SSR molecular marker primer group for identifying dracaena dracaena variety and application of SSR molecular marker primer group

Abstract

The invention belongs to the technical field of biology, and particularly relates to an SSR molecular marker primer group for identifying dracaena dracaena varieties and application of the SSR molecular marker primer group. The SSR molecular marker primer group totally contains 16 pairs of primers, the polymorphic information indexes (PIC) of the 16 pairs of primers are all greater than 0.6, the number of repetitive units is 3-5, and the number of repetitive times is 5-7. The SSR primer provided by the invention has the characteristics of high amplification efficiency, stable amplification result, good polymorphism, strong specificity and the like. By utilizing the SSR molecular marker primer group, not only can different dragon tree varieties and dragon tree species be identified, but also the dragon's blood raw material can be subjected to traceability detection. The method disclosed by the invention has important technical guidance significance for development and utilization of the dragon's blood medicinal material and breeding of fine dragon tree varieties.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a primer set of SSR molecular markers for identifying dracaena varieties and an application thereof. Background Art

[0002] Dragon's Blood is a traditional precious Chinese medicine with the effects of promoting blood circulation and dispersing stasis, relieving pain, promoting tissue regeneration and healing sores. It has a history of application of thousands of years. According to literature records, the plants of the genus Dracaena distributed in Africa are the earliest plant sources of Dragon's Blood. The original plants of Dragon's Blood produced in China are the plants of the genus Dracaena, Hainan Dracaena (D.cambodiana Pierreex Gagnep) and Dracaena cochinchinensis (Lour.) SCChen. In addition, the dragon's blood trees from other species of the genus Dracaena in Southeast Asia are also important sources of Dragon's Blood.

[0003] Due to the increasing demand for dragon's blood medicinal materials, the predatory logging of its resource plants and the destruction of the ecological environment, the wild dragon blood tree resources are on the verge of extinction. At present, Hainan dragon blood tree and sword-leaved dragon blood tree are both listed as national second-level rare and endangered plants. The Socotra dragon blood tree (D.cinnabariBalf.F.) native to Africa is also on the verge of extinction. The method of "cutting trees to extract resin" in Southeast Asia has been banned by the country. At present, the protection of wild dragon blood trees in various countries around the world has changed from simple protection to protection and cultivation.

[0004] According to the survey, the artificially cultivated dragon blood trees in China are mainly Hainan dragon blood trees, and there are also fragrant dragon blood trees, sword-leaved dragon blood trees, black pearls and space iron trees. The dragon blood trees are similar in morphology, and the use of the names of the original plants of dragon blood has always been confusing, which has led to confusion in the source plants of dragon blood medicinal materials on the market, and the main active ingredients have great differences, which has restricted the healthy development of the "dragon blood" industry and caused certain safety hazards in clinical medication. Therefore, it is very necessary to develop a method for accurately identifying dragon blood tree plants, which is not only of great significance for clarifying the original plants of dragon blood medicinal materials, but also for the selection and breeding of excellent varieties of dragon blood trees. Summary of the invention

[0005] In view of the current confusion of Dracaena germplasm resources and the current status of Dracaena microsatellite marker development, the present invention provides the following technical solutions:

[0006] The first aspect of the present invention provides an SSR molecular marker primer set for identifying Dracaena species, the primer set comprising the following 16 pairs of primers:

[0007] The primer pair DSSR-080 includes an upstream primer DSSR-080-F and a downstream primer DSSR-080-R, the sequence of DSSR-080-F is TCTTCGTGGAGGCCCTGATA, and the sequence of DSSR-080-R is GGGGAAGGCAAAGGAGAGAG;

[0008] The primer pair DSSR-050 includes an upstream primer DSSR-050-F and a downstream primer DSSR-050-R, the sequence of DSSR-050-F is CCGACCATGGACAAGAAGCT, and the sequence of DSSR-050-R is AGTTTGCAACCTGGGTTCCA;

[0009] The primer pair DSSR-063 includes an upstream primer DSSR-063-F and a downstream primer DSSR-063-R, the sequence of DSSR-063-F is TCTTGATCTTCCGGCAGCAG, and the sequence of DSSR-063-R is TGCACCTTGGCTTCGTAGAG;

[0010] The primer pair DSSR-174 includes an upstream primer DSSR-174-F and a downstream primer DSSR-174-R, the sequence of DSSR-174-F is AGGCCCACACTTTTCCCAAA, and the sequence of DSSR-174-R is GCCAAACAATAACGAGCCCC;

