endogenous or exogenous protease in non-transmembrane regions of different functional domains of the protein; the recombinant collagen gene fragment (Col17a) n is obtained by repeatedly splicing the recombinant collagen gene fragment (Col17a) n; then introducing homologous promoters from different methylotrophic yeasts to the 5'end of a recombinant collagen gene segment, optimally synthesizing selected (Col17a) n and promoter segments, obtaining a connecting segment by utilizing PCR cloning, connecting the collagen segment (Col17a) n, the promoter segments and a pPIC9K carrier skeleton segment by virtue of a Gibson Assessment seamless connection technology, and obtaining the recombinant collagen gene. And constructing to obtain the pichia pastoris expression plasmid pPIC9K-(Col17a) n of the recombinant human source XVII type collagen.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and specifically relates to a highly biologically active recombinant human type XVII collagen amino acid sequence and a preparation method and application thereof. Background Art

[0002] Human type XVII collagen is a transmembrane non-fibrogenic collagen. It is a homogeneous trimer composed of three identical α1 (XVII) chains. The single-chain molecular weight is 180 kDa, which contains a 70 kDa globular intracellular domain, a transmembrane domain and a 120 kDa extracellular collagen domain. It has very strong thermal stability. The N-terminus of human type XVII collagen is located in the cytoplasm, and the C-terminus is located in the extracellular matrix. It is divided into three major domains: intracellular, transmembrane, and extracellular. It can also be divided into 16 non-triple helical regions and 15 triple helical regions according to whether it has a typical (Gly-XY)n amino acid repeat sequence and whether it can form a triple helical region. These collagen domains and non-collagen domains jointly participate in the interaction with the extracellular matrix. It is mainly expressed in epidermal basal keratinocytes.

[0003] As an important component of hemidesmosomes in cells, human type XVII collagen plays an important role in maintaining the tight connection between the basement membrane and the extracellular matrix. It can regulate the adhesion, separation and developmental differentiation of epithelial cells, and plays an important role in the differentiation and regeneration of keratinocytes. Type XVII collagen is an important regulator in the process of wound repair. During the process of wound healing, the expression and cleavage of type XVII collagen in basal keratinocytes are strongly induced. The 120kDa extracellular domain of type XVII collagen is cleaved by A disintegrin and metalloproteinase (ADAM) 9 and 10. In addition, in quiescent hair follicle stem cells, the expression of type XVII collagen is reduced. Knocking out the gene for type XVII collagen will cause hair loss. Therefore, type XVII collagen plays a key role in hair growth.

[0004] However, the content of type XVII collagen in the human body is extremely low, and the content of type XVII collagen in animals is also extremely rare. It is also very difficult to extract. It cannot be obtained by treating animal tissues with traditional acid, alkali, and enzymatic methods. A small amount of extraction can only meet the needs of scientific research, and cannot be mass-produced. There is no possibility of large-scale application. At the same time, there are inevitable biosafety risks such as animal-derived disease infection, immune rejection or allergic reactions, and potential viruses. Therefore, with the development of genetic engineering technology, the main way to solve such problems now is to obtain recombinant type XVII collagen through biotechnology such as genetic engineering.

[0005] For example, the Chinese patent application number CN110845603A, filed on October 31, 2019, discloses a human collagen type 17 polypeptide expressed by Escherichia coli, its production method and use, wherein the polypeptide comprises 63 to 1496 consecutive amino acid residues of SEQ ID No.9, wherein the polypeptide comprises the sequence shown in (A)m or consists of the sequence shown in (A)m, and its amino acid sequence is 1-10 tandem repeats of any one of the three polypeptides, and the produced recombinant human collagen has very good hydrophilicity and stability, and its amino acid composition is 100% identical to the corresponding part of the natural collagen amino acid sequence, and will not cause immune rejection and allergic reactions when applied to the human body, and can be widely used in the biomedicine and cosmetics industries; the Chinese patent application number CN116640231A, filed on October 31, 2019, discloses a human collagen type 17 polypeptide expressed by Escherichia coli, its production method and use, wherein the polypeptide comprises 63 to 1496 consecutive amino acid residues of SEQ ID No.9, wherein the polypeptide comprises the sequence shown in (A)m or consists of the sequence shown in (A)m, and its amino acid sequence is 10 tandem repeats of any one of the three polypeptides, and the produced recombinant human collagen has very good hydrophilicity and stability, and its amino acid composition is 100% identical to the corresponding part of the natural collagen amino acid sequence, and will not cause immune rejection and allergic reactions when applied to the human body, and can be widely used in the biomedicine and cosmetics industries. A Chinese patent on June 9, 2023 discloses a recombinant humanized type 17 collagen polypeptide and a method for preparing the same. The amino acid sequence of the collagen polypeptide rhC17ICD is composed of the amino acid sequence of the intracellular region (ICD) of human type 17 collagen or contains the amino acid sequence of the ICD region. The efficient and stable expression of the ICD region of human type 17 collagen is achieved through the E. coli system, and the target protein with a purity of more than 90% can be obtained through the provided purification method, overcoming the limitations of the recombinant and efficient expression of the ICD region of human type 17 collagen and the problems of poor product stability and easy degradation. However, the above invention applications all use an E. coli expression system. E. coli is a prokaryotic organism that cannot perform post-translational modifications on proteins. Therefore, it is difficult for the E. coli system to express triple-helical collagen with a natural higher-order structure. In addition, the protein obtained by expression in E. coli may also have problems such as endotoxin contamination and low biological activity.

