Prostate cancer stem cell culture medium, culture method and application

Abstract

The invention provides a prostate cancer stem cell culture medium, a culture method and application, and relates to the technical field of biomedicine. The additives comprise the following components in the basal culture medium in concentration: 1-3% (v / v) of fetal calf serum, 1 * N2, 1 * B-27, 10-50 ng / ml of EGF, 10-50 ng / ml of bFGF, 1-10 nM of androgen DHT, 20-100 [mu] M of ascorbic acid, 0.02-3 [mu] M of a GSK3 inhibitor, 0.1-20 [mu] M of a TGF-beta inhibitor and 0.1-20 [mu] M of a ROCK inhibitor. The primary prostatic cancer stem cells separated from the prostatic cancer tissue block can be well proliferated in vitro, and the biological characteristics of the prostatic cancer stem cells are reserved. The amplified prostate cancer stem cells can be transplanted into the body of an immunodeficient mouse to construct a tumor xenotransplantation model. Compared with a method for directly transplanting tumor tissue blocks, the method for transplanting the amplified prostate cancer stem cells can improve the xenotransplantation success rate.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to a prostate cancer stem cell culture medium, a culture method and an application thereof. Background Art

[0002] Prostate cancer is a common male malignancy, most of which are adenocarcinomas with luminal cell characteristics. Prostate cancer research models mainly include animal models, prostate cancer cell lines, and human tumor xenograft models (PDX). These models have their own advantages and disadvantages. Although animal models are easy to genetically modify, the experimental results obtained using animal models are often not applicable to clinical practice due to certain differences in the physiology, pathology, and genome between animals and humans; prostate cancer cell lines are relatively easy to culture, but they are quite different from the original tumors and are difficult to reflect the biological characteristics of the original tumors and individual differences among patients; PDX models are the gold standard for tumor research and drug screening. The existing conventional operating method is to directly inoculate a small amount of human tumor tissue blocks obtained from the clinic into immunodeficient mice, and the generated tumor tissue is used for drug screening. However, due to the small size of prostate cancer puncture samples, it is difficult to generate tumor tissue in immunodeficient mice, resulting in a low success rate of PDX models of prostate cancer. In addition, it is difficult to isolate a large number of prostate cancer stem cells from prostate cancer puncture tissues for laboratory research. Although there are reported methods for culturing prostate cancer cells, none of them can maintain their adenocarcinoma characteristics. For example, some researchers have reported methods for culturing luminal prostate stem cells in vitro. However, these prostate stem cells do not have the characteristics of cancer stem cells and are not tumorigenic. They need to be genetically modified to overexpress oncogenes before they have certain tumorigenicity. These genetic manipulations change the genome of the original tumor cells, making them unsuitable for personalized precision medicine.

[0003] Prostate cancer stem cells are an important source of castration resistance and drug resistance in prostate cancer. Studying the biological characteristics of prostate cancer stem cells is conducive to developing targeted treatment strategies and improving treatment effects. However, it is currently difficult to culture prostate cancer stem cells with adenocarcinoma characteristics in vitro, and this bottleneck limits the development of prostate cancer drugs.

[0004] In view of this, the present invention is proposed. Summary of the invention

[0005] One of the purposes of the present invention is to provide a prostate cancer stem cell culture medium to solve the technical problem in the prior art that it is difficult to separate a large number of prostate cancer stem cells from the punctured tissue of prostate cancer using the prostate cancer stem cell culture medium.

[0006] A second objective of the present invention is to provide a method for culturing prostate cancer stem cells to solve the technical problem in the prior art that cultured prostate cancer stem cells cannot maintain adenocarcinoma characteristics.

[0007] A third object of the present invention is to provide the use of the above-mentioned prostate cancer stem cell culture medium or the above-mentioned culture method in constructing a tumor primary cell xenograft model.

[0008] A fourth object of the present invention is to provide a method for constructing a primary tumor cell xenograft model.

[0009] In order to achieve the above-mentioned purpose of the present invention, the following technical solutions are particularly adopted:

[0010] In a first aspect, the present invention provides a prostate cancer stem cell culture medium, comprising a basal culture medium and an additive, wherein the additive comprises the following components in the basal culture medium: 1-3% (v / v) fetal bovine serum, 1xN2, 1xB-27, 10-50 ng / ml EGF, 10-50 ng / ml bFGF, 1-10 nM androgen DHT, 20-100 μM ascorbic acid, 0.02-3 μM GSK3 inhibitor, 0.1-20 μM TGF-β inhibitor and 0.1-20 μM ROCK inhibitor;

[0011] The basic culture medium includes DMEM / F12, DMEM or RPMI-1640.

[0012] Further, the GSK3 inhibitor includes Chir99021, AZD1080 or LY2090314, preferably Chir99021;

[0013] Preferably, the TGF-β inhibitor includes A83-01, RepSox or GW788388, preferably A83-01;

[0014] Preferably, the ROCK inhibitor comprises Y27632, RKI-1447 or GSK269962A, preferably Y27632.

[0015] Furthermore, the additives also include penicillin at a concentration of 100 U / ml and streptomycin at a concentration of 100 μg / ml in the basal culture medium.

