A tyrosine decarboxylase mutant and its application in fermentation synthesis of 3-amino-1-propanol

Abstract

The invention discloses a tyrosine decarboxylase mutant and its application in fermentation synthesis of 3-amino-1-propanol. The invention relates to the field of biotechnology, and provides a tyrosine decarboxylase mutant, which is a protein obtained by replacing the 126th amino acid residue of tyrosine decarboxylase by S with M, and replacing the 100th amino acid residue by N with A or V. The invention obtains a tyrosine decarboxylase mutant that can catalyze an L-homoserine substrate, and realizes direct synthesis of 3-amino-1-propanol by a biological fermentation method.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a tyrosine decarboxylase mutant and application thereof in fermentation synthesis of 3-amino-1-propanol. Background Art

[0002] 3-Amino-1-propanol is an important intermediate for the preparation of synthetic alkylating anti-tumor drugs cyclophosphamide and ifosfamide, and is also the raw material for panthenol (provitamin B5), with a large market demand.

[0003] At present, 3-amino-1-propanol is mainly synthesized by chemical synthesis, so it is of practical significance to design a green and high-yield biosynthetic route. In vivo, glucose can be used to synthesize L-homoserine, and L-homoserine can be decarboxylated to synthesize 3-amino-1-propanol. However, many existing decarboxylases have low catalytic activity towards homoserine, so screening out enzymes that are active towards L-homoserine will greatly improve the efficiency of 3-amino-1-propanol synthesis. Summary of the invention

[0004] The purpose of the present invention is to provide a tyrosine decarboxylase mutant and application thereof in fermentation synthesis of 3-amino-1-propanol.

[0005] In a first aspect, the present invention claims a tyrosine decarboxylase mutant.

[0006] The tyrosine decarboxylase mutant claimed in the present invention is mutant 1 or mutant 2;

[0007] The mutant 1 is as follows (A1) or (A2):

[0008] (A1) a protein obtained by replacing the 126th amino acid residue of tyrosine decarboxylase from S to M and the 100th amino acid residue from N to A;

[0009] (A2) Fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of the protein defined in (A1).

[0010] The mutant 2 is as follows (B1) or (B2):

[0011] (B1) a protein obtained by replacing the 126th amino acid residue of tyrosine decarboxylase from S to M and the 100th amino acid residue from N to V;

[0012] (B2) A fusion protein obtained by linking a protein tag to the N-terminus and / or C-terminus of the protein defined in (B1).

[0013] Wherein, the tyrosine decarboxylase is derived from Enterococcus faecalis V583 ( Enterococcus faecalis), specifically the protein shown in SEQ ID No.1.

[0014] The purpose of adding the protein tag may be to facilitate the purification of the target protein, such as 6His.

[0015] Furthermore, in addition to the above mutation sites, conservative substitutions at other positions of SEQ ID No. 1 also fall within the protection scope of the present invention.

[0016] In a second aspect, the present invention claims protection for a nucleic acid molecule encoding the tyrosine decarboxylase mutant described in the first aspect above.

[0017] Furthermore, the sequence of the nucleic acid molecule encoding the mutant 1 may be as follows (C1) or (C2):

[0018] (C1) a sequence obtained by replacing nucleotides 376 to 378 of SEQ ID No. 9 with ATG, and replacing nucleotides 298 to 300 with GCG;

[0019] (C2) The sequence obtained by connecting the coding sequence of the protein tag to the 5' end and / or 3' end of the nucleic acid molecule defined in (C1).

[0020] The sequence of the nucleic acid molecule encoding the mutant 2 may be as follows (D1) or (D2):

[0021] (D1) a sequence obtained by replacing nucleotides 376 to 378 of SEQ ID No. 9 with ATG, and replacing nucleotides 298 to 300 with GTG;

[0022] (D2) The sequence obtained by connecting the coding sequence of the protein tag to the 5' end and / or 3' end of the nucleic acid molecule defined in (D1).

[0023] In a third aspect, the present invention claims protection for any of the following biological materials:

[0024] (I) an expression cassette containing the nucleic acid molecule described in the second aspect above;

[0025] (II) a recombinant vector containing the nucleic acid molecule described in the second aspect above;

[0026] (III) A recombinant bacterium containing the nucleic acid molecule described in the second aspect above.

[0027] The expression cassette includes a promoter capable of initiating transcription of the nucleic acid molecule and the nucleic acid molecule, and may further include a termination sequence and an enhancer sequence.

[0028] Furthermore, the recombinant bacteria may be recombinant Escherichia coli.

[0029] Furthermore, the recombinant Escherichia coli can be prepared according to a method comprising the following steps: introducing the nucleic acid molecule described in the second aspect above into a recipient Escherichia coli to obtain the recombinant Escherichia coli.

[0030] Wherein, the recipient Escherichia coli is an Escherichia coli capable of synthesizing L-homoserine.

[0031] Furthermore, the recipient Escherichia coli is an Escherichia coli that can synthesize L-homoserine using glucose.

[0032] Exemplarily, the recipient Escherichia coli expresses L-homoserine internalization protein tdcC, glucose kinase glk, homoserine dehydrogenase thrA*, aspartate semialdehyde dehydrogenase asd, and glucose-promoting protein gene zglF, and does not express lactate dehydrogenase ldhA, homoserine O-succinyltransferase metA, homoserine kinase thrB, lysine decarboxylase lysA, pyruvate formate lyase pflB, L-homoserine export protein rhtA, DNA-binding transcription dual regulator galR, glucose-specific PTS enzyme IIBC component ptsG, and hypothetical protein yjiP.

[0033] Among them, the amino acid sequence of the L-homoserine internalization protein tdcC is SEQ ID No.2, and the corresponding coding gene sequence is 529-1860 of SEQ ID No.10; the amino acid sequence of the glucose kinase glk is SEQ ID No.3, and the corresponding coding gene sequence is 544-1509 of SEQ ID No.12; the amino acid sequence of the homoserine dehydrogenase thrA* is SEQ ID No.4, and the corresponding coding gene sequence is 537-2999 of SEQ ID No.14; the amino acid sequence of the aspartate semialdehyde dehydrogenase asd is SEQ ID No.5, and the corresponding coding gene sequence is 538-1641 of SEQ ID No.15; the amino acid sequence of the glucose promoting protein gene zglF is SEQ ID No.6, and the corresponding coding gene sequence is 937-2358 of SEQ ID No.11; the amino acid sequence of the lactate dehydrogenase ldhA is SEQ ID No.7, and the corresponding coding gene sequence is SEQ ID No.16; the amino acid sequence of the homoserine O-succinyltransferase metA is (genbank number and submission date AAC76983.1, 20180924), and the corresponding coding gene sequence is Gene ID: 948513; the amino acid sequence of the homoserine kinase thrB is (genbank number and submission date NP_414544.1, 20181011), and the corresponding coding gene sequence is Gene ID: 947498; the amino acid sequence of the lysine decarboxylase lysA is (genbank number and submission date NP_417315.1, 20181011), and the corresponding coding gene sequence is Gene ID: 947313; the amino acid sequence of the pyruvate formate lyase pflB is (genbank number and submission date NP_415423, 20220509), and the corresponding coding gene sequence is Gene ID: 945514; the amino acid sequence of the L-homoserine export protein rhtA is (genbank number and submission date NP_415334.1, 20220509), and the corresponding coding gene sequence is GeneID: 947045; the amino acid sequence of the DNA binding transcription dual regulator galR is (genbank number and submission date NP_417314.1, 20220509), and the corresponding coding gene sequence is Gene ID: 947314; the amino acid sequence of the glucose-specific PTS enzyme IIBC component ptsG is (genbank number and submission date NP_415619.1, 20220509), and the corresponding coding gene sequence is Gene ID: 945651; the amino acid sequence of the hypothetical protein yjiP is SEQ ID No.8, the corresponding coding gene sequence is Gene ID: 38094982. .

