MIRA-LFD primer group for detecting Getah virus and application of MIRA-LFD primer group

Abstract

The invention provides an MIRA-LFD primer group for detecting Getah virus and application of the MIRA-LFD primer group. The invention further discloses a kit for detecting the Getah virus based on the MIRA-LFD, a method for detecting the Getah virus and application.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a MIRA-LFD primer set for detecting swine geta virus, a detection method and an application thereof. Background Art

[0002] Getahvirus (GETV) is a member of the genus Alphavirus, a member of the family Togaviridae, an RNA virus. It is mainly transmitted by mosquitoes, and the virus has also been found in many mammals such as humans, horses, cattle, and pigs. GETV can proliferate in various vertebrates and arthropods. Sick pigs infected with GETV show symptoms such as lethargy, loss or loss of appetite, whole body tremors, fever, diarrhea, redness of the body surface, ataxia, etc. In severe cases, neurological symptoms may occur, and even death from exhaustion may occur. There is currently no effective vaccine against GETV.

[0003] GETV has similar clinical features to many related diseases that can cause diarrhea and reproductive disorders in pigs, making them difficult to distinguish and often causing mixed infections, which greatly increases the difficulty of detecting and diagnosing GETV. Currently, GETV is mainly detected by serological methods and molecular biological methods. Traditional serological detection methods have a low positive detection rate and are complex to operate. Molecular detection methods such as PCR and fluorescent quantitative PCR are time-consuming, have high requirements for technicians, and are easily limited by instruments.

[0004] Therefore, developing a simple, rapid, highly specific and sensitive rapid pathogen detection method is crucial to achieve grassroots pathogen GETV detection. Summary of the invention

[0005] In order to solve one of the above-mentioned technical problems existing in the prior art, the present invention provides a primer set, a kit and a detection method for detecting Geta virus based on MIRA-LFD.

[0006] The present invention combines multi-enzyme constant temperature amplification technology (MIRA) with lateral flow immunoassay technology (LFD), which has the advantages of being able to read the results with the naked eye, convenient detection, and easy to carry. Moreover, the multi-enzyme constant temperature amplification detection technology is used to amplify and detect the nucleic acid of the pathogen at room temperature, and combined with the lateral flow chromatography test strip, it does not require complicated operations and instruments, and can achieve rapid on-site detection. It makes up for the shortcomings of conventional PCR technology, such as complex operation, long time consumption, and high requirements for instruments, thereby establishing an accurate and intuitive rapid detection method that is convenient for grassroots and on-site.

[0007] According to one aspect of the present disclosure, a primer set for detecting Geta virus based on MIRA-LFD is provided, comprising:

[0008] Forward primer: 5'-CCCTGACGACCAAGCAAAATGGTAAAGCAC-3' (SEQ ID NO:9); and

[0009] Reverse primer: 5'-ATTGTGAACCTGCCACCGCTGTACTGCACT-3' (SEQ ID NO: 4).

[0010] In some embodiments, the 5' end of the forward primer and / or the reverse primer may be labeled with biotin.

[0011] According to another aspect of the present disclosure, a kit for detecting Geta virus based on MIRA-LFD is provided, which comprises the above-mentioned primer set of the present disclosure.

[0012] In some embodiments, the kit further comprises a probe, and the probe preferably has a nucleotide sequence shown as 5'-ATGTGCACTGGTATCTGGGCGCACTCCAGGTCATACTTGCTCGATTTCT-3' (SEQ ID NO: 13).

[0013] In some embodiments, the probe can be labeled with tetrahydrofuran, a fluorescent group and / or a quencher group.

[0014] In some embodiments, the fluorescent group can be selected from fluorescein (FAM), cyanine dye, CAL Fluor TM Dyes, ROX dye labels, etc.

[0015] In the present disclosure, the fluorescent group and / or quenching group are not particularly limited, and any fluorescent group and / or quenching group conventionally used by those skilled in the art can be used.