[0016] In a second aspect, the present invention provides a method for culturing prostate cancer stem cells, comprising culturing prostate cancer stem cells from primary prostate cancer stem cells separated from prostate cancer tissue blocks using the above-mentioned culture medium.

[0017] Furthermore, the method for preparing primary prostate cancer stem cells separated from prostate cancer tissue blocks comprises digesting the prostate cancer tissue blocks in digestion solution I to separate and obtain primary prostate cancer stem cells;

[0018] Preferably, the step of culturing the primary prostate cancer stem cells separated from the prostate cancer tissue block to obtain the prostate cancer stem cells comprises: when the primary prostate cancer stem cells are cultured to 80-90% adherent to the wall, sequentially adding a buffer solution and a digestion solution II, collecting the cell suspension by centrifugation, collecting the cell precipitate, adding a culture medium to resuspend the cell precipitate, and then performing subculture;

[0019] Preferably, the subculture generation number is ≤4 generations.

[0020] Furthermore, the method of digesting the prostate cancer tissue block in digestion solution I to separate and obtain primary prostate cancer stem cells is a cyclic digestion method;

[0021] Preferably, the cyclic digestion method comprises the following steps:

[0022] A. Add 1-5 ml of digestion solution I to the tumor puncture tissue block, remove the digestion solution I containing the digested cells every 10-20 minutes, collect the cell pellet, add culture medium to resuspend it and store it for later use, and add new digestion solution I to the remaining tissue block;

[0023] B. Repeat step A until all tissue blocks are digested;

[0024] Preferably, the digestion condition is 36-38°C digestion, preferably 37°C digestion;

[0025] Preferably, the storage temperature is 2-8°C.

[0026] Furthermore, the digestive solution I comprises a basal culture medium, collagenase, ascorbic acid and a ROCK inhibitor;

[0027] Preferably, the collagenase is type I collagenase or type II collagenase, preferably type I collagenase;

[0028] Preferably, the concentration of the collagenase in the basal medium is 1 to 3 mg / ml, preferably 2 mg / ml;

[0029] Preferably, the concentration of ascorbic acid in the basal culture medium is 20-100 μM, preferably 50 μM.

[0030] Preferably, the concentration of the ROCK inhibitor in the basal culture medium is 0.1-20 μM, preferably 5 μM.

[0031] Preferably, the ROCK inhibitor includes Y27632, RKI-1447 or GSK269962A, preferably Y27632.

[0032] Furthermore, the culture conditions include culturing at an ambient temperature of 37° C. and a humidity of 95% for at least 1 week.

[0033] In a third aspect, the present invention provides the use of the above-mentioned culture medium or the above-mentioned culture method in constructing a primary tumor cell xenograft model.

[0034] In a fourth aspect, the present invention provides a method for constructing a primary tumor cell xenograft model, characterized in that it comprises: mixing the prostate cancer stem cells obtained by the culture method of any one of claims 4 to 8 with matrix gel and then transplanting them into immunodeficient mice to obtain a primary tumor cell xenograft model;

[0035] Preferably, the cell density of the prostate cancer stem cells is 500,000 to 1,000,000 cells / 100 μl of matrix gel;

[0036] Preferably, the transplant volume is 50-200 μl, preferably 100 μl.

[0037] The present invention provides a prostate cancer stem cell culture medium, which promotes anabolism, iron ion transport, anti-oxidation, and cell proliferation in prostate cancer stem cells by adding 1xN2 and 1xB-27, and regulates cell growth and proliferation by cooperating with growth factors (EGF and bFGF); hormones can affect the interaction between cells and between cells and culture medium in the prostate cancer stem cell culture microenvironment, and promote the growth and proliferation of prostate cancer stem cells; ascorbic acid has a certain effect on the activity and growth of prostate cancer stem cells; GSK3 inhibitors, TGF-β inhibitors, and ROCK inhibitors can synergistically promote the proliferation and stemness maintenance of prostate cancer stem cells, and have a positive regulatory and promoting effect on the separation of prostate cancer stem cells. By adding 1xN2, 1xB-27, EGF, bFGF, hormones, ascorbic acid, GSK3 inhibitors, TGF-β inhibitors, and ROCK inhibitors within a certain range in the basic culture medium, the growth and proliferation of prostate cancer stem cells can be promoted, and prostate cancer stem cells can be separated from small pieces of punctured tissue of prostate cancer and cultured in vitro by amplification, and because the additives have the effect of regulating the cell culture microenvironment, the proliferating cells can better retain the biological characteristics of prostate cancer stem cells. The technical problem of the difficulty of isolating a large number of prostate cancer stem cells from the puncture tissue of prostate cancer is solved. On the other hand, the method of culturing prostate cancer stem cells using the culture medium enables prostate cancer stem cells to maintain the characteristics of adenocarcinoma. It can be used to construct a primary cell xenograft model (PrDX) to improve the success rate of xenograft. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0039] Figure 1 A statistical diagram of the number of prostate cancer stem cells cultured in different culture media provided in Experiment 1 of the present invention;