[0011] The primer pair DSSR-087 includes an upstream primer DSSR-087-F and a downstream primer DSSR-087-R, the sequence of DSSR-087-F is TGGTGAAGATGTTGGCCTCC, and the sequence of DSSR-087-R is AGGGGCAGCACATTTCTCTC;

[0012] The primer pair DSSR-187 includes an upstream primer DSSR-187-F and a downstream primer DSSR-187-R, the sequence of DSSR-187-F is CGCCATGCTCAAGTCCTACT, and the sequence of DSSR-187-R is GACCCACAGCTCATCCATCC;

[0013] The primer pair DSSR-086 includes an upstream primer DSSR-086-F and a downstream primer DSSR-086-R, the sequence of DSSR-086-F is CATGCGGCCATTATTGTGGG, and the sequence of DSSR-086-R is CCACTGCTCTTCCAAGGGAA;

[0014] The primer pair DSSR-056 includes an upstream primer DSSR-056-F and a downstream primer DSSR-056-R, the sequence of DSSR-056-F is GCTTAAAGGGTGTGCTTGGC, and the sequence of DSSR-056-R is GGCTTGCAGGAATTTCTGGC;

[0015] The primer pair DSSR-039 includes an upstream primer DSSR-039-F and a downstream primer DSSR-039-R, the sequence of DSSR-039-F is TTGACGTTCATGTCCCTGCA, and the sequence of DSSR-039-R is AGAAACAGTTCAGCTCGGCA;

[0016] Primer pair DSSR-013 includes an upstream primer DSSR-086-F and a downstream primer DSSR-086-R, the sequence of DSSR-086-F is TGCCCTGTTGTTTTCTTCGT, and the sequence of DSSR-086-R is GTTTGTAGTGCCCACCCTGT;

[0017] The primer pair DSSR-079 includes an upstream primer DSSR-079-F and a downstream primer DSSR-079-R, the sequence of DSSR-079-F is AAAACCATAGCCACGACCGT, and the sequence of DSSR-079-R is GCAGGCCCTGTAGTTGGATT;

[0018] The primer pair DSSR-065 includes an upstream primer DSSR-065-F and a downstream primer DSSR-065-R, the sequence of DSSR-065-F is TCCCTAATGGTACCTCGCCA, and the sequence of DSSR-065-R is GGAGGTTTTTACCGGCAGGA;

[0019] The primer pair DSSR-006 includes an upstream primer DSSR-006-F and a downstream primer DSSR-006-R, the sequence of DSSR-006-F is ATAATCCCCGGAGCTAACGC, and the sequence of DSSR-006-R is TGATTAGGGCGACGGATTGG;

[0020] The primer pair DSSR-026 includes an upstream primer DSSR-026-F and a downstream primer DSSR-026-R, the sequence of DSSR-026-F is ACAAGTGTGAGCCTTGGGAC, and the sequence of DSSR-026-R is TCACGACGATTGATCCACAA;

[0021] The primer pair DSSR-022 includes an upstream primer DSSR-022-F and a downstream primer DSSR-022-R, the sequence of DSSR-022-F is CCACTGTTGGTCATGCTTCT, and the sequence of DSSR-022-R is CAACCTGTTGAGGCAGAGGT;

[0022] The primer pair DSSR-188 includes an upstream primer DSSR-188-F and a downstream primer DSSR-188-R, the sequence of DSSR-188-F is TAGAACGGCACTGAACCCAG, and the sequence of DSSR-188-R is TTCAACAGAACTGCCTGCCA.

[0023] The second aspect of the present invention provides the application of the above-mentioned SSR molecular marker primer set in the genetic analysis of Dracaena germplasm resources.

[0024] The third aspect of the present invention provides a method for genetic analysis of Dracaena germplasm resources, comprising the following steps:

[0025] (1) Extracting DNA from samples to be analyzed: Collecting young leaves of Dracaena and extracting genomic DNA;

[0026] (2) Synthesizing specific fluorescent primers: screening and synthesizing the 16 pairs of primers described in claim 1;

[0027] (3) PCR amplification: using the fluorescent PCR reaction to perform PCR amplification on the genomic DNA in step (1) using the 16 pairs of primers;

[0028] (4) Genetic analysis: The observed allele number, effective allele number, Shannon index, polymorphism information index, observed heterozygosity, expected heterozygosity, and inbreeding coefficient were statistically analyzed. Cluster analysis was performed using the unweighted group average method based on Nei genetic distance to construct a dendrogram of genetic distance cluster analysis.