[0034] In one embodiment of the present invention, the recipient Escherichia coli is obtained by transforming Escherichia coli DD00 as follows: (a1) replacing the gene encoding the DNA-binding transcription dual regulator galR in the genome with an expression cassette containing a gene encoding a glucose-promoting protein zglF (amino acid sequence as shown in SEQ ID No.6) (i.e., expression cassette 1); (a2) replacing the gene encoding the glucose-specific PTS enzyme IIBC component ptsG in the genome with an expression cassette containing a gene encoding a glucose kinase glk (amino acid sequence as shown in SEQ ID No.3) (i.e., expression cassette 2); (a3) ​​knocking out the gene encoding the pyruvate formate lyase pflB in the genome; (a4) replacing the gene encoding the hypothetical protein yjiP1 in the genome with an expression cassette containing a gene encoding a homoserine dehydrogenase thrA* (amino acid sequence as shown in SEQ ID No.4) (i.e., expression cassette 3); (a5) replacing the gene encoding the hypothetical protein yjiP2 in the genome with an expression cassette containing a gene encoding an aspartate semialdehyde dehydrogenase asd (amino acid sequence as shown in SEQ ID No.5) is an expression cassette for encoding a gene (i.e., expression cassette 4).

[0035] In the expression cassette 1, the promoter for initiating transcription of the gene encoding the glucose-promoting protein zglF is P cpA1 Further, the expression cassette 1 comprises the P cpA1 promoter, RBS sequence (ccatgggt), the glucose-promoting protein zglF encoding gene and terminator TrrnB. cpA1 The sequence of the promoter is shown at positions 751-928 of SEQ ID No.11; the sequence of the terminator TrrnB is shown at positions 2452-2609 of SEQ ID No.11.

[0036] In the expression cassette 2, the promoter for initiating transcription of the gene encoding the glucose kinase glk is P 119 Further, the expression cassette 2 comprises the P 119 promoter, RBS sequence (ccatgggt) and the glucose kinase glk coding gene. 119 The sequence of the promoter is shown in positions 501-535 of SEQ ID No.12.

[0037] In the expression cassette 3, the promoter for initiating the transcription of the gene encoding homoserine dehydrogenase thrA* is P tacFurther, the expression cassette 3 comprises the P tac promoter and the homoserine dehydrogenase thrA* encoding gene. tac The sequence of the promoter is shown in positions 501-528 of SEQ ID No.14.

[0038] In the expression cassette 4, the promoter for initiating the transcription of the gene encoding aspartate semialdehyde dehydrogenase asd is P tac Further, the expression cassette 4 comprises the P tac promoter and the aspartate semialdehyde dehydrogenase asd encoding gene. tac The sequence of the promoter is shown in positions 502-529 of SEQ ID No.15.

[0039] More specifically, (a1) to (a5) can all be achieved by Crispr / cas9 technology. In a specific implementation case of the present invention, the nucleotide sequence of the targeting fragment (donor fragment) used in (a1) is shown in SEQ ID No.11; the nucleotide sequence of the targeting fragment (donor fragment) used in (a2) is shown in SEQ ID No.12; the nucleotide sequence of the targeting fragment (donor fragment) used in (a3) ​​is shown in SEQ ID No.13; the nucleotide sequence of the targeting fragment (donor fragment) used in (a4) is shown in SEQ ID No.14; the nucleotide sequence of the targeting fragment (donor fragment) used in (a5) is shown in SEQ ID No.15.

[0040] Furthermore, the genotype of the Escherichia coli GD00 is BW25113 ΔlysAΔmetAΔthrBΔldhAΔrhtA::P trc -tdcC. That is, the E. coli GD00 is obtained by knocking out the coding gene of the lysine decarboxylase lysA mentioned above, the coding gene of the homoserine O-succinyltransferase metA mentioned above, the coding gene of the homoserine kinase thrB mentioned above, the coding gene of the lactate dehydrogenase ldhA mentioned above, and replacing the coding gene of the L-homoserine export protein rhtA with the expression cassette (i.e., expression cassette 5) containing the coding gene of the L-homoserine internalization protein tdcC mentioned above in the genome of E. coli BW25113. This can be achieved by Crispr / cas9 technology.

[0041] In the expression cassette 5, the promoter for initiating transcription of the gene encoding the L-homoserine internalizing protein tdcC is P trcFurther, the expression cassette 5 comprises the P trc promoter and the coding gene of the L-homoserine internalizing protein tdcC. trc The sequence of the promoter is shown in positions 501-528 of SEQ ID No.10.

[0042] In a specific implementation case of the present invention, the nucleotide sequence of the targeting fragment (donor fragment) used for knocking out the coding gene of the lysine decarboxylase lysA mentioned above is shown in SEQ ID No.17; the nucleotide sequence of the targeting fragment (donor fragment) used for knocking out the coding gene of the homoserine O-succinyltransferase metA mentioned above is shown in SEQ ID No.18; the nucleotide sequence of the targeting fragment (donor fragment) used for knocking out the coding gene of the homoserine kinase thrB mentioned above is shown in SEQ ID No.19; the nucleotide sequence of the targeting fragment (donor fragment) used for knocking out the coding gene of the lactate dehydrogenase ldhA mentioned above is shown in SEQ ID No.20; the nucleotide sequence of the targeting fragment (donor fragment) used for replacing the coding gene of the L-homoserine export protein rhtA with the expression cassette (i.e., expression cassette 5) containing the coding gene of the L-homoserine internalization protein tdcC mentioned above is shown in SEQ ID No.10.

[0043] In a fourth aspect, the present invention claims the use of the tyrosine decarboxylase mutant described in the first aspect above, the nucleic acid molecule described in the second aspect above, or the biomaterial described in the third aspect above in the production of 3-amino-1-propanol.

[0044] In a fifth aspect, the present invention claims a method for producing 3-amino-1-propanol.

[0045] The method for producing 3-amino-1-propanol claimed in the present invention can be the following method I or method II:

[0046] Method I: Whole-cell catalytic method, comprising the following steps: fermenting and culturing the recombinant bacteria described in the third aspect above to obtain 3-amino-1-propanol from the fermentation product;

[0047] Method II: In vitro catalytic method, comprising the following steps: using L-homoserine as substrate, utilizing the tyrosine decarboxylase mutant described in the first aspect above or a crude enzyme solution containing the tyrosine decarboxylase mutant to perform in vitro catalysis, thereby obtaining 3-amino-1-propanol.

[0048] Furthermore, in the method I, the fermentation medium contains glucose, and the recombinant bacteria can use glucose to synthesize L-homoserine, and then synthesize 3-amino-1-propanol using L-homoserine as a substrate.

