Application of CsPNRC1 gene and encoded protein thereof in regulation and control of fusarium wilt resistance of cucumbers

Abstract

The invention discloses an application of a CsPNRC1 gene and a protein encoded by the CsPNRC1 gene in regulation and control of fusarium wilt resistance of cucumbers. The nucleotide sequence of the CsPNRC1 gene is shown as SEQ ID NO.1, and the sequence of the protein encoded by the CsPNRC1 gene is shown as SEQ ID NO.2; according to the invention, a germplasm material edited and overexpressed by the cucumber CsPNRC1 gene is constructed for the first time, and functional research finds that the low expression of the cucumber gene CsPNRC1 can improve the resistance of cucumber fusarium wilt and the overexpressed cucumber gene CsPNRC1 can significantly improve the morbidity of the cucumber fusarium wilt, so that the gene disclosed by the invention plays a key role in regulating and controlling the fusarium wilt resistance process.

Description

Technical Field

[0001] The invention belongs to the fields of genetic engineering and molecular biology, and in particular relates to application of a CsPNRC1 gene and a protein encoded therein in regulating resistance of cucumber to wilt disease. Background Art

[0002] Due to the continuous expansion of the area of ​​greenhouse cucumber cultivation and the resulting soil continuous cropping disorder phenomenon, wilt disease has become the most prominent manifestation of continuous cropping disorder, seriously restricting the high-quality, safe and efficient cultivation of cucumbers. In severe cases, it can lead to complete failure of cucumber production (Delgado-Baquerizo et al., 2020; Naguib et al., 2021; Lian et al., 2023).

[0003] Cucumber wilt is a devastating soil-borne fungal disease caused by Fusarium oxysporum f.sp.cucumerinum (Foc). The disease spreads quickly and can adapt to various environments. It grows fastest at 23-29°C and grows faster in acidic soil or areas affected by nematodes (Cohen et al., 2015; Wang et al., 2023). The pathogen can produce thick-walled spores that can survive in the soil for many years (Sun et al., 2015; Uddin et al., 2023). The continuous cropping of cucumbers causes the base number of pathogens in the soil to increase continuously, and the occurrence of the disease worsens year by year. The disease can occur at all stages of cucumber growth and development. The incidence rate is highest in the middle and late stages of growth due to the decline in growth potential. It is also called the "cancer" of cucumber (Shen et al., 2017; Zhang et al., 2023). Therefore, the prevention and control of cucumber wilt has become a problem that needs to be solved urgently. Summary of the invention

[0004] Purpose of the invention: In order to solve the above technical problems, the present invention aims to provide a gene CsPNRC1 for regulating cucumber resistance to Fusarium wilt, which can effectively regulate the resistance of cucumber to Fusarium wilt and significantly reduce the incidence of Fusarium wilt.

[0005] Technical solution: In order to achieve the above-mentioned purpose, the present invention provides a gene CsPNRC1 for regulating cucumber wilt resistance, and the nucleotide sequence of the gene CsPNRC1 is shown in SEQ ID NO.1.

[0006] Furthermore, the primer pair used to amplify the gene CsPNRC1 is:

[0007] CsPNRC1-F: 5'-CTTACGCCACCAAGGATT-3',

[0008] CsPNRC1-R: 5'-ACGGCAAGGGCACCGAACT-3'.

[0009] The amino acid sequence of the protein encoded by the cucumber wilt resistance gene CsPNRC1 of the present invention is shown in SEQ ID NO.2.

[0010] The invention discloses a gene knockout vector pCambia1301-CsPNRC1 for regulating the cucumber wilt disease resistance gene CsPNRC1.

[0011] Furthermore, the knockout vector pCambia1301-CsPNRC1 is constructed by using the nucleotide sequence of the CsPNRC1 gene as a template, designing target primers for amplification of CsPNRC1, and subjecting the obtained product to a recombination reaction with a pCambi a3101 modified vector that has been digested with enzymes. The sequence of the pCambia3101 modified vector is shown in SEQ ID NO.3. Through transformation and plasmid extraction, the gene knockout vector pCambia1301-CsPNRC1 is finally obtained.

[0012] The invention discloses an overexpression vector pCambia1391-CsPNRC1 for regulating the cucumber wilt disease resistance gene CsPNRC1.

[0013] Furthermore, the overexpression vector pCambia1391-CsPNRC1 is constructed by amplifying the gene CsPNRC1, enzymatically connecting it to the pCambia1391 vector, and then transforming it by Escherichia coli and Agrobacterium tumefaciens, extracting the plasmid, and finally obtaining the overexpression vector pCambia1391-CsPNRC1.