[0029] A fourth aspect of the present invention provides the use of the above-mentioned SSR molecular marker primer set in identifying different Dracaena varieties and Dracaena species.

[0030] A fifth aspect of the present invention provides a method for identifying a variety of Dracaena, comprising the following steps:

[0031] a. Extracting genomic DNA from Dracaena materials;

[0032] b. Using the DNA obtained in step a as a template, performing PCR amplification using the 16 pairs of primers described in claim 3, and performing capillary electrophoresis analysis on the amplified fragments;

[0033] c. Compare the characteristic fingerprints of the sample to be tested with those of the reference variety, or use the cluster analysis dendrogram described in claim 3 to determine the relationship between the sample to be tested and the reference variety.

[0034] Furthermore, in the step b, the PCR amplification system is: 25 μL, including 2x EcoTaqPCR SuperMix 12.5 μL, 1 μL of forward and reverse primers, 20 ng of DNA template, and finally supplemented with ddH2O; the PCR amplification program is: 95°C pre-denaturation for 5 min; 95°C denaturation for 30 s, 62-52°C gradient annealing for 30 s, 72°C extension for 30 s, and run 10 cycles; 95°C denaturation for 30 s, 52°C annealing for 30 s, 72°C extension for 30 s, and run 25 cycles; 72°C extension for 20 min.

[0035] Beneficial effects of the present invention:

[0036] The 16 pairs of primers provided by the present invention not only have high amplification efficiency and stable amplification results in Dracaena plants, but also have strong discrimination ability for Dracaena plants (PIC>0.6). The above SSR molecular marker primer set can not only identify different Dracaena varieties and Dracaena species, but also perform traceability detection on Dracaena raw materials. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 This is the electrophoresis spotting diagram of 7 sites amplification of 2 samples (some site spots are shown). The order of spots from left to right is: HK4-ZP-LXS080, HK5-ZP-LXS080, HK4-ZP-LXS050, HK5-ZP-LXS050, HK4-ZP-LXS063, HK5-ZP-LXS063, HK4-ZP-LXS174, HK5-ZP-LXS174, HK4-ZP-LXS087, HK5-ZP-LXS087, HK4-ZP-LXS187, HK5-LXS187, HK4-ZP-LXS086, HK5-ZP-LXS086, and DNA Marker.

[0038] Figure 2 The following are the typing peaks and fragment sizes of some samples.

[0039] Figure 3 Phylogenetic tree of 16 Dracaena samples constructed based on 16 pairs of SSR primer sets.

[0040] Figure 4 This is the clustering tree of 4 test samples (triangles) and 16 control samples. DETAILED DESCRIPTION

[0041] The specific implementation modes of the present invention are described below so that those skilled in the art can understand the present invention. However, it should be clear that the present invention is not limited to the scope of the specific implementation modes. For those of ordinary skill in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the attached claims, these changes are obvious, and all inventions and creations utilizing the concept of the present invention are protected.

[0042] Example 1: Screening of SSR primer sets

[0043] 1. Screening of SSR primers: MISA software was used to analyze and screen the SSR sequences in the Dracaena transcriptome. The screening criteria for SSR sites were as follows: (1) sites with repeating units consisting entirely of G / C bases were removed; (2) sites with single-base repeating units and compound repeating units were removed; (3) SSR sequences with more than five repeats were retained; and (4) sites were selected preferentially from different gene sequences.

[0044] 2. Primer design: Primers were designed from the SSR loci that met the above conditions. The primer design parameters were as follows: (1) Primer sequence length 18-22 bp; (2) Amplification product length 110-350 bp; (3) Annealing temperature (Tm value) 50°C-60°C; (4) Amplification product GC content 40%-60%.

[0045] 3. Primer synthesis: 192 pairs of primers were randomly selected from the SSR markers that met the above two-step criteria and synthesized using the adapter method. That is, a 21bp adapter sequence was added to the upstream primer during synthesis. When the adapter method was used for PCR amplification, in the first step, the upstream primer with the adapter and the downstream primer were combined with the template to obtain a PCR product with an adapter sequence. In the second step, the adapter primer with a fluorescent group and the downstream primer were combined with the PCR product of the first step to obtain a PCR product with a fluorescent group and a 21bp adapter sequence.