[0016] In some embodiments, the fluorescent group can be selected from any one or more of 6-FAM, FAM-dT, NED, Cy2, DY-495, ATTO495, Cy3, VIC, CAL Fluor 560, CAL Fluor Gold 540, SIMA, Texas Red, TAMRA, Cy5, 6-JOE and 6-ROX.

[0017] In some embodiments, the quenching group can be selected from any one or more of BHQ1, BHQ2, BHQ3, TAMRA (tetramethylrhodamine), Dabcyl, Eclipse and MGB.

[0018] In some embodiments, the 3' end of the probe may also carry a blocking group. In the present disclosure, the blocking group is not particularly limited, and any blocking group conventionally used by those skilled in the art may be used.

[0019] In some embodiments, the blocking group can be selected from any one or more of an amine group, a phosphate group, biotin, and a spacer (eg, C3-spacer).

[0020] In some embodiments, the kit may further include a MIRA amplification reagent. In some embodiments, the MIRA amplification reagent may include a recombinase, a single-stranded DNA binding protein, a DNA polymerase, a recombinase auxiliary protein, and a helicase.

[0021] In some embodiments, the kit may further include a colloidal gold test strip.

[0022] In some embodiments, the colloidal gold test strip may include a support and a sample pad, a gold label pad, a nitrocellulose membrane and absorbent paper sequentially overlapped on the support.

[0023] In some embodiments, the gold label pad is coated with colloidal gold and a first antibody against the fluorescent group. In some embodiments, the colloidal gold test strip is provided with a quality control line and a detection line, wherein the quality control line is coated with streptavidin, and the detection line is coated with a second antibody that specifically binds to the first antibody.

[0024] According to another aspect of the present disclosure, a method for detecting Geta virus is provided, wherein the method adopts the above-mentioned primer set of the present disclosure or the above-mentioned kit of the present disclosure.

[0025] In some embodiments, the method comprises a step of isothermal amplification.

[0026] In some embodiments, the isothermal amplification can be performed at 25° C. to 45° C. In some embodiments, the isothermal amplification can be performed at 25° C., 26° C., 27° C., 28° C., 29° C., 30° C., 31° C., 32° C., 33° C., 34° C., 35° C., 36° C., 37° C., 38° C., 39° C., 40° C., 41° C., 42° C., 43° C., 44° C., or 45° C.

[0027] In some embodiments, the isothermal amplification can be performed for 5 to 30 min, preferably 5 to 20 min. In some embodiments, the isothermal amplification can be performed for 5 min, 6 min, 7 min, 8 min, 9 min, 10 min, 11 min, 12 min, 13 min, 14 min, 15 min, 16 min, 17 min, 18 min, 19 min or 20 min.

[0028] According to another aspect of the present disclosure, the primer set, the kit or the method are used in detecting Geta virus in a sample.

[0029] In some embodiments, the Geta virus may include a porcine Geta virus, a bovine Geta virus, or a horse Geta virus. In a specific embodiment, the Geta virus may be a porcine Geta virus.

[0030] In some embodiments, the sample is not particularly limited and can be in the form of any conventionally used sample. In some embodiments, the sample can be selected from blood, plasma, tissue sample, saliva, urine, etc.

[0031] The primer set, kit or method disclosed in the present invention can detect Geta virus with high specificity and high detection sensitivity, with a detection rate as low as about 10 2 The detection limit is 100 copies / μL and the detection time is short.