[0006] In addition, generally speaking, transmembrane proteins are not secreted outside the cell when expressed in eukaryotic cells, but are fixed on the cell membrane. The amino acid sequence of type XVII collagen is very long (1497 amino acids) and the protein molecular weight is large (180kDa). In theory, it is difficult to effectively secrete it outside the cell and it is easy to degrade. To successfully express it, it is necessary to select relevant sequences. In the extracellular domain of type XVII collagen (489-1497aa), there are 15 collagen domains and 16 non-collagenous domains. These domains jointly participate in the interaction with the extracellular matrix and are an important part of maintaining the stability of the basement membrane. The protein expression pathway of Pichia pastoris overcomes the defects of collagen expressed by animal sources and Escherichia coli. The yeast expression system has molecular chaperones and enzymes for post-translational modification of proteins (such as glycosylation, hydroxylation, acetylase, etc.), which is very suitable for the formation of triple-helical collagen with a higher-order structure.

[0007] Therefore, on the premise of selecting amino acid sequences so that they can maintain the advantages of the Pichia pastoris expression system (especially secretory expression), genetic engineering is used to develop recombinant human type XVII collagen with excellent cell adhesion activity, cell migration promoting activity, and biological activity of promoting tissue regeneration and hair follicle repair and regeneration. A preparation method is designed with simple operation, considerable yield, and easy to expand production, which is of great significance to the current research and application of recombinant human type XVII collagen. Summary of the invention

[0008] In order to solve the problems existing in the prior art, the present invention provides a highly biologically active recombinant human type XVII collagen amino acid sequence and a preparation method and application thereof. The collagen not only has good solubility and the protein state can maintain stability in the later stage of fermentation, but also has excellent cell adhesion activity, cell migration promoting activity and biological activity of promoting tissue regeneration and hair follicle repair and regeneration.

[0009] The technical solution of the present invention is as follows:

[0010] One of the purposes of the present invention is to provide a method for preparing recombinant human type XVII collagen with high biological activity, comprising the following steps:

[0011] S1. Analyze the amino acid sequence of the α1 chain of human type XVII collagen, select some amino acid fragments (489-1497aa) of the non-transmembrane region of the protein that are not easily degraded by endogenous or exogenous proteases, repeatedly splice the selected fragments to obtain a recombinant collagen gene fragment (Col17a)n, and introduce orthologous promoters from different methylotrophic yeasts before recombining the collagen, and optimize the synthesis of the selected (Col17a)n and promoter fragments;

[0012] S2. The connection fragments were obtained by PCR cloning, and then the collagen fragment (Col17a)n, the promoter fragment and the pPIC9K vector backbone fragment were connected by Gibson Assembly seamless connection technology to construct the recombinant plasmid pPIC9K-(Col17a)n;

[0013] S3. Preparation of competent Pichia pastoris cells P. pastoris GS115 and expression of human type XVII collagen using pPIC9K-(Col17a)n.

[0014] Furthermore, in the recombinant collagen gene fragment (Col17a)n in S1, Col17a is the amino acid sequence shown in SEQ ID NO.1, or an amino acid sequence modified to a certain extent by amino acid replacement, insertion, substitution, addition or deletion based on SEQ ID NO.1, or an amino acid sequence having greater than 80% homology with the amino acid sequence of SEQ ID NO.1.