[0049] Further, in the method II, in a reaction system of 50 mM phosphate (dipotassium hydrogen phosphate and potassium dihydrogen phosphate) pH 7.0, the concentration of the crude tyrosine decarboxylase enzyme solution is 20 OD / mL (wherein, 20 OD means that the biomass of the recombinant bacteria corresponding to the crude tyrosine decarboxylase enzyme solution is OD600=20), and the concentration of L-homoserine is 10 mM. The reaction conditions are: 37°C, 220 rpm catalytic reaction for 12 hours.

[0050] Compared with the existing method, the method of the invention obtains a tyrosine decarboxylase mutant capable of catalyzing an L-homoserine substrate, and realizes direct synthesis of 3-amino-1-propanol by a biological fermentation method. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1 This is the HPLC detection spectrum of L-homoserine standard.

[0052] Figure 2 This is the HPLC detection spectrum of 3-amino-1-propanol standard.

[0053] Figure 3 This is the HPLC detection spectrum of the reaction conversion product of the tyrosine decarboxylase double mutant V583ADC-S126M-N100A in Example 4.

[0054] Figure 4 This is the high-density fermentation result of the GD05-pFS91G-V583ADC-S126M-N100A strain in Example 5. Note: The black curve is the homoserine concentration, corresponding to the left coordinate; the red curve is the 3-amino-1-propanol concentration, corresponding to the right coordinate. DETAILED DESCRIPTION

[0055] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0056] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0057] The quantitative data involved in the following examples are the mean values ​​of the results of at least three repeated experiments.

[0058] The experimental materials involved in the following examples are as follows:

[0059] L-Homoserine standard: Aladdin, product number is H105430.

[0060] 3-Amino-1-propanol: ACMEC, product number A41420.

[0061] 2,4-Dinitrofluorobenzene (DNFB): Yeasen, product number 61404ES25.

[0062] Escherichia coli strains BW25113 and HS08: both described in “Qingxuan Mu, et al. Highly efficient production of L-homoserine in Escherichia coli by engineering a redoxbalance route. Metab Eng. 2021 Sep:67:321-329." The public can obtain it from the applicant and it can only be used to repeat the experiments of the present invention and cannot be used for other purposes.

[0063] pCas plasmid and pTargetF plasmid: both are described in the reference "Multigene Editing in the Escherichia coli Genome via the CRISPR-Cas9 System. Applied EnvironmentalMicrobiology. 2015, 81(7): 2506-2514". The public can obtain it from the applicant and can only be used to repeat the experiments of the present invention and cannot be used for other purposes.

[0064] Vector pFS91G: recorded in the reference "Bio-production of high-purity propionate by engineering L-threonine degradation pathway in Pseudomonas putida. Applied Microbiology and Biotechnology (2020) 104:5303–5313", which is available to the public from the applicant and can only be used to repeat the experiments of the present invention and may not be used for other purposes.

[0065] Example 1. Construction of homoserine producing strain

[0066] The purpose of this example is to construct a recombinant Escherichia coli (named strain GD05) that can synthesize L-homoserine from glucose. The synthesized L-homoserine is used as a catalytic substrate for subsequent tyrosine decarboxylase mutants to further synthesize 3-amino-1-propanol.

[0067] The primer sequences involved in this example are shown in Table 1.

[0068]

[0069]

[0070]

[0071] 1. The lysine decarboxylase lysA encoding gene expression cassette in the genome of Escherichia coli BW25113 was knocked out to obtain strain GD-1

[0072] 1. Preparation of the targeting fragment ΔlysA

[0073] Using the genome of the laboratory-preserved Escherichia coli strain HS08 as a template, the primer pair lysA-UP-F / lysA-UP-R and the primer pair lysA-DOWN-F / ysA-DOWN-R (specific sequences are shown in Table 1) were used to obtain the upstream 500bp fragment and the downstream 500bp fragment of the Escherichia coli lysA gene by PCR amplification, and the upstream and downstream homologous arms of the lysA gene were connected by Gibson to construct the targeting fragment. The resulting targeting fragment was named ΔlysA, and its sequence is shown in SEQ ID No. 17. The 1st to 500th positions of SEQ ID No. 17 are the upstream homologous arms of the lysA site, and the 501st to 1001st positions are the downstream homologous arms of the lysA site.

[0074] 2. Construction of targeting plasmid pTargetF-lysA

[0075] Using the pTargetF plasmid as a template and pTargetF-lysA-F and pTargetF-lysA-R as primers (see Table 1 for specific sequences), PCR amplification was performed to obtain a 2118 bp plasmid containing the lysA site recognition N20, which was named pTargetF-lysA after sequencing verification. The nucleotide sequence of its N20 was CTATGTCCGTGACCAAACCC (positions 1-20 of SEQ ID No. 21).

[0076] 3. Genome Editing

[0077] (1) Prepare electrocompetent cells of the target strain according to the preparation method of electrocompetent cells of Escherichia coli, transfer the pCa9 plasmid into Escherichia coli BW25113 by electrocompetent cells, spread on kanamycin (40 mg / L) resistant LB plates, and culture at 30°C to obtain transformants BW25113 / pCas.

[0078] (2) The obtained E. coli BW25113 / pCas was inoculated into LB medium containing kanamycin and 0.2% final concentration of L-arabinose, and cultured at 30°C for 3-4 hours to prepare electrocompetent cells;

[0079] (3) The targeting fragment ΔlysA (SEQ ID No. 17) prepared in step 1 and the targeting plasmid pTargetF-lysA constructed in step 2 were simultaneously transferred into the electroporation competent medium obtained in step (2), and after being revived at 30°C for 1 h, they were spread on LB plates containing kanamycin, streptomycin (100 mg / L) and 0.2% final concentration of L-arabinose, and cultured in an incubator at 30°C;

[0080] (4) Colony PCR was performed on the single colonies grown on the screening plate using the primers lysA-UP-F and lysA-DOWN-R (see Table 1) on the chromosomes at both ends of the target gene site, and verified by agarose gel electrophoresis. Single colonies with a fragment band size of 1001 bp were selected and cultured in LB medium containing kanamycin and 0.5 mM IPTG (isopropyl-β-D-thiogalactopyranoside) at 30°C overnight;

[0081] (5) Use an inoculation loop to dip the overnight cultured bacterial solution and streak three zones on an LB plate containing kanamycin, and then culture it in a 30°C incubator. After a single colony grows, streak it on an LB plate containing kanamycin and streptomycin, respectively, and then culture it in a 30°C incubator. If there is no growth on the LB plate containing streptomycin, the targeting plasmid has been eliminated.

[0082] (6) Pick out single colonies that have eliminated the targeting plasmid, streak them onto LB plates without antibiotics, and culture them at 42°C overnight.

[0083] (7) The grown single colonies were spotted on LB plates without antibiotics and containing kanamycin, and cultured in a 37°C incubator. If there was no growth on the LB plate containing kanamycin, the pCas9 plasmid was successfully eliminated and a genetically recombinant strain was obtained, named GD-1 strain. The genotype of the GD-1 strain was BW25113ΔlysA.