[0032] The detection method disclosed in the present invention does not require professional laboratory equipment and personnel, is time-saving, simple to operate, and the results can be visualized with the naked eye. It can be used for on-site detection of Geta virus and is convenient for use in grassroots farms. It also provides technical support for rapid diagnosis, real-time monitoring and prevention and control of Geta virus. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 The electrophoresis diagrams show the MIRA amplification effects of different primer pairs. Figure 1 In A, lane M is a DNA marker, and lanes 1 to 6 are the results of RT-MIRA performed with GETV-F1 / GETV-R1, GETV-F1 / GETV-R2, GETV-F1 / GETV-R3, GETV-F1 / GETV-R4, and GETV-F1 / GETV-R5 as primer pairs, respectively; Figure 1 In B, lane M is a DNA marker, and lanes 1 to 6 are the results of RT-MIRA performed with GETV-F2 / GETV-R1, GETV-F2 / GETV-R2, GETV-F2 / GETV-R3, GETV-F2 / GETV-R4, and GETV-F2 / GETV-R5 as primer pairs, respectively; Figure 1 In C, lane M is a DNA marker, and lanes 1 to 6 are the RT-MIRA results using GETV-F3 / GETV-R1, GETV-F3 / GETV-R2, GETV-F3 / GETV-R3, GETV-F3 / GETV-R4, and GETV-F3 / GETV-R5 as primer pairs, respectively; Figure 1In D, lane M is a DNA marker, and lanes 1 to 6 are the results of RT-MIRA performed with GETV-F4 / GETV-R1, GETV-F4 / GETV-R2, GETV-F4 / GETV-R3, GETV-F4 / GETV-R4, and GETV-F4 / GETV-R5 as primer pairs, respectively; Figure 1 In E, lane M is a DNA marker, and lanes 1 to 6 are the results of RT-MIRA performed with GETV-F5 / GETV-R1, GETV-F5 / GETV-R2, GETV-F5 / GETV-R3, GETV-F5 / GETV-R4, and GETV-F5 / GETV-R5 as primer pairs, respectively; Figure 1 In F, lane M is a DNA marker, and lanes 1 and 2 are the results of RT-MIRA using GETV-F5 / GETV-R2 and GETV-F5 / GETV-R4 as primer pairs, respectively.

[0034] Figure 2 Shown are the results of screening of the Geta virus MIRA-LFD reaction temperature.

[0035] Figure 3 Shown are the screening results of Geta virus MIRA-LFD reaction time.

[0036] Figure 4 The specific detection results of Geta virus MIRA-LFD are shown. Among them, GETV is Geta virus; PDCoV is porcine coronavirus; CSFV is classical swine fever virus; SVV is Seneca Valley virus; PCV2 is porcine circovirus type 2; PRV is pseudorabies virus; PEDV is porcine epidemic diarrhea virus; NC is a negative control.

[0037] Figure 5 Shown are the results of the Geta virus MIRA-LFD sensitivity experiment.

[0038] Figure 6 The results of fluorescence quantitative PCR detection limit of Geta virus are shown. The concentration of the standard plasmid GETV-C-pMD19-T is 1:5.53×10 9 Copies / μL; 2: 5.53×10 8 Copies / μL; 3: 5.53×10 7 Copies / μL; 4: 5.53×10 6 Copies / μL; 5: 5.53×10 5 Copies / μL; 6: 5.53×10 4 Copies / μL; 7: 5.53×10 3 Copies / μL: 8: 5.53×10 2Copies / μL; 9: 5.53×10 1 Copies / μL; 10: 5.53×10 0 copies / μL; 11: negative control.

[0039] Figure 7 Common PCR test results for Geta virus are shown. DETAILED DESCRIPTION

[0040] GETV is a single-stranded RNA virus that was first isolated from Culex gelidus in the rubber forests of Malaysia in 1950 and named Getah virus. Its prototype strain is MM2021. In 1956, Japan first isolated Sagiyama virus (SAGV) from Culex tritaeniorhynchus, which was later identified as GETV. Subsequently, the virus was isolated in Osaka and Nagasaki, Japan, North Queensland, Australia, China, the Philippines, Thailand, South Korea, Indonesia, Vietnam, Mongolia, Russia, etc. In 1964, my country first discovered and isolated GETV virus in Hainan Province and named it M1 strain. Then, HB0234 strain was isolated in 2002 and YN0540 strain was isolated in 2005.