[0015] Furthermore, n is an integer greater than or equal to 1.

[0016] Furthermore, the orthologous promoter in S1 is the AOX1 promoter from Pichia pastoris or the FMD promoter from Hansenula polymorpha.

[0017] Furthermore, the FMD promoter of Hansenula polymorpha (NCBI sequence number: AY550077.1) was synthesized after modification, and the nucleotide sequence (1-639aa) is shown in SEQ ID NO.2.

[0018] Furthermore, the PCR cloning in S2 comprises the following steps:

[0019] S2-1, using PCR technology to perform PCR cloning on the expression vector pPIC9K, collagen fragment and promoter fragment to obtain a connection fragment, and the cloned collagen, promoter and expression vector pPIC9K fragment were mixed at a concentration ratio of 3:4:1;

[0020] S2-2, using Gibson Assembly seamless connection technology to connect the collagen fragment, promoter and pPIC9K vector backbone fragment obtained in S21 to construct the recombinant plasmid pPIC9K-(Col17a)n;

[0021] S2-3. Incubate the ligation mixture in a metal bath, then transform the ligation mixture into Escherichia coli DH5α competent cells by heat shock method. After overnight culture at 37°C, pick the positive single clones grown on the plate containing sodium ampicillin and kanamycin for preliminary verification by colony PCR. The successfully verified single colony is inoculated in a 5mL LB test tube for culture, and the plasmid is extracted and sequenced to confirm that the recombinant gene is consistent with the design.

[0022] Furthermore, the verification primer in S2-3 is Col17a-F / R.

[0023] Furthermore, the connection mixture in S2-3 is incubated in a 50° C. metal bath for 1 h.

[0024] Furthermore, the single colony successfully verified in S2-3 was cultured in a 5 mL LB test tube at 37 degrees for 16 hours.

[0025] Furthermore, the preparation of GS115 competent cells and the expression of pPIC9K-(Col17a)n in S3 include the following steps:

[0026] S3-1. Preparation of electroporation competent cells: Activate GS115 bacterial liquid by streaking on a YPD plate and culture in an incubator until a single colony grows. Pick a single colony and inoculate it into 5 mL YPD liquid medium for culture. Then inoculate the seed liquid into 50 mL YPD medium at an inoculum volume of 1‰. Collect the bacterial liquid and centrifuge it. Discard the supernatant. Repeat the operation, resuspend the bacteria with D-sorbitol solution and dispense into small portions at 100 μL / tube.

[0027] S3-2, take the linearized recombinant plasmid pPIC9K-(Col17a)n fragment and mix it with the competent cells of Pichia pastoris GS115, and then quickly transfer it to an electroporation cup for electroporation transformation to allow the recombinant plasmid fragment to enter the competent cells of P. pastoris GS115;

[0028] S3-3, spread the transformed competent cells P. pastoris GS115 on the MD plate and invert it in a constant temperature incubator for culture until a single colony appears on the plate, pick a single colony for culture, extract the genome for PCR verification, and then sequence to verify whether the transformation is successful;

[0029] S3-4, the recombinant bacteria verified by sequencing were respectively transfected on YPD plates with a G418 concentration of 500 μg / ml-4 mg / ml to screen for high-copy recombinant strains, and the recombinant bacteria that can grow on the high-concentration G418 plates were selected for activation and then maintained;

[0030] S3-5, transfer the activated recombinant bacteria in S3-4 to new YPD liquid medium for overnight culture;

[0031] S3-6, transfer the overnight activated bacterial solution to 5 mL of BMGY liquid culture medium with an inoculum volume of 1% and collect the bacterial cells by centrifugation, then suspend the collected bacterial cells by centrifugation in 50 mL of BMMY liquid culture medium and ferment and culture, add methanol with a final concentration of 0.5-1% to the culture medium every 24 hours to induce expression;

[0032] S3-7. After 96 hours of induction, the culture medium was centrifuged and the supernatants at 24 hours, 48 ​​hours, 72 hours and 96 hours of induction were collected for SDS-PAGE protein electrophoresis to verify the expression of highly bioactive recombinant human type XVII collagen.

[0033] Furthermore, in the S3-1, the GS115 bacterial liquid was activated by streaking on a YPD plate, and cultured in a 30°C incubator until a single colony grew out, and a single colony was picked and inoculated into 5 mL of YPD liquid culture medium, and cultured at 30°C and 220 rpm for 18 h.