[0084] 2. The homoserine O-succinyltransferase metA gene expression cassette was knocked out in the genome of Escherichia coli GD-1 to obtain strain GD-2

[0085] 1. Preparation of the targeting fragment ΔmetA

[0086] Using the genome of the laboratory-preserved Escherichia coli strain HS08 as a template, the primer pair metA-UP-F / metA-UP-R and the primer pair metA-DOWN-F / metA-DOWN-R (see Table 1 for specific sequences) were used to amplify the upstream 500 bp fragment and the downstream 500 bp fragment of the Escherichia coli metA gene by PCR, and the upstream and downstream homology arms of the metA gene were connected by Gibson to construct the targeting fragment. The resulting targeting fragment was named ΔmetA, and its sequence is shown in SEQ ID No. 18. The 1st to 500th positions of SEQ ID No. 18 are the upstream homology arms of the metA site, and the 501st to 1001st positions are the downstream homology arms of the metA site.

[0087] 2. Construction of targeting plasmid pTargetF-metA

[0088] Using the pTargetF plasmid as a template and pTargetF-metA-F and pTargetF-metA-R as primers (see Table 1 for specific sequences), PCR amplification was performed to obtain a 2118 bp plasmid containing metA site recognition N20, which was named pTargetF-metA after sequencing verification. The nucleotide sequence of its N20 was CTCGACGCTGTTTGTCTGCT (positions 1-20 of SEQ ID No. 23).

[0089] 3. Genome Editing

[0090] Refer to step 1-3, and transfer the targeting fragment ΔmetA (SEQ ID No. 18) prepared in step 1 and the targeting plasmid pTargetF-metA constructed in step 2 into the GD-1 strain at the same time. Among them, the detection primers are metA-UP-F and metA-DOWN-R (see Table 1), and the size of the positive amplified fragment is 1001bp. The recombinant strain finally obtained is named GD-2 strain. The genotype of GD-2 strain is BW25113ΔlysAΔmetA.

[0091] 3. The homoserine kinase thrB encoding gene expression cassette in the genome of Escherichia coli GD-2 was knocked out to obtain strain GD-3

[0092] 1. Preparation of the targeting fragment ΔthrB

[0093] Using the genome of the laboratory-preserved Escherichia coli strain HS08 as a template, the primer pair thrB-UP-F / thrB-UP-R and the primer pair thrB-DOWN-F / thrB-DOWN-R (see Table 1 for specific sequences) were used to amplify the upstream 500 bp fragment and the downstream 500 bp fragment of the Escherichia coli thrB gene by PCR, and the upstream and downstream homologous arms of the thrB gene were connected by Gibson to construct the targeting fragment. The resulting targeting fragment was named ΔthrB, and its sequence is shown in SEQ ID No. 19. The 1st to 500th positions of SEQ ID No. 19 are the upstream homologous arms of the thrB site, and the 501st to 1000th positions are the downstream homologous arms of the thrB site.

[0094] 2. Construction of targeting plasmid pTargetF-thrB

[0095] Using the pTargetF plasmid as a template and pTargetF-thrB-F and pTargetF-thrB-R as primers (see Table 1 for specific sequences), PCR amplification was performed to obtain a 2118 bp plasmid containing thrB site recognition N20, which was named pTargetF-thrB after sequencing verification. The nucleotide sequence of its N20 was GCTGGCTTTGATGGGCGAGC (positions 1-20 of SEQ ID No. 25).

[0096] 3. Genome Editing

[0097] Refer to step 1-3, and transfer the targeting fragment ΔthrB (SEQ ID No. 19) prepared in step 1 and the targeting plasmid pTargetF-thrB constructed in step 2 into the GD-2 strain at the same time. Among them, the detection primers are thrB-UP-F and thrB-DOWN-R (see Table 1), and the size of the positive amplified fragment is 1000bp. The recombinant strain finally obtained is named GD-3 strain. The genotype of GD-3 strain is BW25113ΔlysAΔmetAΔthrB.

[0098] 4. Knock out the lactate dehydrogenase ldhA gene expression cassette in the genome of Escherichia coli GD-3 to obtain strain GD-4

[0099] 1. Preparation of the targeting fragment ΔldhA

[0100] Using the genome of the laboratory-preserved Escherichia coli strain HS08 as a template, the primer pair ldhA-UP-F / ldhA-UP-R and the primer pair ldhA-DOWN-F / ldhA-DOWN-R (specific sequences are shown in Table 1) were used to amplify the upstream 500 bp fragment and the downstream 500 bp fragment of the Escherichia coli ldhA gene by PCR, and the upstream and downstream homologous arms of the ldhA gene were connected by Gibson to construct the targeting fragment. The resulting targeting fragment was named ΔldhA, and its sequence is shown in SEQ ID No. 20. The 1st to 500th positions of SEQ ID No. 20 are the upstream homologous arms of the ldhA site, and the 501st to 1000th positions are the downstream homologous arms of the ldhA site.

[0101] 2. Construction of targeting plasmid pTargetF-ldhA

[0102] Using pTargetF as a template and pTargetF-ldhA-F and pTargetF-ldhA-R as primers, PCR amplification was performed to obtain a 2118 bp plasmid containing the ldhA site recognition N20. After sequencing verification, it was named pTargetF-ldhA, and the nucleotide sequence of its N20 was TTTGCCATACATAGTAAAGC (positions 1-20 of SEQ ID No. 27).

[0103] 3. Genome Editing

[0104] Refer to step 1-3, and transfer the targeting fragment ΔldhA (SEQ ID No. 20) prepared in step 1 and the targeting plasmid pTargetF-ldhA constructed in step 2 into the GD-3 strain at the same time. Among them, the detection primers are ldhA-UP-F and ldhA-DOWN-R (see Table 1), and the size of the positive amplified fragment is 1000bp. The recombinant strain finally obtained is named GD-4 strain. The genotype of GD-4 strain is BW25113ΔlysAΔmetAΔthrBΔldhA.

[0105] 5. The strain GD00 was obtained by replacing the gene encoding the L-homoserine export protein rhtA in the genome of Escherichia coli GD-4 with an expression cassette containing the gene encoding the L-homoserine internalization protein tdcC

[0106] 1. Preparation of the targeting fragment ΔrhtA::Ptrc-tdcC

[0107] Using the genome of the laboratory-preserved Escherichia coli strain HS08 as a template, the primer pair rhtA-UP-F / rhtA-UP-R, the primer pair tdcC-UP / tdcC-DOWN and the primer pair rhtA-DOWN-F / rhtA-DOWN-R (see Table 1 for specific sequences) were used to obtain the upstream 500bp fragment of the rhtA gene, the tdcC expression cassette (including the Ptrc promoter, RBS sequence (ccatgggt), and tdcC gene expression sequence) that can express the homoserine transporter gene from Escherichia coli in Escherichia coli, and the downstream 500bp fragment of the rhtA gene by PCR amplification. The tdcC expression cassette was connected to the upstream and downstream homology arms of the rhtA site on the genome by Gibson to construct the targeting fragment. The resulting targeting fragment was named ΔrhtA::Ptrc-tdcC, and its sequence is shown in SEQ ID No.10. Positions 1-500 of SEQ ID No. 10 are the upstream homology arms of the rhtA site, positions 501-528 are the Ptrc promoter sequence, positions 529-1860 are the tdcC gene sequence, and positions 1861-2361 are the downstream homology arms of the rhtA site.

[0108] 2. Construction of targeting plasmid pTargetF-rhtA

[0109] Using pTargetF as a template and pTargetF-rhtA-F and pTargetF-rhtA-R as primers (see Table 1 for details), PCR amplification was performed to obtain a 2118 bp plasmid containing the rhtA site recognition N20, which was named pTargetF-rhtA after sequencing verification. The nucleotide sequence of its N20 was AACCAATTGCCACCGTCGCA (positions 1-20 of SEQ ID No. 29).