[0041] The present disclosure provides a method and kit for detecting porcine Geta virus by combining multienzyme isothermal nucleic acid amplification technology (Multienzyme Isothermal Rapid Amplification, MIRA) with lateral flow immunoassay technology (LFD). The method disclosed in the present disclosure only needs to react for 15 minutes under a constant temperature of 40°C to complete. The whole process reacts quickly, does not require high temperature, and has strong specificity. No professional laboratory equipment and personnel are required, the time consumption is short, the operation is simple, and the results can be visualized with the naked eye. It can be used for on-site detection of Geta virus and is convenient for use in grassroots farms. It also provides technical support for rapid diagnosis, real-time monitoring and prevention and control of Geta virus.

[0042] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described in detail below in conjunction with embodiments. The specific embodiments described herein are only used to explain the present invention and are not intended to constitute any limitation of the present invention. In addition, in the following description, the description of known structures and technologies is omitted to avoid unnecessary confusion of the concepts of the present disclosure. Such structures and technologies are also described in many publications.

[0043] definition

[0044] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly used in the field to which the present invention belongs. For the purpose of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural form, and vice versa.

[0045] Unless the context clearly dictates otherwise, the expressions "a", "an" and "an" as used herein include plural references. For example, reference to "a cell" includes a plurality of such cells and equivalents thereof known to those skilled in the art, and so forth.

[0046] As used herein, the term "about" refers to a range of ±20% of the value that follows. In some embodiments, the term "about" refers to a range of ±10% of the value that follows. In some embodiments, the term "about" refers to a range of ±5% of the value that follows.

[0047] The term "multi-enzyme isothermal amplification technology" or "MIRA" used in this article is a isothermal rapid nucleic acid amplification technology that relies on the synergistic action of multiple functional proteins to achieve rapid nucleic acid amplification at room temperature. Specifically, the protein-DNA complex formed by the combination of recombinase and primer can search for homologous sequences in double-stranded DNA. Once the primer locates the homologous sequence, a strand exchange reaction will occur and initiate DNA amplification, exponentially amplifying the target area on the template; the replaced DNA chain binds to the single strand DNA-binding protein (SSB) to prevent further replacement. In this system, the amplification event is initiated by two opposing primers.

[0048] The amplification product of MIRA can be observed by direct electrophoresis, or by real-time fluorescence monitoring after amplification by a fluorescence quantitative PCR instrument, and the result can be determined by the amplification curve. The combination of MIRA and lateral flow chromatography (LFD) can intuitively determine the result in the form of colloidal gold detection reagent card.

[0049] Examples and drawings are provided below to help understand the present invention. However, it should be understood that these examples and drawings are only used to illustrate the present invention, but do not constitute any limitation. The actual protection scope of the present invention is set forth in the claims. It should be understood that any modifications and changes can be made without departing from the spirit of the present invention.

[0050] It should be noted that, if the specific conditions are not specified in the examples, the experimental conditions are carried out according to conventional conditions, manufacturer recommendations or publicly reported experimental conditions. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially. If the manufacturer of the reagents used is specified, similar products from other manufacturers are substitutable.

[0051] Example

[0052] Example 1: Design and screening of primers and probes for Geta virus MIRA-LFD

[0053] By screening and analyzing the known Getavirus C gene sequences, five sets of MIRA primer pairs were designed for the conserved region of the C gene, and the probe MIRA-P was designed. The sequences are shown in Table 1 below.

[0054] Table 1

[0055]

[0056]

[0057] The RNA of Getavirus GETV was reverse transcribed to obtain cDNA, and the Getavirus C gene fragment (SEQ ID NO: 12) was amplified using RT-PCR primers. The amplified product was recovered by gel and connected to the pMD19-T vector, named GETV-C-pMD19-T.