[0014] The application of the gene CsPNRC1 or the protein or the gene knockout vector or the overexpression vector in regulating the resistance of cucumber to Fusarium wilt disease.

[0015] Furthermore, by editing the cucumber CsPNRC1 gene in cucumber, its resistance to Fusarium wilt disease was increased and its susceptibility to the disease was reduced; by overexpressing the cucumber CsPNRC1 gene, its resistance to Fusarium wilt disease was reduced and its susceptibility to the disease was increased.

[0016] The invention discloses an application of the cucumber wilt resistance gene CsPNRC1 or the protein or the gene knockout vector or the overexpression vector in cultivating wilt resistance cucumber germplasm.

[0017] The cucumber CsPNRC1 gene is used to construct CsPNRC1 cucumber gene-edited transgenic materials, which can disable the function of proline-rich nuclear receptor coactivators, thereby improving resistance to wilt disease.

[0018] The present invention provides the cucumber CsPNRC1 gene sequence and the protein sequence encoded by it, constructs the cucumber CsPNRC1 gene-edited transgenic material for the first time, and conducts functional studies, and finds that the gene plays a regulatory role in the process of resistance to Fusarium wilt.

[0019] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages:

[0020] The present invention proposes for the first time the application of CsPNRC1 gene and its encoded protein in regulating the resistance of cucumber to Fusarium wilt. The transgenic technology is used to construct CsPNRC1 gene editing and overexpression transgenic materials, and the function of CsPNRC1 gene is explored. The experiment proves that the expression of CsPNRC1 in cucumber gene editing transgenic strains is significantly lower than WT, but the resistance is significantly better than WT; while the overexpression transgenic strains show the opposite result, indicating that the gene plays a negative regulatory role in the resistance of cucumber to Fusarium wilt. The discovery of the new function of this gene in cucumber provides a new idea and theoretical basis for the innovation of cucumber Fusarium wilt resistant germplasm materials, and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is a diagram of the cucumber CsPNRC1 gene editing expression vector;

[0022] Figure 2 This is the cucumber CsPNRC1 gene overexpression vector map;

[0023] Figure 3 The CsPNRC1 gene-edited material of cucumber regulates resistance to Fusarium wilt, where: Figure a shows the process of transgenic plant construction; Figure b shows the sequence differences between different genotypes (KO) and wild type (WT) of cucumber CsPNRC1 gene-edited transgenics; Figure c shows the phenotypic differences between cucumber CsPNRC1-KO and WT strains inoculated with Fusarium wilt; Figure d shows the expression levels of CsPNRC1 in three genotypes of edited materials and WT; Figure e shows the disease level of cucumber CsPNRC1-KO and WT strains after inoculation with Fusarium wilt;

[0024] Figure 4 The CsPNRC1 gene overexpression material in cucumber regulates resistance to Fusarium wilt, where: Figure a shows the expression level of CsPNRC1 in five overexpression materials and WT; Figure b shows the phenotypic difference between cucumber CsPNRC1-OE (3-3) and WT strains inoculated with Fusarium wilt; Figure c shows the disease level of cucumber CsPNRC1-OE (3-3) and WT strains inoculated with Fusarium wilt;

[0025] Figure 5To regulate the resistance to Fusarium wilt in cucumber CsPNRC1 gene overexpression and gene editing transgenic materials;

[0026] Figure 6 The attachment of Fusarium wilt to the root epidermis of cucumber CsPNRC1 transgenic materials and WT. DETAILED DESCRIPTION

[0027] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0028] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources. Experimental methods without specific conditions specified in the examples are usually carried out under conventional conditions or under conditions recommended by the manufacturer.

[0029] The materials of the present invention, the cucumber inbred line 'Chinese Dragon' (Chinese Dragon / 9930) and the cucumber wilt strain Foc (Fusarium oxysporum f.sp.cucumerinum), have been published in an article in 2017, entitled "Isolation and Identification of Cucumber Wilt Pathogen and Analysis of Variety Resistance Differences" in the Journal of Molecular Plant Breeding (Dong Jingping et al., 2017).

[0030] The pCambia1391 vector was purchased from Shanghai Zeye Biotechnology Co., Ltd.