[0110] 3. Genome Editing

[0111] Refer to step 1-3, and transfer the targeting fragment ΔrhtA::Ptrc-tdcC (SEQ ID No. 10) prepared in step 1 and the targeting plasmid pTargetF-rhtA constructed in step 2 into the GD-4 strain at the same time. Among them, the detection primers are rhtA-UP-F and rhtA-DOWN-R (see Table 1), and the size of the positive amplified fragment is 2361bp. The recombinant strain finally obtained was named GD00 strain. The genotype of GD00 strain is BW25113ΔlysAΔmetAΔthrBΔldhAΔrhtA::Ptrc-tdcC.

[0112] 6. The gene encoding the DNA-binding transcriptional dual regulator galR in the genome of Escherichia coli GD00 was replaced with an expression cassette containing the gene encoding the glucose-promoting protein zglF (amino acid sequence as shown in SEQ ID No. 6) to obtain strain GD01

[0113] 1. Targeting fragment ΔgalR::P cpA1 Preparation of -zglF

[0114] Using the genome of the laboratory-preserved Escherichia coli strain HS08 as a template, the primer pair galR-UP-F / galR-UP-R, the primer pair zglf-F / zglf-R, and the primer pair galR-DOWN-F / galR-DOWN-R (see Table 1 for specific sequences) were used to obtain the upstream homology arm fragment of the galR gene, the expression cassette of the glucose-promoting protein gene zglF from Zymomonas mobilis that can be expressed in Escherichia coli (including the PcpA1 promoter, RBS sequence (ccatgggt), zglF gene expression sequence, and terminator TrrnB), and the downstream homology arm fragment of the galR gene by PCR amplification. The zglF expression cassette was connected to the upstream and downstream homology arms of the galR site on the genome by Gibson to construct the targeting fragment. The resulting targeting fragment was named ΔgalR::P cpA1 -zglF, whose sequence is shown in SEQ ID No. 11. Positions 1-750 of SEQ ID No. 11 are the homology arms upstream of the galR site, and positions 751-928 are P cpA1 The promoter sequence, positions 929-936 are the RBS sequence, positions 937-2358 are the zglF gene sequence, positions 2542-2609 are the TrrnB sequence, and positions 2610-3359 are the downstream homology arms of the galR site.

[0115] 2. Construction of targeting plasmid pTargetF-galR

[0116] Using the pTargetF plasmid as a template and pTargetF-galR-F and pTargetF-galR-R as primers (see Table 1), PCR amplification was performed to obtain a 2118 bp plasmid containing the galR site recognition N20, which was named pTargetF-galR after sequencing verification. The nucleotide sequence of its N20 was ACGCCGAAGATCGTCTGCAA (positions 1-20 of SEQ ID No. 31).

[0117] 3. Genome Editing

[0118] Refer to step 1-3 and transfer the targeting fragment ΔgalR::P prepared in step 1 to cpA1-zglF (SEQ ID No.11) and the targeting plasmid pTargetF-galR constructed in step 2 were simultaneously transferred into the GD00 strain. Among them, the detection primers were galR-UP-F and galR-DOWN-R (see Table 1), and the size of the positive amplified fragment was 3359 bp. The resulting recombinant strain was named GD01 strain. The genotype of GD01 strain was GD00ΔgalR::P cpA1 -zglF.

[0119] 7. The gene encoding the glucose-specific PTS enzyme IIBC component ptsG in the genome of strain GD01 was replaced with an expression cassette containing a gene encoding glucose kinase glk (amino acid sequence as shown in SEQ ID No. 3) to obtain strain GD02

[0120] 1. Targeting fragment ΔptsG::P 119 Preparation of -GLK

[0121] Using the E. coli MG1655 genome as a template, the primer pair ptsG-UP-F / ptsG-UP-R, the primer pair glK-F / glK-R, and the primer pair ptsG-DOWN-F and ptsG-DOWN-R (see Table 1 for specific sequences) were used to obtain the upstream homology arm fragment of the ptsG gene, the E. coli-derived glucokinase gene glk expression cassette (including the 119 promoter, RBS sequence (ccatgggt) and glk gene expression sequence) and the downstream homology arm fragment of the ptsG gene by PCR amplification. The glk expression cassette was connected to the upstream and downstream homology arms of the ptsG site by Gibson to obtain the targeting fragment. The resulting targeting fragment was named ΔptsG::P 119 -glk, the sequence of which is shown in SEQ ID No. 12. Positions 1-500 of SEQ ID No. 12 are the homology arms upstream of the ptsG site, and positions 501-535 are P 119 The promoter sequence, positions 536-543 are the RBS sequence, positions 544-1509 are the glK sequence, and positions 1510-2009 are the homology arms downstream of the ptsG site.

[0122] 2. Construction of targeting plasmid pTargetF-ptsG

[0123] Using the pTargetF plasmid as a template and pTargetF-ptsG-F and pTargetF-ptsG-R as primers (see Table 1 for specific sequences), PCR amplification was performed to obtain a 2118 bp plasmid containing the ptsG site recognition N20, which was named pTargetF-ptsG after sequencing verification. The nucleotide sequence of its N20 was ATCATCCACGCGATTCTGGC (positions 1-20 of SEQ ID No. 33).

[0124] 3. Genome Editing

[0125] Refer to step 1-3 and transfer the targeting fragment ΔptsG::P prepared in step 1 to 119 -glk (SEQ ID No.12) and the targeting plasmid pTargetF-ptsG constructed in step 2 were simultaneously transferred into the GD01 strain. Among them, the detection primers were ptsG-UP-F and ptsG-DOWN-R (see Table 1), and the size of the positive amplified fragment was 2009bp. The resulting recombinant strain was named GD02 strain. The genotype of GD02 strain was GD01ΔptsG::P 119 -glk.

[0126] 8. Knockout of the gene encoding pyruvate formate lyase pflB in the genome of strain GD02 to obtain strain GD03

[0127] 1. Preparation of the targeting fragment ΔpflB

[0128] Using the genome of Escherichia coli MG1655 as a template, the upstream homology arm and the downstream homology arm of the pflB glucopyranoacetate lyase from Escherichia coli were obtained by PCR amplification using primer pairs pflB-UP-F / pflB-UP-R and primer pairs pflB-DOWN-F / pflB-DOWN-R (see Table 1 for specific sequences). The target fragment was obtained by Gibson ligation with the upstream and downstream homology arms of the pflB site. The obtained target fragment was named ΔpflB, and its sequence is shown in SEQ ID No. 13. Positions 1-500 of SEQ ID No. 13 are the upstream homology arms of the pflB site, and positions 501-1001 are the downstream homology arms of the pflB site.

[0129] 2. Construction of targeting plasmid pTargetF-pflB

[0130] Using the pTargetF plasmid as a template and pTargetF-pflB-F and pTargetF-pflB-R as primers (see Table 1 for specific sequences), PCR amplification was performed to obtain a 2118 bp plasmid containing the pflB site recognition N20, which was named pTargetF-pflB after sequencing verification. The nucleotide sequence of its N20 was ACAGCCAGGTCATCTACACG (positions 1-20 of SEQ ID No. 35).