[0058] The DNA isothermal rapid amplification kit (Anpu Future (Changzhou) Biological Company) was used to prepare the RT-MIRA basic reaction system. The total volume of the reaction system was 50 μl, including: 29.4 μl A buffer, 2 μl of 10 μM upstream and downstream primers, 5 μl GETV-C-pMD19-T, 9.1 μl ddH2O, and 2.5 μl B Buffer. The amplification temperature was 37°C for 15 min. ddH2O was added to the template in the negative control, and the template in the positive control was GETV-C-pMD19-T.

[0059] The amplified product was eluted with a mixture of DNA extractant (phenol: chloroform: isoamyl alcohol = 25:24:1) and centrifuged for 5 minutes. The supernatant was extracted and the results were observed using 2% agarose gel electrophoresis. Figure 1 shown.

[0060] Figure 1 A shows the results of RT-MIRA using GETV-F1 as the upstream primer and GETV-R1 to GETV-R5 as the downstream primers.

[0061] Figure 1 B shows the results of RT-MIRA using GETV-F2 as the upstream primer and GETV-R1 to GETV-R5 as the downstream primers.

[0062] Figure 1 C shows the results of RT-MIRA using GETV-F3 as the upstream primer and GETV-R1 to GETV-R5 as the downstream primers.

[0063] Figure 1 D shows the results of RT-MIRA using GETV-F4 as the upstream primer and GETV-R1 to GETV-R5 as the downstream primers.

[0064] Figure 1 E shows the results of RT-MIRA using GETV-F5 as the upstream primer and GETV-R1 to GETV-R5 as the downstream primers.

[0065] Figure 1 F shows the results of RT-MIRA using GETV-F5 as the upstream primer and GETV-R2 and GETV-R4 as the downstream primers.

[0066] Taking into account the band brightness, position, size, presence or absence of nonspecific amplification and primer dimers, the primer combination GETV-F5 / R2 was selected as the primer combination for multi-enzyme isothermal amplification. The 5' end of GETV-F5 was biotin-modified for the following examples.

[0067] Example 2: Establishment of Geta virus MIRA reaction system

[0068] A DNA isothermal rapid amplification kit (Anpu Future (Changzhou) Biological Company) was used to prepare the MIRA reaction system. The total volume of the reaction system was 50 μL. The specific components included: 29.4 μL A buffer, 2 μL each of 10 μM upstream and downstream primers, 0.6 μL of 10 μM probe, 4 μL GETV-C-pMD19-T, 9.5 μL ddH2O, and 2.5 μL B Buffer.

[0069] The specific steps are as follows: add A buffer, upstream primer, downstream primer, probe, GETV-C-pMD19-T, ddH2O to each dry powder reaction tube, then add B buffer to the reaction tube and mix thoroughly immediately. After mixing, place the reaction tube in a constant temperature device at 40-42°C for 10-15 minutes. After the reaction is completed, take 10 μL and make a 10-fold dilution and drop it into the sample well of the HybriDetect colloidal gold test strip (Anpu Future (Changzhou) Biological Company), and observe the quality control line and the detection line within 5 minutes.

[0070] Example 3: Screening for optimal temperature of Geta virus MIRA-LFD reaction

[0071] GETV-C-pMD19-T was used as the template plasmid, and the GETV-F5 / R2 primer pair and DNA constant temperature rapid amplification kit (Anpu Future (Changzhou) Biological Company) were used for multi-enzyme constant temperature amplification. The reaction temperatures were 15°C, 20°C, 25°C, 30°C, 37°C, 40°C, 42°C, 45°C, and 50°C, respectively. The reaction time was 15 minutes. The reaction system included: 29.4μL ABuffer, 2μL each of 10μM upstream and downstream primers, 0.6μL of 10μM probe, 5.0μL of template plasmid, 8.5μL of ddH2O, and 2.5μL BBuffer, with a total volume of 50μL.