[0046] 4. Sixteen samples of Dracaena plants with large differences in genetic background were used as screening materials (Table 1), and qualified DNA was extracted from the above samples.

[0047] Table 116 Sample information for screening

[0048]

[0049] 5. Fluorescence PCR Amplification

[0050] Table 2 PCR amplification system and amplification procedure

[0051]

[0052] 6. Detection and dilution of fluorescent PCR products

[0053] After the fluorescence PCR amplification was completed, 2 μL of PCR product was taken for agarose gel electrophoresis (1% concentration) ( Figure 1 ). Primers were screened according to the following criteria: (1) All samples had obvious bands, indicating a high amplification success rate; (2) The bands were single and clear without dragging, indicating a high specificity of amplification. For PCR products that met the above criteria, they were diluted according to the sample concentration tested on the machine to obtain fluorescent PCR products with uniform concentrations.

[0054] The specific sequences of the 16 pairs of SSR primers screened are as follows:

[0055] Table 316 pairs of SSR primer sequences

[0056]

[0057] 7. Fluorescence capillary electrophoresis detection

[0058] Add the fluorescent PCR products diluted to a uniform concentration to the upper plate, centrifuge the plate to be tested with samples and reagents, and place it on the PCR instrument to run the denaturation program (95°C, 3min). Cool it immediately after the denaturation is completed, refer to the ABI 3730xL upper machine operation process, select the test file corresponding to the name of the plate to be tested, and run the SSR sample analysis test program. Use the Fragment (Plant) fragment analysis function in the GeneMarker software to analyze the capillary raw data, and compare the position of the molecular weight internal standard in each lane with the position of each sample peak to obtain the fragment size of each amplified product ( Figure 2 ).

[0059] 8. Data Analysis

[0060] According to the length of the amplified product of each pair of SSR primers, various genetic diversity indicators of SSR loci and populations were calculated using software such as GenAlEx version 6.501, including observed alleles (Na), effective alleles (Ne), Shannon index (I), polymorphism information index (PIC), observed heterozygosity (Ho), expected heterozygosity (He) and inbred line (Fis) (Table 2). Further, based on the peak quality, Na (number of alleles) ≥ 3 and PIC (polymorphism information index) > 0.6 as the standard (Table 2), 16 pairs of SSR marker primer sets with good polymorphism and high resolution were screened. Using PowerMarker software, the unweighted group average method (UPGMA) of 16 samples was constructed to construct a phylogenetic tree ( Figure 3 ).from Figure 3 It can be seen that 16 SSR loci can distinguish 16 Dracaena varieties, indicating that the resolution of 16 pairs of SSR primers is high.

[0061] Table 4 Genetic diversity indicators of 16 pairs of SSR primers

[0062]

[0063] Note: Na: observed allele; Ne: effective allele; I: Shannon index; Ho: observed heterozygosity; He: expected heterozygosity; PIC: polymorphism information index

[0064] Example 2: Identification of unknown Dracaena germplasm resources

[0065] (1) DNA extraction and detection: Wipe the sample clean with a cotton ball soaked in 75% alcohol and dry it; select 100 mg of fresh material (10-50 mg of dry material) and extract DNA according to the plant genomic DNA extraction kit (OMEGAHP Plant DNA Kit, USA). Take 2 μL of DNA stock solution for concentration and purity detection (NanoDrop 2000, USA). DNA should meet the following quality requirements: concentration greater than 50 ng / uL, A260 / A280 of 1.8-2.2, and A260 / A230 greater than 1.0.

[0066] (2) Fluorescence PCR amplification:

[0067] The PCR reaction system was 25 μL, including 12.5 μL of 2x EcoTaq PCR SuperMix (Transgen, China), 1 μL of each forward and reverse primer, and 20 ng of DNA template, which was finally supplemented with ddH2O.

[0068] The PCR amplification program was set as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, gradient annealing at 62-52°C for 30 s, extension at 72°C for 30 s, for 10 cycles; denaturation at 95°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 30 s, for 25 cycles; extension at 72°C for 20 min, and finally storage at 4°C.