[0031] Example 1

[0032] Obtaining the full-length sequence of cucumber CsPNRC1 gene

[0033] Using the root cDNA of the susceptible cucumber inbred line 'Chinese Dragon' (Chinese Dragon / 9930) as a template, cloning primers CsPNRC1-F and CsPNRC1-R were designed and PCR amplification was performed using a high-fidelity DNA polymerase.

[0034] The primer sequences are:

[0035] CsPNRC1-F: 5'-CTTACGCCACCAAGGATT-3' ,

[0036] CsPNRC1-R: 5'-ACGGCAAGGGCACCGAACT-3' 。

[0037] The PCR system was 50 μL in total: 2×PhantaFlash Master Mix 25 μL, template 2 μL, upstream and downstream primers 2 μL each, ddH2O 19 μL. The PCR reaction program was: 98°C pre-denaturation for 30 seconds; 98°C denaturation for 10 seconds, 60°C annealing for 5 seconds, 72°C extension for 2 minutes, a total of 35 cycles; and finally 72°C extension for another 1 minute. The obtained PCR reaction product was identified by 1% agarose gel electrophoresis, and then the target band was purified by Takara's gel recovery kit, and the product was connected to the PMD19-T vector (Takara), and the above recombinant plasmid was sent for testing.

[0038] The nucleotide sequence of the CsPNRC1 gene is shown in SEQ ID No.1; the amino acid sequence encoded by the gene is shown in SEQ ID No.2.

[0039] Example 2

[0040] Construction and detection of cucumber CsPNRC1 gene-edited transgenic materials

[0041] 1. Steps for constructing a knockout vector using the cucumber CsPNRC1 gene:

[0042] Using the nucleotide sequence of the CsPNRC1 gene (SEQ ID No. 1) as a template, target primers were designed: pCambia3101-CsPNRC1-F1: GAATTTCGCCGAGAACTCAACGG; pCambia3101-CsPNRC1-R1: ACCGTCAAGCTAACAGAGAGCGG for amplification; the resulting product was recombined with the pC ambia3101 transformation vector digested with AluI and BarI by a homologous recombinase (ClonExpress Ultra One Step Cloning Kit) to construct a knockout vector. The pCambia3101 transformation vector is a vector transformed with the vector pCambia3101 plasmid as the basic skeleton, and its sequence is shown in SEQ ID NO.3, which was constructed and synthesized by Weimi Biotechnology (Suzhou) Co., Ltd. The recombinant product was transformed into Escherichia coli DH5α competent cells, and the positive clones were screened by bacterial culture medium with Kan+ resistance and colony PCR. The identification primers were: pCambia3101-CsPNRC1-F2: AGACGAAGA AGGCGACACTT; pCambia3101-CsPNRC1-R2: CAAGTCGTAGCAACCGCCTA. After sequencing verification of the positive clones at a biological sequencing company, the knockout vector pCambia1301-CsPNRC1( Figure 1). After sequencing was correct, the plasmid was extracted (Novagen, RapidLyse PlasmidMini Kit).

[0043] The successfully constructed pCambia1301-CsPNRC1 vector was transferred into the competent cell of Agrobacterium EHA105, and the monoclonal strain with correct sequencing was selected for shaking for use; the cotyledons of 9930 cucumbers germinated for 2 days were used as materials, placed in the Agrobacterium suspension at room temperature for 30 minutes for infection, and after the infection, the explants were placed in the co-culture medium and cultured in the dark at 23°C for 3 days; then transferred to the rest culture medium and cultured in the light at 25°C for 7 days; then transferred to the screening culture medium and cultured for 6 weeks to induce resistant buds, and then transferred to the elongation culture medium and cultured in the light at 25°C for 3-6 weeks until roots were formed, and tissue culture seedlings ( Figure 3 a). The obtained regenerated plants were identified. The identification primers were the vector antibiotic gene AADA, AADA_F:TCCGACATCGATCT CCTGGT; AADA_R:CAGGGTGAGGACCACATTCC; the specific primers designed for the CsPNRC1 gene, CsPNRC1_T_F:AGACGAAGAAGGCGACACTT; CsPNRC1_T_R:CAAGTCGTAG CAACCGCCTA. Finally, 8 transgenic positive plants were obtained. After sequencing, 3 transgenic knockout lines were found ( Figure 3 b) T2 generation plants were obtained through self-pollination of individual plants and named KO6.1_line1, KO6.1_line2, and KO6.1_line3 for subsequent experimental analysis.