[0131] 3. Genome Editing

[0132] Refer to step 1-3, and transfer the targeting fragment ΔpflB (SEQ ID No. 13) prepared in step 1 and the targeting plasmid pTargetF-pflB constructed in step 2 into the GD02 strain at the same time. Among them, the detection primers are pflB-UP-F and pflB-DOWN-R (see Table 1), and the size of the positive amplified fragment is 1001bp. The recombinant strain finally obtained is named GD03 strain. The genotype of GD03 strain is GD02ΔpflB.

[0133] IX. The gene encoding the hypothetical protein yjiP1 in the genome of strain GD03 was replaced with an expression cassette containing a gene encoding homoserine dehydrogenase thrA* (amino acid sequence as shown in SEQ ID No. 4) to obtain strain GD04.

[0134] 1. Targeting fragment ΔyjiP1::P tac Preparation of -thrA*

[0135] Using the genome of E. coli MG1655 as a template, the primer pair yjiP1-UP-F / yjiP1-UP-R, the primer pair thrA*-F / thrA*-R and the primer pair yjiP1-DOWN-F / yjiP1-DOWN-R (for specific sequences, see Table 1) were used to obtain the upstream homology arm of the yjiP1 site, the expression cassette of the homoserine dehydrogenase gene thrA* from E. coli itself (including the tac promoter, RBS sequence (ccatgggt) and the thrA* gene expression sequence) and the downstream homology arm of the yjiP1 site by PCR amplification. The thrA* expression cassette was connected to the upstream and downstream homology arms of the yjiP1 site by Gibson to obtain the target fragment. The obtained target fragment was named ΔyjiP1::Ptac-thrA*, and its sequence is shown in SEQ ID No.14. The 1st to 500th positions of SEQ ID No.14 are the homology arms upstream of the yjiP1 site, and the 501st to 528th positions are P tacPromoter sequence, positions 529-536 are RBS sequences, positions 537-2999 are thrA* sequences, and positions 3000-3499 are homologous arms downstream of the yjiP1 site.

[0136] 2. Construction of targeting plasmid pTargetF-yjiP1

[0137] Using the pTargetF plasmid as a template and pTargetF-yjiP1-F and pTargetF-yjiP1-R as primers (see Table 1), PCR amplification was performed to obtain a 2118 bp plasmid containing the yjiP1 site recognition N20. After sequencing verification, it was named pTargetF-yjiP1, and the nucleotide sequence of its N20 was CACGCACCCTGACACTGCGC (positions 1-20 of SEQ ID No. 37).

[0138] 3. Genome Editing

[0139] Refer to step 1-3 and convert the targeting fragment ΔyjiP1::P prepared in step 1 into tac -thrA* (SEQ ID No.14) and the targeting plasmid pTargetF-yjiP1 constructed in step 2 were simultaneously transferred into the GD03 strain. Among them, the detection primers were yjiP1-UP-F and yjiP1-DOWN-R (see Table 1), and the size of the positive amplified fragment was 3499bp. The resulting recombinant strain was named GD04 strain. The genotype of GD04 strain was GD03ΔyjiP1::P tac -thrA*.

[0140] 10. Replace the gene encoding the hypothetical protein yjiP2 in the genome of the GD04 strain with an expression cassette containing a gene encoding aspartate semialdehyde dehydrogenase asd (amino acid sequence as shown in SEQ ID No. 5) to obtain the GD05 strain

[0141] 1. Targeting fragment ΔyjiP2::P tac Preparation of -asd

[0142] Using the genome of E. coli MG1655 as a template, the primer pair yjiP2-UP-F / yjiP2-UP-R, the primer pair asd-F / asd-R and the primer pair yjiP2-DOWN-F / yjiP2-DOWN-R (see Table 1 for specific sequences) were used to obtain the upstream homology arm of the yjiP2 site, the asd expression cassette of the aspartate semialdehyde dehydrogenase gene from E. coli itself (including the Ptac promoter, RBS sequence (ccatgggt) and asd gene expression sequence) and the downstream homology arm of the yjiP2 site by PCR amplification. The asd expression cassette was connected to the upstream and downstream homology arms of the yjiP2 site by Gibson to obtain the targeting fragment. The resulting targeting fragment was named ΔyjiP2::Ptac-asd, and its sequence is shown in SEQ ID No.15. The 1st to 501st positions of SEQ ID No.15 are the homology arms upstream of the yjiP2 site, and the 502nd to 529th positions are the P tac Promoter sequence, positions 530-537 are RBS sequences, positions 538-1641 are asd sequences, and positions 1642-2143 are homologous arms downstream of the yjiP2 site.

[0143] 2. Construction of targeting plasmid pTargetF-yjiP2

[0144] Using pTargetF as a template and pTargetF-yjiP2-F and pTargetF-yjiP2-R as primers (see Table 1 for specific sequences), PCR amplification was performed to obtain a 2118 bp plasmid containing the yjiP2 site recognition N20, which was named pTargetF-yjiP2 after sequencing verification. The nucleotide sequence of its N20 was TAAACGCCAGCCGCTACCGT (positions 1-20 of SEQ ID No. 39).

[0145] 3. Genome Editing

[0146] Refer to step 1-3 and prepare the targeting fragment ΔyjiP2::P tac -asd (SEQ ID No.15) and the targeting plasmid pTargetF-yjiP2 constructed in step 2 were simultaneously transferred into the GD03 strain. Among them, the detection primers were yjiP2-UP-F and yjiP2-DOWN-R (see Table 1), and the size of the positive amplified fragment was 2143bp. The resulting recombinant strain was named GD05 strain. The genotype of GD05 strain was GD04ΔyjiP2:: P tac -asd.

[0147] Example 2: Construction of tyrosine decarboxylase mutant strain

[0148] The tyrosine decarboxylase in the present invention is derived from Enterococcus faecalis V583 ( Enterococcus faecalis ), hereinafter abbreviated as V583ADC.

[0149] The amino acid sequence of the V583ADC is shown in SEQ ID No.1.

[0150] The single point mutation of the amino acid of the V583ADC (relative to SEQ ID No. 1) is as follows:

[0151] The 126th position S mutates to M; or

[0152] The 126th position S mutated to I;

[0153] The double point mutations of the amino acids of the V583ADC (relative to SEQ ID No. 1) are as follows:

[0154] The S at position 126 mutated to M; and

[0155] The N at position 100 mutates to A; or

[0156] The N at position 100 mutates to a T; or

[0157] The N at position 100 mutates to Y; or

[0158] The N at position 100 is mutated to I; or

[0159] The 100th position N is mutated to V; or

[0160] The 100th position N mutates to L; or

[0161] The A at position 123 mutated to I.

[0162] The V583ADC gene fragment (SEQ ID No. 9) is derived from Enterococcus faecalis V583 ( Enterococcus faecalis ) genome, with double restriction sites of SpeI and EcoRI at both ends of the V583ADC gene fragment. Subsequently, the gene fragment V583ADC was ligated with the expression vector pFS91G (the full sequence of the vector is shown in SEQ ID No. 109) that had been similarly double-digested by T4 DNA ligase (product of Takara) at 16°C overnight to obtain a ligation solution V583ADC.

[0163] The ligation solution V583ADC was transformed into DH5α competent cells (product of Beijing Qingke Biotechnology Co., Ltd.) and sequenced to obtain the positive recombinant plasmid pFS91G-V583ADC. Structural description of the recombinant plasmid pFS91G-V583ADC: The recombinant plasmid was obtained by replacing the small fragment between the restriction sites SpeI and EcoRI of the expression vector pFS91G with the V583ADC gene fragment shown in SEQ ID No.9.