[0069] (3) Fluorescence PCR product electrophoresis identification and dilution: After the fluorescence PCR amplification is completed, 2 μL of PCR product is taken for agarose gel electrophoresis detection (1% concentration), and the amplification efficiency of each SSR primer is judged by the brightness of the PCR product band. According to the sample detection concentration requirements, each fluorescent PCR product is diluted to obtain a fluorescent PCR product of uniform concentration, and arranged for detection on the sequencer.

[0070] (4) Fluorescence capillary electrophoresis detection: Add the fluorescent PCR product diluted to a uniform concentration to the upper plate, and add the upper detection reagents according to the following system:

[0071] Table 5 Fluorescence PCR reaction system

[0072]

[0073] Centrifuge the plate to be tested with samples and reagents and place it on a PCR instrument to run the denaturation program (95°C, 3 min). Cool it immediately after the denaturation is completed. Refer to the ABI 3730xl machine operation process, select the test file corresponding to the name of the plate to be tested, and run the SSR sample analysis test program.

[0074] (5) The raw data in .fsa format were exported from the ABI 3730xl instrument, classified and archived according to the detection sites, and then imported into the GeneMarker analysis software to obtain the fragment size of each amplified product. The UPGMA method was used for cluster analysis, and a circular cluster diagram was drawn ( Figure 4 ). The variety of the sample to be tested and its relationship with the control variety are determined based on their positions in the phylogenetic tree. Figure 4 It can be seen that the two samples from Dongfang, Hainan (HaiN-DF and HaiN-DF-resin) are clustered on a branch alone, indicating that the two may be the same variety or similar varieties. At the same time, they are also closely related to the control varieties from Maoming, Guangdong (GuangD-SJL) and Wanning, Hainan (HaiN-WN1); while the lipid-containing material from Sanya (HaiN-SY8-resin) is closely related to the control variety from Lingshui (HaiN-LS2).

[0075] The present invention uses specific embodiments to illustrate the principles and implementation methods of the present invention. The description of the above embodiments is only used to help understand the method of the present invention and its core idea. At the same time, for those skilled in the art, according to the idea of ​​the present invention, there will be changes in the specific implementation methods and application scope. In summary, the content of this specification should not be understood as a limitation on the present invention.