[0034] Furthermore, in the S3-1, the seed liquid was inoculated into 50 mL YPD at an inoculum size of 1‰, cultured until OD600 was 1.3-1.5, the bacterial liquid was collected and centrifuged at 4°C and 5000 rpm for 5 min, the supernatant was discarded, and the process was repeated twice. The bacteria were resuspended in 1 M / L D-sorbitol solution and aliquoted into small portions at 100 μL / tube.

[0035] Furthermore, 1 μg of the linearized plasmid pPIC9K-(Col17a)n fragment in S3-2 was mixed with 100 μL of yeast competent GS115 in S3-1, and then quickly transferred to a 0.2 cm pre-cooled electroporation cup and placed on ice for 5 minutes.

[0036] Furthermore, the electric shock conversion parameters in S3-2 are as follows: electric shock voltage 2kV, capacitance 25μF, resistance 200Ω, and electric shock time 5msec.

[0037] Furthermore, after the electric shock in S3-2 is completed, the pre-cooled sorbitol solution is immediately added to the electroporation cup, gently blown to mix, and then quickly transferred to a centrifuge tube, and placed in a 30°C constant temperature incubator for static culture.

[0038] Furthermore, immediately after the electric shock in S3-2 is completed, 600-700 μL of pre-cooled 1 M sorbitol solution is added to the electroporation cup, gently blown to mix, and then quickly transferred to a 1.5 mL centrifuge tube and placed in a 30° C. constant temperature incubator for 1-2 hours.

[0039] Furthermore, in S3-3, the transformed competent cells P. pastoris GS115 are spread on the MD plate and then inverted in a 30° C. constant temperature incubator for 3-4 days.

[0040] Furthermore, the activated recombinant bacteria in S3-5 were cultured in YPD liquid culture medium at 30° C. and 220 rpm overnight for activation.

[0041] Furthermore, the activated bacterial solution in S3-6 was cultured in 5 mL of BMGY liquid culture medium at 30° C. and 220 rpm for 24 h, and the bacterial cells were collected by centrifugation at 4° C. and 5000 rpm for 10 min.

[0042] Furthermore, in S3-6, 50 mL of BMMY liquid culture medium was used to suspend the bacteria collected by centrifugation and ferment and cultured at 30° C. and 220 rpm.

[0043] Furthermore, the culture medium after induced expression in the S3-7 was centrifuged at 4° C. and 12,000 rpm for 10 min.

[0044] The second object of the present invention is to provide a recombinant human type XVII collagen with high biological activity.

[0045] The third object of the present invention is to provide a highly bioactive recombinant human type XVII collagen for use in promoting tissue regeneration and hair follicle repair and regeneration.

[0046] Compared with the prior art, the beneficial effects of the present invention are:

[0047] 1. In the extracellular domain of type XVII collagen (489-1497aa), there are 15 collagen domains and 16 non-collagen domains. These domains jointly participate in the interaction with the extracellular matrix and are an important part in maintaining the stability of the basement membrane. The invention designs and splices the sequence of human type XVII collagen, selects different functional domain fragments from the extracellular domain (489-1497aa) of the α1 chain of human full-length type XVII collagen, splices them to obtain a recombinant collagen gene fragment (Col17a)n, and introduces the orthologous promoters of different methylotrophic yeasts, such as the AOX1 promoter of Pichia pastoris or the FMD promoter of Hansenula polymorpha, before the recombinant collagen, optimizes and synthesizes the selected (Col17a)n and the promoter fragment, and thus constructs a novel recombinant plasmid, so that the secreted human type XVII collagen has better solubility, higher biological activity and better stability, significantly reduces the probability of protein degradation in the late fermentation period, is suitable for promotion and application in actual industries, and solves the problem of limited source of type XVII collagen.

[0048] 2. Different from the commonly used Escherichia coli expression system in the prior art, the present invention innovatively combines the expression of the Pichia pastoris expression system with the recombinant plasmid pPIC9K-(Col17a)n to secrete and express recombinant human type XVII collagen with high biological activity. The Pichia pastoris expression system has molecular chaperones and enzymes for post-translational modification of proteins (such as glycosylation, hydroxylation, acetylase, etc.), which are very suitable for the formation of human type XVII collagen with triple-helical collagen, and overcomes the defects of the Escherichia coli expression system that cannot perform post-translational modification of proteins, and may have endotoxin contamination and low biological activity; at the same time, when the Pichia pastoris expression system expresses recombinant proteins with natural sequences at high-density fermentation, they are often degraded by the protease system in Pichia pastoris. The recombinant human type XVII collagen secreted by the recombinant plasmid pPIC9K-(Col17a)n constructed by the present invention can maintain the physicochemical properties of the recombinant human type XVII collagen, maintain the stability of biological functions and improve its biological activity while reducing the degradation phenomenon.