[0164] The positive recombinant plasmid pFS91G-V583ADC was transformed into the expression host bacterium Escherichia coli BL21 (DE3) (Beijing Qingke Biotechnology Co., Ltd.) to obtain the prokaryotic expression strain pFS91G-V583ADC-BL21 (DE3).

[0165] Using the recombinant plasmid pFS91G-V583ADC as a DNA template and the sequences in Table 2 as primers, a single mutant plasmid with a mutant gene was obtained by site-directed mutagenesis. The specific operation is as follows:

[0166] Using the wild-type recombinant plasmid pFS91G-V583ADC as a template, PCR amplification was performed using the primer pair S126M-F / S126M-R and the primer pair S126I-F / S126I-R in Table 2, respectively.

[0167]

[0168] Note: Underlined characters indicate mutation sites.

[0169] The PCR amplification reaction system was as follows (total volume was 50 μL): ApexHFHS DNA 2× 25 μL, forward primer (10 pM) 1.5 μL, reverse primer (10 pM) 1.5 μL, wild-type recombinant plasmid pFS91G-V583ADC (100 ng / μL) 1 μL, and water 22 μL.

[0170] The PCR amplification reaction conditions were as follows: 98°C for 10 min, 98°C for 10 s, 55°C for 30 s, 72°C for 4 min, 35 cycles, 72°C for 10 min, and 4°C insulation.

[0171] After the PCR amplification reaction was completed, 1.5 μL Dpn I (20 U / μL) was added to the PCR reaction solution and reacted at 37°C for 3 h.

[0172] After sequencing verification, the recombinant plasmids pFS91G-V583ADC-S126M and pFS91G-V583ADC-S126I were obtained according to the different mutation sites.

[0173] Then, the recombinant plasmid pFS91G-V583ADC-S126M was used as a DNA template, the sequences in Table 3 were used as primers, and site-directed mutagenesis was used to obtain a double mutant plasmid with a mutant gene. The specific operation is as follows:

[0174] Using the recombinant plasmid pFS91G-V583ADC-S126M as a template, PCR amplification was performed using the primers in Table 3.

[0175]

[0176] Note: Underlined characters indicate mutation sites.

[0177] The PCR amplification reaction system was as follows (total volume was 50 μL): ApexHFHS DNA 2× 25 μL, forward primer (10 pM) 1.5 μL, reverse primer (10 pM) 1.5 μL, recombinant plasmid pFS91G-V583ADC-S126M (100 ng / μL) 1 μL, and water 22 μL.

[0178] The PCR amplification reaction conditions were as follows: 98°C for 10 min, 98°C for 10 s, 55°C for 30 s, 72°C for 4 min, 35 cycles, 72°C for 10 mins, and 4°C insulation.

[0179] After the PCR amplification reaction was completed, 1.5 μL Dpn I (20 U / μL) was added to the PCR reaction solution and reacted at 37°C for 3 h.

[0180] After sequencing verification, the recombinant plasmids pFS91G-V583ADC-S126M-N100A, pFS91G-V583ADC-S126M-N100T, pFS91G-V583ADC-S126M-N100Y, pFS91G-V583ADC-S126M-N100I, pFS91G-V583ADC-S126M-N100V, pFS91G-V583ADC-S126M-N100L, and pFS91G-V583ADC-S126M-A123I were obtained according to the different mutation sites.

[0181] The structure of the recombinant plasmid pFS91G-V583ADC-S126M-N100A is described as follows: the recombinant plasmid is obtained by replacing the V583ADC S126M-N100A gene fragment with a small fragment between the restriction sites SpeI and EcoRI of the expression vector pFS91G, and the sequence of the V583ADC S126M-N100A gene fragment is the sequence obtained by replacing the nucleotides at positions 376-378 of SEQ ID No.9 with ATG, and replacing the nucleotides at positions 298-300 with GCG. Structural description of the recombinant plasmid pFS91G-V583ADC-S126M-N100V: The recombinant plasmid obtained by replacing the V583ADC S126M-N100V gene fragment with a small fragment between the restriction sites SpeI and EcoRI of the expression vector pFS91G, the sequence of the V583ADC S126M-N100V gene fragment is the sequence obtained by replacing the nucleotides at positions 376-378 of SEQ ID No.9 with ATG, and replacing the nucleotides at positions 298-300 with GTG.

[0182] The obtained different mutant plasmids were transformed into Escherichia coli DH5α respectively, and the correctly sequenced plasmids were transformed into Escherichia coli GD05 to obtain the 3-amino-1-propanol production strain GD05-pFS91G-TyrADC (mutant).

[0183] At the same time, a wild-type control in which pFS91G-V583ADC was introduced into E. coli GD05 was set up, and the resulting strain was named GD05-pFS91G-TyrADC (wild-type).

[0184] Example 3: Preparation of crude enzyme solution of tyrosine decarboxylase mutant

[0185] The strains GD05-pFS91G-TyrADC (mutant) and GD05-pFS91G-TyrADC (wild type) constructed in Example 2 were inoculated into 5 mL of 2YT liquid culture medium (formula: 0.5% NaCl, 1% yeast extract, 1.6% tryptone) with a final concentration of 50 μg / ml gentamicin, respectively, and cultured at 37° C. and 220 rpm overnight with shaking. Then, they were inoculated into 100 mL of 2YT liquid culture medium containing a final concentration of 50 μg / ml gentamicin at a ratio of 1% (V / V), and cultured at 37° C. and 220 rpm for 2 h, and then induced at 25° C. and 220 rpm for 12 h to obtain the induced tyrosine decarboxylase mutant bacterial liquid and wild type bacterial liquid, respectively.

[0186] The induced tyrosine decarboxylase mutant bacterial liquid and wild-type bacterial liquid were centrifuged at 4°C and 6000rpm for 10 min, respectively. The cells were collected, suspended in 50mM phosphate (dipotassium hydrogen phosphate and potassium dihydrogen phosphate) pH 7.0 buffer, and ultrasonically disrupted (200W, 5s / 7s, 20min) to obtain tyrosine decarboxylase mutant crude enzyme liquid and wild-type crude enzyme liquid.

[0187] Example 4: Catalytic activity detection of wild-type and various mutant tyrosine decarboxylases

[0188] L-homoserine was added to each crude enzyme solution prepared in Example 3. In the reaction system of 50 mM phosphate (dipotassium hydrogen phosphate and potassium dihydrogen phosphate) pH 7.0, the concentration of the crude tyrosine decarboxylase enzyme solution was 20 OD / mL (wherein, 20 OD means that the biomass of the recombinant bacteria corresponding to the crude tyrosine decarboxylase enzyme solution is OD600=20. OD600 represents the biomass of bacteria. The OD600 value refers to the absorbance value at a wavelength of 600 nm, which is usually used to indicate the bacterial concentration in the bacterial liquid culture solution), and the concentration of L-homoserine was 10 mM. The mixed solution was catalyzed at 37°C and 220 rpm for 12 h to obtain a conversion solution.