[0040] Figure 2 This is a statistical diagram of the number of dead cells in the digestion suspension obtained by different digestion methods provided in Experiment 2 of the present invention;

[0041] Figure 3 This is a statistical diagram of the number of dead cells in the digestion suspension obtained by treating with different digestion solutions provided in Experiment 3 of the present invention;

[0042] Figure 4 This is a statistical diagram of the number of dead cells in the digestion suspension obtained by treating with different digestion solutions provided in Experiment 4 of the present invention;

[0043] Figure 5 This is a microscopic observation of the morphology of prostate cancer stem cells provided in Experiment 5 of the present invention;

[0044] Figure 6 Laser confocal microscopic imaging of immunofluorescence staining of prostate cancer stem cells provided in Experiment 5 of the present invention;

[0045] Figure 7 This is a statistical graph of the key gene expression levels of prostate cancer stem cells provided in Experiment 5 of the present invention;

[0046] Figure 8 This is an immunoblot analysis of prostate cancer stem cells provided in Experiment 6 of the present invention;

[0047] Fig. 9 The protein quantitative statistical graph of the immunoblot analysis of prostate cancer stem cells provided in Experiment 6 of the present invention;

[0048] Fig.10 The statistical graph of prostate tumor tissue weight constructed under different transplantation amounts provided in Experiment 7 of the present invention;

[0049] Fig.11 A physical picture of the PrDX tumor constructed from prostate cancer stem cells provided in Experiment 7 of the present invention;

[0050] Fig.12 This is a laser confocal microscopic image of the PrDX tumor immunofluorescence staining constructed by prostate cancer stem cells provided in Experiment 7 of the present invention. DETAILED DESCRIPTION

[0051] Unless otherwise defined herein, scientific and technical terms used in conjunction with the present invention shall have the meanings commonly understood by those of ordinary skill in the art. The meaning and scope of the terms should be clear, however, in the case of any potential ambiguity, the definitions provided herein take precedence over any dictionary or external definitions. In this application, unless otherwise stated, the use of "or" means "and / or". In addition, the use of the term "including" and other forms is non-limiting.

[0052] The methods and techniques of the present invention are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification unless otherwise indicated.

[0053] In one aspect, the present invention provides a prostate cancer stem cell culture medium, which is composed of a basal culture medium and an additive, wherein the additive includes the following components in the basal culture medium at the following concentrations: 1-3% (v / v) fetal bovine serum, 1xN2, 1xB-27, 10-50 ng / ml EGF, 10-50 ng / ml bFGF, 1-10 nM androgen DHT, 20-100 μM ascorbic acid, 0.02-3 μM GSK3 inhibitor, 0.1-20 μM TGF-β inhibitor and 0.1-20 μM ROCK inhibitor;

[0054] The basic culture medium includes DMEM / F12, DMEM or RPMI-1640.

[0055] By adding 1xN2 and 1xB-27, the anabolism, iron ion transport, anti-oxidation and cell proliferation in prostate cancer stem cells are promoted, and the growth factors (EGF and bFGF) are used to regulate cell growth and proliferation; hormones can affect the interaction between cells and between cells and culture medium in the culture microenvironment of prostate cancer stem cells, and promote the growth and proliferation of prostate cancer stem cells; ascorbic acid has a certain effect on the activity and growth of prostate cancer stem cells; GSK3 inhibitors, TGF-β inhibitors and ROCK inhibitors can synergistically promote the proliferation and stemness maintenance of prostate cancer stem cells, and have a positive regulatory effect on the separation of prostate cancer stem cells. By adding a certain amount of 1xN2, 1xB-27, EGF, bFGF, hormones, ascorbic acid, GSK3 inhibitors, TGF-β inhibitors and ROCK inhibitors in the basic culture medium, the growth and proliferation of prostate cancer stem cells can be promoted, and prostate cancer stem cells can be separated from small pieces of prostate cancer puncture tissue and cultured in vitro. Because the additives have the function of regulating the cell culture microenvironment, the proliferating cells can better retain the biological characteristics of prostate cancer stem cells. The technical problem of the difficulty in isolating a large number of prostate cancer stem cells from the punctured tissue of prostate cancer has been solved.

[0056] The concentration of the fetal bovine serum may be, but is not limited to, 1%, 1.2%, 1.5%, 1.8%, 2%, 2.2%, 2.5%, 2.8% or 3%, or any value between 1% and 3%.

[0057] The concentration of EGF can be but is not limited to 10ng / ml, 15ng / ml, 20ng / ml, 25ng / ml, 30ng / ml, 35ng / ml, 40ng / ml, 45ng / ml or 50ng / ml, and can also be any concentration value between 10 and 50ng / ml.

[0058] The concentration of bFGF can be, but is not limited to, 10 ng / ml, 15 ng / ml, 20 ng / ml, 25 ng / ml, 30 ng / ml, 35 ng / ml, 40 ng / ml, 45 ng / ml or 50 ng / ml, or any concentration value between 10 and 50 ng / ml. The concentration of androgen DHT can be, but is not limited to, 1 nM, 2 nM, 3 nM, 4 nM, 5 nM, 6 nM, 7 nM, 8 nM, 9 nM or 10 nM, or any solubility value between 1 and 10 nM.