[0049] 3. The present invention discloses for the first time a highly biologically active recombinant human type XVII collagen, which has an advanced triple helix structure and good solubility, and a stable molecular structure. Compared with natural human type XVII collagen, it exhibits more excellent cell adhesion activity, cell migration promoting activity, and biological activity of promoting tissue regeneration and hair follicle repair and regeneration. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] Figure 1 This is a schematic diagram of the structure of the recombinant plasmid pPIC9K-(Col17a)2 constructed in the present invention;

[0051] Figure 2 The collagen electrophoresis result of the highly bioactive recombinant human type XVII collagen described in Example 2 of the present invention;

[0052] Figure 3 This is a graph showing the effects of recombinant human XVII collagen (Col17a) 2 and fetal bovine serum (BSA) on the relative adhesion of human hair follicle stem cells in the performance test of the present invention;

[0053] Figure 4 This is a graph showing the effects of recombinant human XVII collagen (Col17a) 2 and fetal bovine serum (BSA) on the relative adhesion of human fibroblasts in the performance test of the present invention;

[0054] Figure 5 This is a graph showing the effect of recombinant human XVII collagen (Col17a) 2 and fetal bovine serum (BSA) on the migration rate of human hair follicle stem cells in the performance test of the present invention;

[0055] Figure 6This is a graph showing the effect of recombinant human XVII collagen (Col17a) 2 and fetal bovine serum (BSA) on the migration rate of human fibroblasts in the performance test of the present invention;

[0056] Figure 7 This is a graph showing the effects of recombinant human XVII collagen (Col17a) 2 and fetal bovine serum (BSA) on the proliferation rate of human hair follicle stem cells in the performance test of the present invention;

[0057] Figure 8 This is a graph showing the effects of recombinant human XVII collagen (Col17a) 2 and fetal bovine serum (BSA) on the proliferation rate of human fibroblasts in the performance test of the present invention. DETAILED DESCRIPTION

[0058] The present invention is further described below in conjunction with preferred embodiments. The endpoints of the ranges disclosed in the present invention and any values ​​are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, and these numerical ranges should be deemed to be specifically disclosed herein.

[0059] The experimental methods in the following examples, unless otherwise specified, are conventional methods and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions.

[0060] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0061] In the following examples, the gene fragment (Col17a) 2 and the FMD promoter fragment were fully synthesized by GenScript Biopharmaceuticals Co., Ltd.

[0062] Example 1

[0063] This embodiment provides a method for constructing a recombinant plasmid pPIC9K-(Col17a)n expressing highly biologically active recombinant human XVII collagen, and the preparation method thereof is as follows:

[0064] (1) The cloned collagen (Col17a) 2, FMD promoter fragment and expression vector pPIC9K fragment were mixed at a concentration ratio of 3:4:1 by PCR technology;

[0065] (2) The cloned collagen fragment, promoter and pPIC9K vector backbone fragment were connected using Gibson Assembly seamless connection technology to construct the recombinant plasmid pPIC9K-(Col17a)2;

[0066] (3) The ligation mixture was incubated in a 50°C metal bath for 1 h, and then transformed into Escherichia coli DH5α competent cells by heat shock method. After overnight incubation at 37°C, positive single clones grown on plates containing sodium ampicillin and kanamycin were picked and preliminarily verified by colony PCR using verification primers Col17a-F / R;

[0067] The nucleotide sequences of the primers are as follows:

[0068] Col17a-F: atgagatttccttcaatttttactgcagt;

[0069] Col17a-R:gaattaattcgcggccgcttaaccaggtggacctggg;

[0070] pPIC9K-F: gcggccgcgaattaattcgcctta;

[0071] pPIC9K-R:gtttgcgtttagatacatttcgaataataactgttatt;

[0072] FMD-F: aatgtatctaaacgcaaactccgag;

[0073] FMD-R: aaattgaaggaaatctcatgatttgattgatgaaggc;

[0074] (4) The successfully verified single colony was inoculated in a 5 mL LB test tube and cultured at 37°C for 16 h. The plasmid was extracted and sequenced to confirm that the recombinant gene was consistent with the design.