[0072] After the amplified product was diluted 10 times with ddH2O, 50 μL was added to the sample well of the HybriDetect colloidal gold test strip and the result was read within 5 minutes. Figure 2 As shown in the figure, when the reaction temperature is lower than 25℃, there is no red band on the test strip test line; at 25℃, a faint red band appears on the test line; between 25℃ and 45℃, a weak red band appears on the test line; at 50℃, there is no red band on the test strip test line. It can be seen that MIRA can react in the range of 25℃ to 45℃. From 25℃, the band becomes darker as the temperature rises, until it stops changing at 40℃, and gradually becomes lighter as the temperature rises until it disappears at 50℃.

[0073] Example 4: Screening for the optimal time of Geta virus MIRA-LFD reaction

[0074] GETV-C-pMD19-T was used as the template plasmid, and the GETV-F5 / R2 primer set and DNA constant temperature rapid amplification kit (Anpu Future (Changzhou) Biological Company) were used for multi-enzyme constant temperature amplification. The reaction temperature was 40°C, and the reaction times were 1 min, 5 min, 10 min, 15 min, 20 min, 25 min, and 30 min, respectively. The reaction system was: 29.4 μL A Buffer, 2 μL each of 10 μM upstream and downstream primers, 0.6 μL of 10 μM probe, 5.0 μL of template plasmid, 8.5 μL of ddH2O, and 2.5 μL B Buffer, with a total volume of 50 μL.

[0075] After the amplified product was diluted 10 times with ddH2O, 50 μL was added to the sample well of the HybriDetect colloidal gold test strip and the result was read within 5 minutes. Figure 3 As shown, a band appears at the detection limit of the test strip starting from 5 minutes, deepens at 10 minutes, and then the color of the band no longer deepens with time. In order to achieve a more complete reaction, 15 minutes was selected as the optimal reaction time.

[0076] Example 5: Specificity experiment of MIRA-LFD method for detecting Geta virus

[0077] To verify the specificity of the MIRA-LFD reaction system, nucleic acids of Geta virus (GETV), porcine epidemic diarrhea virus (PEDV), porcine deltacoronavirus (PDCoV), inactivated classical swine fever virus (CSFV), Seneca Valley virus (SVV) type A, porcine circovirus type 2 (PCV2), and pseudorabies virus (PRV) pathogens were used as templates (all strains were from the Key Laboratory of Animal Epidemiology, Ministry of Agriculture and Rural Affairs).

[0078] The GETV-F5, GETV-R2, and GETV-P primer probe sets were used, the reaction system of Example 4 was adopted, and the reaction time was 15 minutes. The results are as follows Figure 4 It can be seen that except for the positive result of Geta virus, the detection results of other viruses are all negative, indicating that the method of the present invention has good specificity.

[0079] Example 6: Sensitivity test of MIRA-LFD method for detecting Geta virus

[0080] The GETV-C-pMD19-T vector constructed in Example 1 was transformed into Escherichia coli DH5α competent cells. After culture, the plasmid was extracted and the concentration was determined, and then stored at -20°C.

[0081] The concentration is 5.53×10 9 ~5.53×10 0 Copies / μLGETV-C-pMD19-T were used as template, and GETV-F5 / R2 primer set and DNA constant temperature rapid amplification kit (Anpu Future (Changzhou) Biological Company) were used for multi-enzyme constant temperature amplification. The reaction temperature was 40°C, the reaction time was 15 min, and the reaction system was: 29.4μL A Buffer, 2μL each of 10μM upstream and downstream primers, 0.6μL of 10μM probe, 5.0μL template plasmid, 8.5μL ddH2O, 2.5μL B Buffer, and the total volume was 50μL.

[0082] After the amplified product was diluted 10 times with ddH2O, 50 μL was added to the sample well of the HybriDetect colloidal gold test strip and the result was read within 5 minutes. Figure 5 As shown, the detection limit of MIRA-LFD is 5.53×10 2 copies / μL.

[0083] To compare the sensitivity of the MIRA-LFD method and qRT-PCR, the concentration of 5.53×10 9 ~5.53×10 0 copies / μL GETV-C-pMD19-T was used as a template for detection.