[0059] The concentration of ascorbic acid may be, but is not limited to, 20 μM, 30 μM, 40 μM, 50 μM, 60 μM, 70 μM, 80 μM, 90 μM or 100 μM, and may be any concentration value between 20 and 100 μM.

[0060] The concentration of the GSK3 inhibitor may be, but is not limited to, 0.02 μM, 0.05 μM, 0.1 μM, 0.15 μM, 0.2 μM, 0.25 μM or 0.3 μM, or any value between 0.02 and 3 μM.

[0061] The concentration of the TGF-β inhibitor may be, but is not limited to, 0.1 μM, 2 μM, 4 μM, 6 μM, 8 μM, 10 μM, 12 μM, 14 μM, 16 μM, 18 μM or 20 μM, or any concentration value between 0.1 and 20 μM.

[0062] In some specific embodiments, the GSK3 inhibitor comprises Chir99021, AZD1080 or LY2090314.

[0063] When the GSK3 inhibitor is Chir99021, its concentration is preferably 1-3 μM; when the GSK3 inhibitor is AZD1080, its concentration is preferably 0.2-2 μM; when the GSK3 inhibitor is LY2090314, its concentration is preferably 0.02-0.2 μM. The GSK3 inhibitor is preferably Chir99021.

[0064] In some specific embodiments, the TGF-β inhibitor comprises A83-01, RepSox or GW788388.

[0065] When the TGF-β inhibitor is A83-01, its concentration is preferably 0.1-1 μM; when the TGF-β inhibitor is RepSox, its concentration is preferably 2-20 μM; when the TGF-β inhibitor is GW788388, its concentration is preferably 2-20 μM. The TGF-β inhibitor is preferably A83-01.

[0066] In some specific embodiments, the ROCK inhibitor includes Y27632, RKI-1447 or GSK269962A.

[0067] When the ROCK inhibitor is Y27632, its concentration is preferably 1 to 20 μM; when the ROCK inhibitor is RKI-1447, its concentration is preferably 0.1 to 10 μM; when the ROCK inhibitor is GSK269962A, its concentration is preferably 1 to 10 μM. The ROCK inhibitor is preferably Y27632.

[0068] In some specific embodiments, the supplement further comprises 100 U / ml penicillin and 100 μg / ml streptomycin in the basal medium.

[0069] According to another aspect of the present invention, a method for culturing prostate cancer stem cells is provided, comprising using the above-mentioned culture medium to culture prostate cancer stem cells from primary prostate cancer stem cells separated from prostate cancer tissue blocks.

[0070] Experiments have shown that the use of the above-mentioned culture medium can expand and culture prostate cancer stem cells in primary prostate cancer stem cells, and the prostate cancer stem cells obtained by culture can maintain their adenocarcinoma characteristics, thereby solving the technical problem that the cultured prostate cancer stem cells in the prior art cannot maintain adenocarcinoma characteristics.

[0071] In some specific embodiments, the method for preparing primary prostate cancer stem cells isolated from prostate cancer tissue blocks comprises digesting the prostate cancer tissue blocks in digestion solution I to isolate primary prostate cancer stem cells.

[0072] In some specific embodiments, the method of culturing prostate cancer stem cells from primary prostate cancer stem cells isolated from prostate cancer tissue blocks includes adding buffer and digestion solution II in sequence when the primary prostate cancer stem cells are cultured to 80-90% adherence, collecting the cell suspension by centrifugation, collecting the cell precipitate, adding prostate cancer stem cell culture medium to resuspend, and then subculturing.

[0073] In some specific embodiments, the subculture generation number is ≤4 generations.

[0074] In some specific embodiments, the method of digesting the prostate cancer tissue block in digestion solution I to separate and obtain primary prostate cancer stem cells is a cyclic digestion method;

[0075] Preferably, the cyclic digestion method comprises the following steps:

[0076] A. Add 1-5 ml of digestion solution I to the tumor puncture tissue block, take out the digestion solution I containing the digested cells every 10-20 minutes, collect the cell suspension, centrifuge to obtain the cell pellet, add culture medium to resuspend and store for later use, and add new digestion solution I to the remaining tissue block;

[0077] B. Repeat step A until all tissue blocks are digested;

[0078] The cyclic digestion method is used for digestion to reduce the treatment time of cells in the digestive enzyme and improve cell activity, so as to improve the success rate of prostate cancer stem cell isolation and culture.

[0079] In some specific embodiments, the digestion condition is 36-38°C digestion, preferably 37°C digestion.

[0080] The digestion can be carried out in an incubator set at 36-38°C, or in a water bath set at 36-38°C.

[0081] In some specific embodiments, the storage temperature is 2-8°C.

[0082] In some specific embodiments, the digestion solution I comprises basal culture medium, collagenase, ascorbic acid and ROCK inhibitor.

[0083] In some specific embodiments, the collagenase is type I collagenase or type II collagenase, preferably type I collagenase.