Claims

1. A SSR molecular marker primer set for identification of Dracaena species, characterized in that: The primer set includes the following 16 pairs of primers: The primer pair DSSR-080 includes an upstream primer DSSR-080-F and a downstream primer DSSR-080-R, the sequence of DSSR-080-F is TCTTCGTGGAGGCCCTGATA, and the sequence of DSSR-080-R is GGGGAAGGCAAAGGAGAGAG; The primer pair DSSR-050 includes an upstream primer DSSR-050-F and a downstream primer DSSR-050-R, the sequence of DSSR-050-F is CCGACCATGGACAAGAAGCT, and the sequence of DSSR-050-R is AGTTTGCAACCTGGGTTCCA; The primer pair DSSR-063 includes an upstream primer DSSR-063-F and a downstream primer DSSR-063-R, the sequence of DSSR-063-F is TCTTGATCTTCCGGCAGCAG, and the sequence of DSSR-063-R is TGCACCTTGGCTTCGTAGAG; The primer pair DSSR-174 includes an upstream primer DSSR-174-F and a downstream primer DSSR-174-R, the sequence of DSSR-174-F is AGGCCCACACTTTTCCCAAA, and the sequence of DSSR-174-R is GCCAAACAATAACGAGCCCC; The primer pair DSSR-087 includes an upstream primer DSSR-087-F and a downstream primer DSSR-087-R, the sequence of DSSR-087-F is TGGTGAAGATGTTGGCCTCC, and the sequence of DSSR-087-R is AGGGGCAGCACATTTCTCTC; The primer pair DSSR-187 includes an upstream primer DSSR-187-F and a downstream primer DSSR-187-R, the sequence of DSSR-187-F is CGCCATGCTCAAGTCCTACT, and the sequence of DSSR-187-R is GACCCACAGCTCATCCATCC; The primer pair DSSR-086 includes an upstream primer DSSR-086-F and a downstream primer DSSR-086-R, the sequence of DSSR-086-F is CATGCGGCCATTATTGTGGG, and the sequence of DSSR-086-R is CCACTGCTCTTCCAAGGGAA; The primer pair DSSR-056 includes an upstream primer DSSR-056-F and a downstream primer DSSR-056-R, the sequence of DSSR-056-F is GCTTAAAGGGTGTGCTTGGC, and the sequence of DSSR-056-R is GGCTTGCAGGAATTTCTGGC; The primer pair DSSR-039 includes an upstream primer DSSR-039-F and a downstream primer DSSR-039-R, the sequence of DSSR-039-F is TTGACGTTCATGTCCCTGCA, and the sequence of DSSR-039-R is AGAAACAGTTCAGCTCGGCA; Primer pair DSSR-013 includes an upstream primer DSSR-086-F and a downstream primer DSSR-086-R, the sequence of DSSR-086-F is TGCCCTGTTGTTTTCTTCGT, and the sequence of DSSR-086-R is GTTTGTAGTGCCCACCCTGT; The primer pair DSSR-079 includes an upstream primer DSSR-079-F and a downstream primer DSSR-079-R, the sequence of DSSR-079-F is AAAACCATAGCCACGACCGT, and the sequence of DSSR-079-R is GCAGGCCCTGTAGTTGGATT; The primer pair DSSR-065 includes an upstream primer DSSR-065-F and a downstream primer DSSR-065-R, the sequence of DSSR-065-F is TCCCTAATGGTACCTCGCCA, and the sequence of DSSR-065-R is GGAGGTTTTTACCGGCAGGA; The primer pair DSSR-006 includes an upstream primer DSSR-006-F and a downstream primer DSSR-006-R, the sequence of DSSR-006-F is ATAATCCCCGGAGCTAACGC, and the sequence of DSSR-006-R is TGATTAGGGCGACGGATTGG; The primer pair DSSR-026 includes an upstream primer DSSR-026-F and a downstream primer DSSR-026-R, the sequence of DSSR-026-F is ACAAGTGTGAGCCTTGGGAC, and the sequence of DSSR-026-R is TCACGACGATTGATCCACAA; The primer pair DSSR-022 includes an upstream primer DSSR-022-F and a downstream primer DSSR-022-R, the sequence of DSSR-022-F is CCACTGTTGGTCATGCTTCT, and the sequence of DSSR-022-R is CAACCTGTTGAGGCAGAGGT; The primer pair DSSR-188 includes an upstream primer DSSR-188-F and a downstream primer DSSR-188-R, the sequence of DSSR-188-F is TAGAACGGCACTGAACCCAG, and the sequence of DSSR-188-R is TTCAACAGAACTGCCTGCCA.

2. Application of the SSR molecular marker primer set described in claim 1 in genetic analysis of Dracaena germplasm resources.

3. A method for genetic analysis of Dracaena germplasm resources, characterized in that: The following steps are included: (1) Extracting DNA from samples to be analyzed: Collecting young leaves of Dracaena and extracting genomic DNA; (2) Synthesizing specific fluorescent primers: screening and synthesizing the 16 pairs of primers described in claim 1; (3) PCR amplification: using the fluorescent PCR reaction to perform PCR amplification on the genomic DNA in step (1) using the 16 pairs of primers; (4) Genetic analysis: The observed allele number, effective allele number, Shannon index, polymorphism information index, observed heterozygosity, expected heterozygosity, and inbreeding coefficient were statistically analyzed. Cluster analysis was performed using the unweighted group average method based on Nei genetic distance to construct a dendrogram of genetic distance cluster analysis.

4. Use of the SSR molecular marker primer set described in claim 1 in identifying different Dracaena varieties and Dracaena species.

5. A method for identifying a variety of Dracaena, characterized in that: The following steps are included: a. Extracting genomic DNA from Dracaena materials; b. Using the DNA obtained in step a as a template, performing PCR amplification using the 16 pairs of primers described in claim 3, and performing capillary electrophoresis analysis on the amplified fragments; c. Compare the characteristic fingerprints of the sample to be tested with those of the reference variety, or use the cluster analysis dendrogram described in claim 3 to determine the relationship between the sample to be tested and the reference variety.

6. The method for identifying a Dracaena species according to claim 5, characterized in that: In the step b, the PCR amplification system is: 25 μL, including 12.5 μL of 2x EcoTaqPCR SuperMix, 1 μL of each forward and reverse primer, and 20 ng of DNA template, which is finally supplemented with ddH2O; the PCR amplification program is: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, gradient annealing at 62-52°C for 30 s, extension at 72°C for 30 s, and running for 10 cycles; denaturation at 95°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 30 s, and running for 25 cycles; extension at 72°C for 20 min.

Images