[0075] Example 2

[0076] This embodiment provides a method for preparing a recombinant genetic engineering strain of Pichia pastoris that secretes and expresses a recombinant human XVII collagen with high biological activity, comprising the following steps:

[0077] (1) The bacterial liquid of Pichia pastoris GS115 was streaked on a YPD plate for activation, and cultured in a 30°C incubator until a single colony grew out. A single colony was picked and inoculated into 5 mL of YPD liquid culture medium, and cultured at 30°C and 220 rpm for 18 h to obtain Pichia pastoris GS115 electroporated competent cells;

[0078] (2) Inoculate 1‰ of the GS115 competent bacterial solution into 50 mL YPD and culture until the OD600 reaches 1.4. Collect the bacterial solution and centrifuge it at 4°C and 5000 rpm for 5 min. Discard the supernatant and repeat twice. Resuspend the bacterial cells in 1 M / L D-sorbitol solution and dispense into small aliquots at 100 μL / tube.

[0079] (3) Take 1 μg of the linearized plasmid pPIC9K-(Col17a)2 fragment and mix it with 100 μL of GS115 yeast competent bacterial solution. After mixing, quickly transfer it to a 0.2 cm pre-cooled electric spin cuvette and place it on ice for 5 min;

[0080] (4) Setting the electroporation parameters: electroporation voltage 2 kV, capacitance 25 μF, resistance 200 Ω, electroporation time 5 msec, and electroporation in an electroporation cup to allow the recombinant plasmid fragment to enter the competent cell P. pastoris GS115;

[0081] (5) Immediately after the electroporation, add 650 μL of pre-cooled 1 M sorbitol solution to the electroporation cup. Gently blow to mix the bacterial solution and quickly transfer it to a 1.5 mL centrifuge tube. Place it in a 30°C constant temperature incubator and culture it for 1.5 h.

[0082] (6) Take 100 μL of bacterial solution and spread it on the MD plate, invert it and culture it in a 30°C constant temperature incubator for 3 days until a single colony appears on the plate. Pick a single colony for culture, extract the genome for PCR verification and sequencing to verify whether the transformation is successful;

[0083] (4) The recombinant bacteria verified by sequencing were transfected onto YPD plates with a G418 concentration of 2 mg / ml for high-copy recombinant strain screening, and the recombinant bacteria that could grow on the high-concentration G418 plates were selected for activation and then maintained to obtain a Pichia pastoris recombinant genetically engineered strain that could secrete and express highly biologically active recombinant human XVII collagen.

[0084] Example 3

[0085] This embodiment provides a method for secreting and expressing recombinant human XVII collagen with high biological activity, comprising the following steps:

[0086] (1) A single colony of a Pichia pastoris recombinant genetically engineered strain capable of expressing highly biologically active recombinant human collagen XVII was inoculated into 5 mL of YPD liquid medium and cultured overnight at 30° C. and 220 rpm for activation;

[0087] (2) Transfer the overnight activated bacterial solution to 5 mL of BMGY liquid medium at a 1% inoculum volume, culture at 30°C, 220 rpm for 24 h, and collect the bacterial cells by centrifugation at 4°C, 5000 rpm for 10 min;

[0088] (3) Suspending the collected bacteria by centrifugation in 50 mL of BMMY liquid medium and fermenting them at 30°C and 220 rpm, adding methanol at a final concentration of 0.7% to the culture medium every 24 h to induce expression;

[0089] (4) After 96 h of induction, the bacterial culture was centrifuged at 4°C, 12,000 rpm for 10 min, and the supernatant was collected for SDS-PAGE protein electrophoresis to verify the protein expression.

[0090] The experimental results are shown in Figure 2 :M:Marker lane 1 is the supernatant of recombinant collagen (Col17a) 2 fermented for 24 hours, lane 2 is the supernatant of recombinant collagen (Col17a) 2 fermented for 48 hours, lane 3 is the supernatant of recombinant collagen (Col17a) 2 fermented for 72 hours, lane 4 is the supernatant of recombinant collagen (Col17a) 2 fermented for 96 hours. The molecular weight of recombinant collagen (Col17a) 2 protein is between 30kDa-40kDa, which is consistent with the theoretical molecular weight of (Col17a) 2 protein of 38kDa.