[0084] In some specific embodiments, the concentration of the collagenase in the basal culture medium is 1-3 mg / ml.

[0085] The concentration of type I collagenase in the basal culture medium may be, but is not limited to, 1 mg / ml, 1.2 mg / ml, 1.4 mg / ml, 1.6 mg / ml, 1.8 mg / ml, 2 mg / ml, 2.2 mg / ml, 2.4 mg / ml, 2.6 mg / ml, 2.8 mg / ml or 3 mg / ml, and may be any concentration value between 1 and 3 mg / ml, preferably 2 mg / ml.

[0086] In some specific embodiments, the concentration of the ROCK inhibitor in the basal culture medium is 0.1-20 μM.

[0087] The concentration of the ROCK inhibitor in the basal culture medium may be any concentration value, but is not limited to, 0.1 μM, 1 μM, 2 μM, 4 μM, 6 μM, 8 μM, 10 μM, 12 μM, 14 μM, 16 μM, 18 μM or 20 μM, or any concentration value between 0.1 and 20 μM, preferably 5 μM.

[0088] In some specific embodiments, the ROCK inhibitor includes Y27632, RKI-1447 or GSK269962A, preferably Y27632.

[0089] In some specific embodiments, the concentration of ascorbic acid in the basal culture medium is 20-100 μM, preferably 50 μM.

[0090] In some specific embodiments, the culture conditions include culturing at an ambient temperature of 37° C. and a humidity of 95% for at least 1 week.

[0091] According to another aspect of the present invention, there is also provided the use of the above culture medium or the above culture method in constructing a primary tumor cell xenograft model.

[0092] According to another aspect of the present invention, a method for constructing a primary tumor cell xenograft model is also provided, comprising mixing prostate cancer stem cells cultured by the above-mentioned culture method with matrix gel and then transplanting the mixture into immunodeficient mice to obtain a primary tumor cell xenograft model.

[0093] Experiments have shown that prostate cancer stem cells isolated and cultured from prostate cancer puncture tissue using the above culture medium or the above culture method can form prostate tumor tissue after being transplanted into immunodeficient mice, that is, a tumor primary cell xenograft model (PrDX model), which has a high tumorigenicity. Compared with the method of directly transplanting tumor tissue blocks, the xenograft success rate can be improved.

[0094] The present invention refers to this model as a primary cell xenograft model, patient primary cell-derived xenograft, abbreviated as PrDX.

[0095] In some specific embodiments, the cell density of the prostate cancer stem cells is 500,000 to 1,000,000 cells / 100 μl of matrix gel.

[0096] In some specific embodiments, the transplant volume is 50-200 μl, preferably 100 μl.

[0097] In some specific embodiments, the prostate cancer stem cells are transplanted into immunodeficient mice and cultured for up to 4 weeks.

[0098] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0099] The reagents used in the following examples are as follows:

[0100] DMEM / F12, DMEM, RPMI-1640, fetal bovine serum, penicillin, and streptomycin were purchased from Shanghai Yuanpei Biotechnology Co., Ltd.;

[0101] N2 and B-27: purchased from Gibco;

[0102] EGF and bFGF: purchased from Peprotech;

[0103] DHT: purchased from Selleck;

[0104] GSK3 inhibitor, TGF-β inhibitor and ROCK inhibitor were purchased from Selleck;

[0105] Ascorbic acid: purchased from Sigma;

[0106] Type I and type II collagenase: purchased from Worthington;

[0107] Digestion solution I: basal medium, 1-3 mg / ml type I collagenase, 10-100 μM ascorbic acid, and 4-6 μM ROCK inhibitor;

[0108] Digestive solution II: Accutase, purchased from Yisheng Company;

[0109] NCG immunodeficient mice were purchased from Jicui Pharmaceutical Co., Ltd.

[0110] Example 1

[0111] A prostate cancer stem cell culture medium comprises DMEM / F12, 2% fetal bovine serum, 100U / ml penicillin, 100μg / ml streptomycin, 1xN2, 1xB-27, 10ng / ml EGF, 10ng / ml bFGF, 10nM DHT, 50μM ascorbic acid, 2μM Chir99021, 0.2μM A83-01 and 10μM Y27632.

[0112] Example 2

[0113] A prostate cancer stem cell culture medium comprises DMEM / F12, 1% fetal bovine serum, 100U / ml penicillin, 100μg / ml streptomycin, 1xN2, 1xB-27, 8ng / ml EGF, 25ng / ml bFGF, 10nM DHT, 20μM ascorbic acid, 1μM Chir99021, 0.1μM A83-01 and 8μM Y27632.

[0114] Example 3

[0115] A prostate cancer stem cell culture medium comprises DMEM / F12, 3% fetal bovine serum, 100U / ml penicillin, 100μg / ml streptomycin, 1xN2, 1xB-27, 12ng / ml EGF, 50ng / ml bFGF, 1nM DHT, 100μM ascorbic acid, 3μM Chir99021, 0.3μM A83-01 and 12μM Y27632.

[0116] Comparative Example 1

[0117] Different from Example 1, N2 and B-27 were not added.