[0044] 2. The steps for constructing the overexpression vector are as follows:

[0045] Homologous recombination primers were designed using the overexpression vector pCambia1391 sequence and the nucleotide sequence of the above-mentioned target gene (SEQ ID No. 1), the sequences of which were: pCambia1391-CsPNRC1-F: 5'-tgggcccggcgcgccaagcttATGGCAACCGTGATTCTTCCG-3'; pCambia1391-CsPNRC1-R: 5'-cggggatccgtcgacctgcagTCATTCTAAATCAAGTCGTAGCAACC-3'. Amplification was performed using the nucleotide sequence (SEQ ID No. 1) as a template, and the amplified product was electrophoresed by agarose gel and recovered from the gel for later use. The vector was linearized using restriction endonucleases HindIII and PstI, and the vector was constructed using the Novogene recombination kit system. 5 μL of the recombinant product was transferred into the competent E. coli DH5α. The colonies were verified by PCR with the help of recombination primers (pCambia1391-CsPNRC1-F and pCambia1391-CsPNRC1-R), and the correct bacterial solution was selected for testing, and then transferred into the competent Agrobacterium EHA105. The Agrobacterium bacterial solution with the correct sequence was also verified by colony PCR for the next transformation experiment. The vector was as follows Figure 2 shown.

[0046] The cotyledons of "9930" cucumbers that had germinated for 2 days were placed in 50 mL of correctly sequenced Agrobacterium suspension cultured to the logarithmic phase and placed at room temperature for 30 minutes for infection. After the infection, the treated explants were placed in a co-culture medium and cultured in the dark at 23°C for 3 days. After co-culture, the explants were transferred to a resting medium and cultured in light at 25°C for 7 days. They were then placed on a screening medium and cultured for 6 weeks to induce resistant buds. They were then transferred to an elongation medium and cultured in light for 3-6 weeks. They were cultured under light until roots formed and then transplanted into a plug tray for detection of the T0 plants. The detection primers were: AADA_F:TCCGACATCGATCTCCTGGT; AADA_R:CAGGGTGAGGACCACATTCC. The positively identified plants were propagated and 5 transgenic positive plants were finally obtained, named OE 1-1 , OE 3-2 , OE 3-3 , OE 8-1 , OE 8-2 , T2 generation plants were obtained through self-pollination of individual plants for subsequent experimental analysis.

[0047] Example 3

[0048] Study on regulating resistance to Fusarium wilt by editing CsPNRC1 gene in cucumber transgenic materials

[0049] Based on the sequence after the R-terminal primer of the CsPNRC1 editing target, qRT-PCR primers were designed, CsPNRC1_qPCR_F:GTGATGATTCTTGTGGTAA, CsPNRC1_qPCR_R:ATCCTTGAAGTCCGTTAA, and qRT-PCR technology was used to verify the expression level of CsPNRC1 in gene-edited transgenic plants and WT. The results showed that the expression level of CsPNRC1 gene in the three transgenic lines was significantly lower than that in WT plants, among which KO6.1_line1 had the lowest expression level, which can be used as a follow-up research material for further experiments ( Figure 3 d).

[0050] In order to further analyze the role of CsPNRC1 gene in the resistance of cucumber to Fusarium wilt, three genotypes edited with CsPNRC1 gene were selected for sowing. Each seedling was inoculated with spore suspension of Fusarium wilt fungus Foc by root irrigation at the stage of two leaves and one heart. Each seedling was inoculated with 5 mL (concentration of 1×10 6 spores / mL), and the disease grade was counted and the disease index was calculated 10 days after inoculation. The results showed that WT had dead plants 10 days after inoculation, while only a few gene-edited materials showed the phenotype of browning at the base of the stem of Fusarium wilt. With the extension of inoculation time, the incidence of WT increased, indicating that CsPNRC1 gene editing can significantly improve the resistance of cucumber Fusarium wilt ( Figure 3 c, Figure 3 e).

[0051] Based on the above qRT-PCR sequence, select OE with the highest expression level of CsPNRC1 gene 3-3 The strains were sown with WT plants ( Figure 4 a) Each seedling was inoculated with a suspension of Fusarium wilt Foc spores at the two-leaf and one-heart stage. The inoculation method was the same as that used in the verification of gene-edited materials. Each seedling was inoculated with 5 mL (concentration of 1×10 6 spores / mL), and 10 days after inoculation, the overexpression plants had severely wilted, and even multiple dead plants appeared, which was more serious than WT ( Figure 4 b, c).