[0091] Performance Testing

[0092] 1. Cell Adhesion Assay

[0093] Human hair follicle stem cells and human fibroblasts were used as experimental cells, and the ability of recombinant human XVII collagen (Col17a) 2 and BSA to promote cell adhesion was detected by centrifugation method.

[0094] The results are as follows Figure 3 and 4 As shown, it can be seen that recombinant human type XVII collagen (Col17a) 2 exhibits a better ability to promote cell adhesion than BSA. In the cell adhesion ability test of human hair follicle stem cells and human fibroblasts, compared with BSA, recombinant human type XVII collagen (Col17a) 2 increased by 3.6 times and 2.5 times.

[0095] 2. Cell migration assay

[0096] Human hair follicle stem cells and human fibroblasts were used as experimental cells. The cell migration movement was determined by cell scratch method to detect the ability of recombinant human type XVII collagen (Col17a) 2 and BSA to promote cell migration.

[0097] The results are as follows Figure 5 and 6As shown, it can be seen that recombinant type XVII collagen (Col17a) 2 exhibits a better ability to promote cell migration than BSA. In the cell migration assay of human hair follicle stem cells and human fibroblasts, compared with BSA, recombinant human type XVII collagen (Col17a) 2 increased by 2.9 times and 3.1 times.

[0098] 3. Cell proliferation assay

[0099] Human hair follicle stem cells and human fibroblasts were used as experimental cells, and the MTT method was used to detect the ability of recombinant human type XVII collagen and BSA to promote cell proliferation.

[0100] The results are as follows Figure 7 and 8 As shown, it can be seen that recombinant type XVII collagen exhibits a better ability to promote cell proliferation than BSA. In the cell proliferation assay of human hair follicle stem cells and human fibroblasts, compared with BSA, recombinant human type XVII collagen (Col17a) 2 increased by 3.1 times and 1.8 times.

[0101] It should be noted that, in this article, relational terms such as "first" and "second" are only used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any such actual relationship or order between these entities or operations. The terms "include", "comprises" or any other variants thereof are intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or device. In the absence of further restrictions, the elements defined by the sentence "comprises a ..." do not exclude the presence of other identical elements in the process, method, article or device including the elements.

[0102] The above are only preferred embodiments of the present application and do not constitute any form of limitation to the present application. Any technician familiar with the profession can make some changes or modify the technical contents disclosed above into equivalent embodiments with equivalent changes without departing from the scope of the technical solution of the present application. However, any simple modification, equivalent change and modification made to the above embodiments based on the technical essence of the present application without departing from the content of the technical solution of the present application still fall within the scope of the technical solution of the present application.

Claims

1. A method for preparing recombinant human type XVII collagen with high biological activity, characterized in that: The following steps are involved: S1. Analyze the amino acid sequence of the α1 chain of human type XVII collagen, select some amino acid fragments in the non-transmembrane region of different functional domains of the protein that are not easily degraded by endogenous or exogenous proteases, repeatedly splice the selected fragments to obtain a recombinant collagen gene fragment (Col17a)n, and introduce orthologous promoters from different methylotrophic yeasts before recombining the collagen, and optimize the synthesis of the selected (Col17a)n and promoter fragments; S2. The connection fragments were obtained by PCR cloning, and then the collagen fragment (Col17a)n, the promoter fragment and the pPIC9K vector backbone fragment were connected by Gibson Assembly seamless connection technology to construct the recombinant plasmid pPIC9K-(Col17a)n; S3. Preparation of competent Pichia pastoris cells P. pastoris GS115 and expression of recombinant human type XVII collagen protein using pPIC9K-(Col17a)n.

2. The method for preparing a highly biologically active recombinant human type XVII collagen according to claim 1, characterized in that: In the recombinant collagen gene fragment (Col17a)n in S1, Col17a is the amino acid sequence shown in SEQ ID NO.1, or an amino acid sequence modified to a certain extent by amino acid replacement, insertion, substitution, addition or deletion on the basis of SEQ ID NO.1, or an amino acid sequence having greater than 80% homology with the amino acid sequence of SEQ ID NO.1; n is an integer greater than or equal to 1.

3. The method for preparing a highly biologically active recombinant human type XVII collagen according to claim 1, characterized in that: The orthologous promoter in S1 is the AOX1 promoter from Pichia pastoris or the FMD promoter from Hansenula polymorpha; the nucleotide sequence of the FMD promoter is shown in SEQ ID NO.