[0118] Comparative Example 2

[0119] Different from Example 1, the growth factors EGF and bFGF were not added.

[0120] Comparative Example 3

[0121] Different from Example 1, the hormone DHT was not added.

[0122] Comparative Example 4

[0123] Different from Example 1, no GSK3 inhibitor was added.

[0124] Comparative Example 5

[0125] Different from Example 1, no TGF-β inhibitor was added.

[0126] Comparative Example 6

[0127] Different from Example 1, no ROCK inhibitor was added.

[0128] Embodiments 4 to 6

[0129] Prostate cancer puncture tissues were obtained, and primary prostate cancer stem cells separated from the puncture tissues were cultured using the culture media of Examples 1 to 3 to obtain prostate cancer stem cells. The specific operation was carried out according to the following steps.

[0130] (1) Place the clinical prostate cancer biopsy specimen in digestion solution I and digest it in a 37°C incubator or water bath. The formula of digestion solution I is as follows: DMEM, 2 mg / ml type I collagenase, 50 μM ascorbic acid, and 5 μM Y27632.

[0131] (2) Digestion was performed using a cyclic digestion method. The specific process was as follows: During the digestion process, the tissue was gently shaken and gently aspirated with a pipette. The cell suspension was removed every 10 minutes, and the cell pellet was collected after centrifugation at 1000 rpm for 4 minutes and resuspended in PBS. New digestion solution was added to the remaining tissue blocks, and the above process was repeated until all tissue blocks were digested to obtain a cell suspension containing primary prostate cancer stem cells.

[0132] (3) All cell suspensions were pooled and divided into three groups, and the culture medium of Examples 1 to 3 was added respectively. The cells were cultured at 37° C. and 95% humidity. After one week, when the cell suspension reached 80% to 90%, subculture was performed.

[0133] (4) Cell subculture: Digest 80-90% of the cells cultured in the culture dish in step (3) using digestion solution II, collect the cells in a centrifuge tube, centrifuge at 1000 rpm for 4 minutes, collect the cell precipitate, add new culture medium to resuspend the cells, and culture them in a new culture dish. After one week of culture, prostate cancer stem cells are obtained.

[0134] Comparative Examples 7 to 12

[0135] The difference from Example 4 is that in step (3), all the cell suspensions are collected and divided into six groups, and the culture media of Comparative Examples 1 to 6 are added respectively.

[0136] Experiment 1

[0137] Take the prostate cancer stem cells obtained in Examples 4 to 6 and Comparative Examples 7 to 12, and count the cells using a cell counter. The specific steps are as follows: remove the culture medium, wash the cells once with PBS, add digestion solution II and digest in a 37°C incubator. After about 3 minutes, blow the culture dish with a pipette to collect the cells, centrifuge at 1000rpm to obtain a cell precipitate, add 1ml PBS to resuspend the cells, take out 10μl of the cell suspension, mix it with 10μl of trypan blue solution, take out 10μl of the suspension and add it to the cell counter, count the cells under a microscope, the cell bodies of live cells are transparent, and the dead cells absorb the trypan blue dye and their cell bodies turn dark blue. The results are as follows Figure 1 shown.

[0138] Depend on Figure 1 It can be seen that the number of prostate cancer stem cells obtained from the cell suspension containing primary prostate cancer stem cells in Examples 4 to 6 is more than that in Comparative Examples 7 to 12. It can be seen that N2 and B-27, growth factors (EGF and bFGF), androgen DHT, GSK3 inhibitors, TGF-β inhibitors and ROCK inhibition have a synergistic promoting effect on improving the ability of the culture medium to obtain prostate cancer stem cells from the cell suspension containing primary prostate cancer stem cells, which can preserve cell viability, improve cell proliferation ability, and increase the number of prostate cancer stem cells obtained.

[0139] Experiment 2

[0140] Clinical prostate cancer puncture samples were divided into two parts, and the digestion method used in Example 4 and the conventional digestion method of control group 1 were used respectively. The conventional digestion method of the control group included slight shaking during the digestion process and slight aspiration of the tissue with a pipette until all tissue blocks were digested. The digestion suspensions of Example 4 and control group 1 were taken, and the dead cells in the digestion suspensions were counted according to the cell counting method of Experiment 1. The specific results are as follows: Figure 2 Compared with control group 1, the cyclic digestion method can reduce the proportion of dead cells.

[0141] Experiment 3

[0142] A clinical prostate cancer puncture sample was divided into two parts and digested according to the digestion method of Example 4, except that one part was digested using the digestion solution I in Example 4, and the other part was digested using the digestion solution I of the control group 2. The specific formula of the digestion solution I of the control group 2 is as follows: DMEM, 2 mg / ml type I collagenase, and 50 μM ascorbic acid.

[0143] After digestion, the digestion suspensions of Example 4 and Control Group 2 were taken respectively, and the dead cells in the digestion suspensions were counted according to the cell counting method of Experiment 1. The specific results are as follows: Figure 3 As shown, the absence of Y27632 in the digestion solution I of the control group 2 increased the number of dead cells, while the use of the improved digestion solution I (Example 4) reduced the number of dead cells in the digestion suspension.