[0052] In order to clarify the function of CsPNRC1 and determine the resistance of gene-edited and overexpressed plants to Fusarium wilt, gene-edited transgenic material CsPNRC1-KO6.1_line1 and overexpressed transgenic material CsPNRC1-OE were sown at the same time. 3-3 The WT and WT were inoculated with Fusarium wilt at the two-leaf and one-heart stage. The inoculation method was the same as that used in the verification of the gene-edited materials. Each seedling was inoculated with 5 mL (concentration of 1×10 6 spores / mL), observations were made and disease levels were recorded on days 10 and 15 after inoculation ( Figure 5) and found that on the 10th day after inoculation, WT plants became diseased, most of the overexpression materials had severe wilting, while the gene-edited materials showed no symptoms.

[0053] The wilt pathogen infects the roots. To further determine the function of CsPNRC1, the roots of gene-edited, overexpressed, and WT plants at the two-leaf-one-heart stage were washed and placed in an equal amount of spore suspension (1×10 6 spores / mL), and the root epidermis was collected for observation at 24h, 48h, and 96h. It was found that the root epidermis of the overexpression plant began to be enriched with a large number of hyphae at 24h, WT had a small amount of enrichment, and no hyphae and spores were found in the root epidermis of the gene-edited plant; as time went on, the root epidermis of the overexpression plant and WT was enriched with more and more hyphae, and the root epidermis of the gene-edited plant was basically free of spores and hyphae ( Figure 6 ).

[0054] In summary, the experiments proved that the expression of CsPNRC1 in cucumber gene-edited transgenic lines was significantly lower than that in WT, but the resistance was significantly better than that in WT; while the opposite result was shown in the overexpression transgenic lines, indicating that this gene plays a negative regulatory role in the resistance of cucumber to Fusarium wilt. The discovery of the new function of this gene in cucumber provides new ideas and theoretical basis for the innovation of cucumber Fusarium wilt-resistant germplasm materials, and has good application prospects.

Claims

1. A method for regulating the cucumber wilt resistance gene CsPNRC1, characterized in that: The nucleotide sequence of the gene CsPNRC1 is shown in SEQ ID NO.

1.

2. The method for regulating the cucumber wilt resistance gene CsPNRC1 according to claim 1, characterized in that: The primer pair used to amplify the gene CsPNRC1 is: CsPNRC1-F: 5'-CTTACGCCACCAAGGATT-3', CsPNRC1-R: 5'-ACGGCAAGGGCACCGAACT-3'.

3. A protein encoded by the cucumber wilt resistance gene CsPNRC1 according to claim 1, characterized in that: The amino acid sequence of the protein is shown in SEQ ID NO.

2.

4. A gene knockout vector pCambia1301-CsPNRC1 for regulating the cucumber wilt resistance gene CsPNRC1 according to claim 1.

5. The gene knockout vector pCambia1301-CsPNRC1 according to claim 4, characterized in that: The knockout vector pCambia1301-CsPNRC1 is constructed by using the nucleotide sequence of the CsPNRC1 gene as a template, designing target primers for amplification of CsPNRC1, and subjecting the obtained product to a recombination reaction with a pCambia3101 modified vector that has been digested with enzymes. The sequence of the pCambia3101 modified vector is shown in SEQ ID NO.

3. The gene knockout vector pCambia1301-CsPNRC1 is finally obtained by transformation and plasmid extraction.

6. An overexpression vector pCambia1391-CsPNRC1 containing the cucumber wilt resistance regulating gene CsPNRC1 according to claim 1.

7. The overexpression vector pCambia1391-CsPNRC1 according to claim 6, characterized in that: The overexpression vector pCambia1391-CsPNRC1 is constructed by amplifying the gene CsPNRC1, enzymatically connecting it to the pCambia1391 vector, and then transforming and extracting the plasmid to finally obtain the overexpression vector pCambia1391-CsPNRC1.

8. Use of the gene CsPNRC1 according to claim 1, or the protein according to claim 3, or the gene knockout vector according to claim 4, or the overexpression vector according to claim 6 in regulating resistance to cucumber wilt disease.

9. The use according to claim 8, characterized in that: By editing the cucumber CsPNRC1 gene, the resistance to Fusarium wilt disease was increased and the susceptibility to the disease was reduced; by overexpressing the cucumber CsPNRC1 gene, the resistance to Fusarium wilt disease was reduced and the susceptibility to the disease was increased.

10. Use of the cucumber wilt resistance gene CsPNRC1 according to claim 1, or the protein according to claim 3, or the gene knockout vector according to claim 4, or the overexpression vector according to claim 6 in cultivating wilt-resistant cucumber germplasm.

Images