[0189] After the catalytic reaction is completed, the conversion solution obtained above is heat-treated in a boiling water bath at 80°C for 10 minutes, and after the heat treatment is completed, it is centrifuged at 4°C and 12,000 rpm for 5 minutes to obtain the supernatant. The supernatant is derivatized with DNFB (2,4-dinitrofluorobenzene) and the content of 3-amino-1-propanol is detected by HPLC.

[0190] DNFB derivatization method: take 50μl sample, 20μl 1M sodium bicarbonate, 80μl DNFB derivatization agent, mix well and place at 60℃ for 30min, take out after 30min and add 50μl 1M hydrochloric acid, mix well and centrifuge at 12000rpm for 5min, take out the supernatant and filter through 0.22μM filter membrane, collect the filtrate for HPLC detection of 3-amino-1-propanol content. HPLC uses RP-C18 column, mobile phase: 35% acetonitrile + 65% 0.1% formic acid solution (% indicates volume percentage), flow rate is 0.7ml / min, column temperature is 25℃, injection is 10μl, detection wavelength is 360nm.

[0191] The results show:

[0192] like Figure 1 As shown, the retention time of the L-homoserine standard is 8.28 min.

[0193] like Figure 2 As shown, the retention time of the 3-amino-1-propanol standard is 12.83 min.

[0194] like Figure 3 As shown, there are peaks with retention times of 8.216 min and 12.79 min in the conversion solution, indicating that 3-amino-1-propanol was generated using L-homoserine as a substrate.

[0195] The experiment was repeated three times and the average value was taken. After screening and verification, the mutation status, conversion rate and mutation site of tyrosine decarboxylase wild type and mutants are summarized in Table 4. The results showed that the enzyme activity of tyrosine decarboxylase double mutants S126M-N100A and S126M-N100V was significantly improved compared with the wild type.

[0196]

[0197] Example 5: Fermentation of recombinant strains to produce 3-amino-1-propanol

[0198] A single colony of the recombinant bacteria (GD05-pFS91G-V583ADC-S126M-N100A strain) obtained by introducing the recombinant plasmid pFS91G-V583ADC-S126M-N100A into the GD05 strain constructed in Example 2 was inoculated into LB medium and cultured overnight at 37°C. The overnight culture solution was inoculated at a 1% (V / V) inoculation amount into 100 mL LB liquid medium containing 50 μg / mL gentamicin and the seeds were cultured at 37°C for 8 hours. The obtained seed solution was inoculated at a 5% (v / v) inoculation amount into 2L fermentation medium and fermented in a 5L fermenter for 60 hours. The formula of the fermentation medium is: 4g / L (NH4)2HPO4, 6g / L KH2PO4, 1.8g / L citric acid monohydrate, 2g / L magnesium sulfate heptahydrate, 2g / L yeast powder, 0.8g / L lysine, 0.4g / L threonine, 0.25g / L methionine, 0.4g / L isoleucine, 20g / L glucose monohydrate. The pH is controlled at 6.8-7.2, the dissolved oxygen is controlled at 25%-30%, and the residual sugar is controlled below 2g / L.

[0199] Agilent HPLC (Agilent 1260 series; Agilent Technologies, Santa, Clara, CA, USA) equipped with Agilent extended-C18 5.0 μm (4.6×250 mm) column was used to detect the yield of 3-amino-1-propanol. The column temperature was 25°C. Mobile phase A was 0.1% (v / v) formic acid in water, mobile phase B was acetonitrile, A:B ratio (v / v) was 65:35, and the flow rate was 1.0 mL / min. The fermentation broth was diluted 100 times and derivatized with 2,4-dinitrobenzene at 60°C for 30 minutes (see the relevant steps in Example 4), then filtered through a 0.22 μm polyethersulfone (PES) membrane and loaded for detection. The absorbance at 360 nm was measured using a diode array detector (DAD). A regression curve of peak area versus concentration was established using 3-amino-1-propanol standards.

[0200] The fermentation results are as follows Figure 4 As shown in the figure, after the recombinant plasmid pFS91G-V583ADC-S126M-N100A was introduced into the GD05 strain, the L-homoserine production was 0.28 mM and the 3-amino-1-propanol production was 18.07 mM after 60 hours of high-density fermentation.

[0201] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. A tyrosine decarboxylase mutant, which is mutant 1 or mutant 2; The mutant 1 is as follows (A1) or (A2): (A1) a protein obtained by replacing the 126th amino acid residue of tyrosine decarboxylase from S to M and the 100th amino acid residue from N to A; (A2) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of the protein defined in (A1); The mutant 2 is as follows (B1) or (B2): (B1) a protein obtained by replacing the 126th amino acid residue of tyrosine decarboxylase from S to M and the 100th amino acid residue from N to V; (B2) a fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of the protein defined in (B1); The tyrosine decarboxylase is a protein as shown in SEQ ID No.

1.

2. A nucleic acid molecule encoding the tyrosine decarboxylase mutant according to claim 1.

3. The nucleic acid molecule according to claim 2, characterized in that: The sequence of the nucleic acid molecule encoding the mutant 1 is as follows (C1) or (C2): (C1) a sequence obtained by replacing nucleotides 376 to 378 of SEQ ID No. 9 with ATG, and replacing nucleotides 298 to 300 with GCG; (C2) a sequence obtained by connecting a protein tag coding sequence to the 5' end and / or 3' end of the nucleic acid molecule defined in (C1); or The sequence of the nucleic acid molecule encoding the mutant 2 is as follows (D1) or (D2): (D1) a sequence obtained by replacing nucleotides 376 to 378 of SEQ ID No. 9 with ATG, and replacing nucleotides 298 to 300 with GTG; (D2) The sequence obtained by connecting the coding sequence of the protein tag to the 5' end and / or 3' end of the nucleic acid molecule defined in (D1).

4. Any of the following biological materials: (I) an expression cassette containing the nucleic acid molecule according to claim 2 or 3; (II) a recombinant vector containing the nucleic acid molecule of claim 2 or 3; (III) A recombinant bacterium containing the nucleic acid molecule according to claim 2 or 3.

5. The biomaterial according to claim 4, characterized in that: The recombinant bacteria is recombinant Escherichia coli.

6. The biomaterial according to claim 5, characterized in that: The recombinant Escherichia coli is prepared according to a method comprising the following steps: introducing the nucleic acid molecule according to claim 2 or 3 into a recipient Escherichia coli to obtain the recombinant Escherichia coli.

7. The biomaterial according to claim 6, characterized in that: The recipient Escherichia coli is an Escherichia coli capable of synthesizing L-homoserine.

8. The biomaterial according to claim 7, characterized in that: The recipient Escherichia coli is an Escherichia coli that can synthesize L-homoserine by utilizing glucose.

9. Use of the tyrosine decarboxylase mutant according to claim 1, the nucleic acid molecule according to claim 2 or 3, or the biomaterial according to any one of claims 4 to 8 in the production of 3-amino-1-propanol.

10. A method for producing 3-amino-1-propanol, characterized in that: The method is the following method I or method II: Method I: Whole-cell catalytic method, comprising the following steps: fermenting and culturing the recombinant bacteria described in any one of claims 4 to 8 to obtain 3-amino-1-propanol from the fermentation product; Method II: in vitro catalytic method, comprising the following steps: using L-homoserine as substrate, utilizing the tyrosine decarboxylase mutant of claim 1 or a crude enzyme solution containing the tyrosine decarboxylase mutant to perform in vitro catalysis, thereby obtaining 3-amino-1-propanol.

Images