2.

4. The method for preparing a highly biologically active recombinant human type XVII collagen according to claim 1, characterized in that: The PCR cloning in S2 comprises the following steps: S2-1, using PCR technology to perform PCR cloning on the expression vector pPIC9K, collagen fragment and promoter fragment to obtain a connection fragment, and the cloned collagen, promoter and expression vector pPIC9K fragment were mixed at a concentration ratio of 3:4:1; S2-2, using Gibson Assembly seamless connection technology to connect the collagen fragment, promoter and pPIC9K vector backbone fragment obtained in S21 to construct the recombinant plasmid pPIC9K-(Col17a)n; S2-3. Incubate the ligation mixture in a metal bath, then transform the ligation mixture into Escherichia coli DH5α competent cells by heat shock method. After overnight culture at 37°C, pick the positive single clones grown on the plate containing sodium ampicillin and kanamycin for preliminary verification by colony PCR. The successfully verified single colony is inoculated in a 5mL LB test tube for culture, and the plasmid is extracted and sequenced to confirm that the recombinant gene is consistent with the design.

5. The method for preparing a highly biologically active recombinant human type XVII collagen according to claim 4, characterized in that: The primers verified in S2-3 are Col17a-F / R.

6. The method for preparing a highly biologically active recombinant human type XVII collagen according to claim 1, characterized in that: The preparation of GS115 competent cells and the expression of pPIC9K-(Col17a)n in S3 include the following steps: S3-1. Preparation of electroporation competent cells: Activate GS115 bacterial liquid by streaking on a YPD plate and culture in an incubator until a single colony grows. Pick a single colony and inoculate it into 5 mL YPD liquid medium for culture. Then inoculate the seed liquid into 50 mL YPD medium at an inoculum volume of 1‰. Collect the bacterial liquid and centrifuge it. Discard the supernatant. Repeat the operation, resuspend the bacteria with D-sorbitol solution and dispense into small portions at 100 μL / tube. S3-2, take the linearized recombinant plasmid pPIC9K-(Col17a)n fragment and mix it with the competent cells of Pichia pastoris GS115, and then quickly transfer it to an electroporation cup for electroporation transformation to allow the recombinant plasmid fragment to enter the competent cells of P. pastoris GS115; S3-3, spread the transformed competent cells P. pastoris GS115 on the MD plate and invert it in a constant temperature incubator for culture until a single colony appears on the plate, pick a single colony for culture, extract the genome for PCR verification, and then sequence to verify whether the transformation is successful; S3-4, the recombinant bacteria verified by sequencing were respectively transfected on YPD plates with a G418 concentration of 500 μg / ml-4 mg / ml to screen for high-copy recombinant strains, and the recombinant bacteria that can grow on the high-concentration G418 plates were selected for activation and then maintained; S3-5, transfer the activated recombinant bacteria in S3-4 to new YPD liquid medium for overnight culture; S3-6, transfer the overnight activated bacterial solution to 5 mL of BMGY liquid culture medium with an inoculum volume of 1% and collect the bacterial cells by centrifugation, then suspend the collected bacterial cells by centrifugation in 50 mL of BMMY liquid culture medium and ferment and culture, add methanol with a final concentration of 0.5-1% to the culture medium every 24 hours to induce expression; S3-7. After 96 hours of induction, the culture medium was centrifuged and the supernatants at 24 hours, 48 ​​hours, 72 hours and 96 hours of induction were collected for SDS-PAGE protein electrophoresis to verify the expression of highly bioactive recombinant human type XVII collagen.

7. The method for preparing a highly biologically active recombinant human type XVII collagen according to claim 6, characterized in that: The electric shock conversion parameters in S3-2 are as follows: electric shock voltage 2kV, capacitance 25μF, resistance 200Ω, and electric shock time 5msec.

8. The method for preparing a highly biologically active recombinant human type XVII collagen according to claim 6, characterized in that: After the electric shock in S3-2 is completed, the pre-cooled sorbitol solution is immediately added to the electroporation cup, gently blown to mix, and then quickly transferred to a centrifuge tube, and placed in a 30°C constant temperature incubator for static culture.

9. A recombinant human type XVII collagen with high biological activity obtained by the preparation method according to any one of claims 1 to 8.

10. Use of the highly bioactive recombinant human type XVII collagen as claimed in claim 9 in promoting tissue regeneration and hair follicle repair and regeneration.

Images