[0144] Experiment 4

[0145] A clinical prostate cancer biopsy specimen was divided into two portions and digested according to the digestion method of Example 4, except that one portion was digested using the digestion solution I in Example 4, and the other portion was digested using the digestion solution I of the control group 3. The specific formula of the digestion solution I of the control group 3 was as follows: DMEM, 2 mg / ml type I collagenase, and 5 μM Y27632.

[0146] After digestion, the digestion suspensions of Example 4 and Control Group 3 were taken respectively, and the dead cells in the digestion suspensions were counted according to the cell counting method of Experiment 1. The specific results are as follows: Figure 4 As shown, the absence of ascorbic acid in the digestion solution I of the control group 3 increased the number of dead cells, while the use of the improved digestion solution I (Example 4) reduced the number of dead cells in the digestion suspension.

[0147] Experiment 5: Observation of characteristics of intermediate stem cells

[0148] This experiment observed the prostate cancer stem cells cultured in Example 4.

[0149] 1. Use phase contrast microscopy to observe the morphology of prostate cancer stem cells. The results are as follows Figure 5 As shown, it can be seen that prostate cancer stem cells retain the typical epithelial cell morphology.

[0150] 2. Antibodies targeting the following proteins: CK8, AR, PSA, CK5, P63, SOX2, immunofluorescence staining of prostate cancer stem cells, DAPI labeling of cell nuclei, laser confocal microscopy imaging, the results are as follows Figure 6 As shown, it can be seen that prostate cancer stem cells express luminal cell markers CK8, AR and PSA; basal cell markers CK5 and P63; stem cell marker SOX2, and have the characteristics of intermediate prostate cancer stem cells.

[0151] 3. qPCR was used to analyze the expression of key genes related to prostate cancer stem cells, among which the key genes were AR, PSA, CK8, CK18, CK5, P63, IVL, CK4, CK13, PSCA and SOX2. PC-3, 22Rv1, LNCaP and VCaP cell lines were selected as control groups, respectively. The primers are shown in List 1.

[0152] Table 1

[0153] Gene Upstream primer Downstream primer AR GGAGGCGACAGAGGGAAAAA TTCACCGAAGAGGAAAGGGC PSA ACTCACAGCAAGGATGGAGC TCCCATGCCAAAGGAAGACC CK8 TCCTCAGGCAGCTATATGAAGAG GGTTGGCAATATCCTCGTACTGT CK18 TCGCAAATACTGTGGACAATGC GCAGTCGTGTGATATTGGTGT CK5 CCAAGGTTGATGCACTGATGG TGTCAGAGACATGCGTCTGC P63 GTCATTTGATTCGAGTAGAGGGG CTGGGGTGGCTCATAAGGT IVL TCCTCCAGTCAATACCCATCAG CAGCAGTCATGTGCTTTTCCT CK4 CTCTTTGAGACCTACCTCAGTGT GGCTGCTGTGCGTTTGTTG CK13 GACCGCCACCATTGAAAACAA TCCAGGTCAGTCTTAGACAGAG PSCA CTGAGGCACATCCTAACGCA TCAATAGAGCCGATCTGCCG SOX2 CCCCCGGCGGCAATAGCA TCGGVGCCGGGGAGATACAT

[0154] Specific results such as Figure 7 As shown, it can be seen that the prostate cancer stem cells cultured in Example 4 expressed relatively high levels of luminal cell, basal cell and stem cell marker genes, and had the characteristics of intermediate prostate cancer stem cells.

[0155] Experiment 6 Castration resistance test

[0156] By reducing the concentration of androgen (DHT) in the culture medium to simulate clinical endocrine therapy, the castration resistance of prostate cancer stem cells cultured and expanded under different hormone concentrations was analyzed using the immunoblotting method. The specific steps are as follows:

[0157] The androgen (DHT) concentrations in the culture medium were set to 10 nM, 1 nM, 0.1 nM and 0 nM, respectively. Prostate cancer stem cells were isolated, cultured and amplified according to the method of Example 4. After one week of culture, proteins were collected for immunoblot analysis. The specific results are shown in FIG. Figure 8 and Fig. 9 As shown, Fig. 9 Here A stands for AR and B stands for PSA.

[0158] It can be seen that the expression of AR and PSA in prostate cancer stem cells is upregulated, indicating that they are castration-resistant, which is similar to the development of clinical drug resistance.

[0159] Experiment 7: Verification of in vivo tumorigenicity

[0160] Nine male NCG immunodeficient mice were selected and randomly divided into three groups, with 3 mice in each group. The prostate cancer stem cells cultured in Example 4 were mixed with matrix gel at a cell concentration of 500,000 / 100 μl of matrix gel. 50 μl, 100 μl and 200 μl of the mixture of prostate cancer stem cells and matrix gel were injected subcutaneously into the immunodeficient mice, respectively, to observe the tumor formation.

[0161] After 4 weeks of culture, the tumor tissues were taken out for weighing and analysis. Fig.10As shown. It was found that prostate tumor tissue (PrDX) was generated in mice with different inhibition amounts, indicating that it has a high tumorigenicity. Among them, there was no significant difference between the transplantation volume of 100μl and 200μl, so 100μl was the optimal transplantation volume.