[0084] The specific components are: 12.5 μL UltraSYBR Mixture (Congwei Century), 0.5 μL of 10 μM upstream and downstream primers, 2.0 μL of template plasmid, 9.5 μL of ddH2O, and the total volume is 25 μL. The primer sequences are shown in Table 2 below.

[0085] Table 2. Sequences of forward and reverse primers used in qRT-PCR

[0086] Primer name Sequence (5'-3') Sequence number qPCR-F CCTGCCTAGTCGGGGATAA SEQ ID NO:14 qPCR-R AATTGTAGTGCCCTTCTGGT SEQ ID NO:15

[0087] The program for fluorescence quantification was as follows: pre-denaturation at 95°C for 10 min, denaturation at 95°C for 10 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s, for 40 cycles.

[0088] The results are as follows Figure 6 As shown, the detection limit of qRT-PCR was 5.53×10 1 Although the sensitivity is higher than that of the MIRA-LFD method, the MIRA-LFD method disclosed in the present invention shortens the detection time and is simple and quick to operate.

[0089] In order to compare the sensitivity of the MIRA-LFD method disclosed in the present invention with that of conventional PCR, the primers and reaction procedures in the DB51 / T 2906-2022 standard were referred to, and the concentrations of 5.53×10 9 ~5.53×10 0 The copies / μLGETV-C-pMD19-T was used as a template for detection. The primer sequences are shown in Table 3 below.

[0090] Table 3. Sequences of forward and reverse primers used in PCR

[0091]

[0092]

[0093] PCR reaction system: 5 μL 2×Taq PCRmaster Mix, 0.5 μL each of 10 μM upstream and downstream primers, 1.0 μL template plasmid, 3.0 μL ddH2O, total volume 10 μL.

[0094] The PCR program was as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 56°C for 30 s, and extension at 72°C for 30 s, for 35 cycles.

[0095] The results are as follows Figure 7 As shown, the detection limit of conventional PCR is about 5.53×10 4The detection sensitivity of the MIRA-LFD disclosed in the present invention is significantly improved compared with that of ordinary PCR. The method disclosed in the present invention has good sensitivity.

[0096] Example 7: Detection application on actual samples

[0097] Thirty 3-week-old ICR mice were randomly divided into an infection group and a control group, with 15 mice in each group. The infection group was injected intraperitoneally with GETV virus dilution 250 μL / mouse, with a dose of 10 6 TCID50, the control group was injected intraperitoneally with an equal amount of DMEM.

[0098] Blood samples were collected from infected and control mice at 0.5d, 1d, 3d, 5d, and 7d after GETV artificially infected ICR mice, and 21 blood samples were randomly selected. Spleen, kidney, liver, and brain tissues of artificially infected mice were collected, and 45 tissue samples were randomly selected.

[0099] RNA was extracted from blood and tissue samples using the TRIzol method, and reverse transcribed using the HiScriptⅢqRTSuperMix reverse transcription kit to obtain cDNA. Then, conventional RT-PCR, RT-MIRA-LFD, and qRT-PCR were used for simultaneous detection.

[0100] The 21 blood samples collected were tested by the MIRA-LFD method of Example 6, and the results are shown in Table 4. The results showed that 10 samples were positive and 11 samples were negative, which were exactly the same as the test results of the conventional RT-PCR method and the qRT-PCR method.

[0101] Table 4. Comparison of clinical performance of RT-PCR, RT-MIRA-LFD, and qRT-PCR for detecting infected blood samples

[0102]

[0103] Three results obtained based on the tissue samples are shown in Table 5 below.

[0104] Table 5. Comparison of clinical performance of RT-PCR, RT-MIRA-LFD, and RT-qPCR for detecting infected tissue samples.

[0105]

[0106]

[0107]

[0108] Kappa statistical comparison analysis was performed on the results shown in Table 5, and the results are shown in Table 6 below.