[0162] Prostate tumor tissue (PrDX) at a concentration of 500,000 / 100 μl was photographed. Fig.11 As shown. The frozen sections were sliced ​​and the cells were respectively labeled with antibodies targeting AR, PSA, and CK8, and the cell nuclei were marked with DAPI. The cells were observed by immunofluorescence staining and laser confocal microscopy, as shown. Fig.12 As shown, the scale bar is 100 μm. It can be seen that the tumor generated by prostate cancer stem cells after transplantation into the body has typical adenocarcinoma characteristics.

[0163] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A prostate cancer stem cell culture medium, characterized in that The invention is composed of a basic culture medium and an additive, wherein the additive is composed of the following components at the following concentrations: 1-3% (v / v) fetal bovine serum, 1xN2, 1xB-27, 10-50 ng / ml EGF, 10-50 ng / ml bFGF, 1-10 nM androgen DHT, 20-100 μM ascorbic acid, 0.02-3 μM GSK3 inhibitor, 0.1-20 μM TGF-β inhibitor and 0.1-20 μM ROCK inhibitor; The basic culture medium includes DMEM / F12, DMEM or RPMI-1640.

2. The prostate cancer stem cell culture medium according to claim 1, characterized in that The GSK3 inhibitor includes Chir99021, AZD1080 or LY2090314, preferably Chir99021; Preferably, the TGF-β inhibitor includes A83-01, RepSox or GW788388, preferably A83-01; Preferably, the ROCK inhibitor comprises Y27632, RKI-1447 or GSK269962A, preferably Y27632.

3. The prostate cancer stem cell culture medium according to claim 1 or 2, characterized in that The supplement also included penicillin at a concentration of 100 U / ml and streptomycin at 100 μg / ml in the basal medium.

4. A method for culturing prostate cancer stem cells, characterized in that: The method comprises culturing prostate cancer stem cells from primary prostate cancer stem cells separated from prostate cancer tissue blocks using the culture medium described in any one of claims 1 to 3.

5. The culture method according to claim 4, characterized in that The method for preparing primary prostate cancer stem cells separated from prostate cancer tissue blocks comprises digesting the prostate cancer tissue blocks in digestion solution I to separate and obtain primary prostate cancer stem cells; Preferably, the step of culturing the primary prostate cancer stem cells separated from the prostate cancer tissue block to obtain the prostate cancer stem cells comprises: when the primary prostate cancer stem cells are cultured to 80-90% adherent to the wall, sequentially adding a buffer and a digestion solution II, collecting the cell suspension and centrifuging it, collecting the cell precipitate, adding a prostate cancer stem cell culture medium, resuspending it, and then subculturing it; Preferably, the subculture generation number is ≤4 generations.

6. The culture method according to claim 5, characterized in that: The method of digesting the prostate cancer tissue block in digestion solution I to separate and obtain primary prostate cancer stem cells is a cyclic digestion method; Preferably, the cyclic digestion method comprises the following steps: A. Add 1-5 ml of digestion solution I to the tumor puncture tissue block, take out the digestion solution I containing the digested cells every 10-20 minutes, collect the cell suspension, centrifuge to obtain the cell pellet, add culture medium to resuspend and store for later use, and add new digestion solution I to the remaining tissue block; B. Repeat step A until all tissue blocks are digested; Preferably, the digestion condition is 36-38°C digestion, preferably 37°C digestion; Preferably, the storage temperature is 2-8°C.

7. The culture method according to claim 6, characterized in that: The digestion solution I comprises a basal culture medium, collagenase, ascorbic acid and a ROCK inhibitor; Preferably, the collagenase is type I collagenase or type II collagenase, preferably type I collagenase. Preferably, the concentration of the collagenase in the basal medium is 1 to 3 mg / ml, preferably 2 mg / ml; Preferably, the concentration of the ROCK inhibitor in the basal culture medium is 0.1-20 μM, preferably 5 μM. Preferably, the ascorbic acid concentration in the basal medium is 20 to 100 μM, preferably 50 μM; Preferably, the ROCK inhibitor includes Y27632, RKI-1447 or GSK269962A, preferably Y27632.

8. The culture method according to any one of claims 4 to 7, characterized in that: The culture conditions include culturing at an ambient temperature of 37° C. and a humidity of 95% for at least 1 week.

9. Use of the culture medium according to any one of claims 1 to 3 or the culture method according to any one of claims 4 to 8 in constructing a primary tumor cell xenograft model.

10. A method for constructing a primary tumor cell xenograft model, characterized in that: The method comprises: mixing the prostate cancer stem cells obtained by the culture method according to any one of claims 4 to 8 with matrix gel and then transplanting them into immunodeficient mice to obtain a primary tumor cell xenograft model; Preferably, the cell density of the prostate cancer stem cells is 500,000 to 1,000,000 cells / 100 μl of matrix gel; Preferably, the transplant volume is 50-200 μl, preferably 100 μl.

Images