[0109] Table 6. Comparison of clinical performance of RT-PCR, RT-MIRA-LFD, and qRT-PCR methods for detecting infected tissue samples.

[0110]

[0111] The results showed that the Kappa value of the consistency test between the RT-MIRA-LFD method and the RT-PCR method was 0.776 (P<0.001), and the agreement rate of the two detection methods was 95.6% (P<0.001); the Kappa value of the consistency test between the RT-MIRA-LFD method and the qRT-PCR method was 0.845, and the agreement rate of the two detection methods was 97.8%. These data show that the clinical diagnostic performance of the RT-MIRA-LFD method established in the present disclosure is good, and therefore it can be used for the detection of GETV.

[0112] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. All technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. A primer set for detecting Geta virus based on MIRA-LFD, characterized in that: The primer set comprises: Forward primer: 5'-CCCTGACGACCAAGCAAAATGGTAAAGCAC-3' (SEQ ID NO:9); and Reverse primer: 5'-ATTGTGAACCTGCCACCGCTGTACTGCACT-3' (SEQ ID NO: 4).

2. The primer set according to claim 1, characterized in that The 5' end of the forward primer and / or the reverse primer is labeled with biotin.

3. A kit for detecting Geta virus based on MIRA-LFD, characterized in that: The kit comprises the primer set according to claim 1 or 2.

4. The kit according to claim 3, characterized in that The kit further comprises a probe, which preferably has a nucleotide sequence shown as 5'-ATGTGCACTGGTATCTGGGCGCACTCCAGGTCATACTTGCTCGATTTCT-3' (SEQ ID NO: 13), Preferably, the probe is labeled with tetrahydrofuran, a fluorescent group and / or a quenching group; Preferably, the fluorescent group is selected from fluorescein (FAM), cyanine dye, CAL Fluor TM Dye, ROX dye labeling; Preferably, the fluorescent group is selected from any one or more of 6-FAM, FAM-dT, NED, Cy2, DY-495, ATTO 495, Cy3, VIC, CALFluor 560, CAL Fluor Gold 540, SIMA, Texas Red, TAMRA, Cy5, 6-JOE and 6-ROX; Preferably, the quenching group is selected from any one or more of BHQ1, BHQ2, BHQ3, TAMRA, Dabcyl, Eclipse and MGB; Preferably, the 3' end of the probe further carries a blocking group, and the blocking group is preferably selected from any one or more of an amine group, a phosphate group, biotin and a C3-spacer.

5. The kit according to claim 3, characterized in that The kit also includes a MIRA amplification reagent, Preferably, the MIRA amplification reagent comprises a recombinase, a single-stranded DNA binding protein, a DNA polymerase, a recombinase auxiliary protein and a helicase.

6. The kit according to claim 3, characterized in that The kit also includes a colloidal gold test strip. Preferably, the colloidal gold test strip comprises a support and a sample pad, a gold label pad, a nitrocellulose membrane and absorbent paper sequentially overlapped on the support; Preferably, the gold label pad is coated with colloidal gold and a first antibody against the fluorescent group; Preferably, the colloidal gold test strip is provided with a quality control line and a detection line, wherein the quality control line is coated with streptavidin, and the detection line is coated with a second antibody that specifically binds to the first antibody.

7. A method for detecting Geta virus, characterized in that: The method uses the primer set described in claim 1 or 2 or the kit described in any one of claims 3 to 6 for detection.

8. The method according to claim 7, characterized in that The method comprises the steps of isothermal amplification, Preferably, the isothermal amplification is performed at 25°C to 45°C; Preferably, the isothermal amplification is performed for 5 to 30 minutes, preferably for 5 to 20 minutes.

9. Use of the primer set according to claim 1 or 2 or the kit according to any one of claims 3 to 6 in detecting Geta virus.

10. The use according to claim 9, characterized in that The Geta virus includes porcine Geta virus, bovine Geta virus or horse Geta virus, preferably porcine Geta virus.

Images