Primer probe for rapid detection of hepatitis A virus RT-RPA and application and rapid detection method thereof

Abstract

The invention belongs to the technical field of biology, and particularly relates to a primer probe for rapid detection of hepatitis A virus RT-RPA as well as application and a rapid detection method of the primer probe. The primer probe for the hepatitis A virus RT-RPA rapid detection is shown as SEQ ID NO: 1-3, RT-RPA-LFD rapid detection of the hepatitis A virus is established, the primer probe can be used for preparing a reagent for hepatitis A virus detection, rapid, high-sensitivity, high-specificity and macroscopic high-accuracy detection of the hepatitis A virus is achieved, and an efficient and convenient solution is provided for hepatitis A virus detection.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to a detection technology for hepatitis A virus, in particular to an RPA primer combination, a probe and a kit for detecting hepatitis A virus. Background Art

[0002] Hepatitis A virus (HAV) is a single-stranded, positive-sense RNA virus without an envelope, belonging to the genus Hepacivirus of the family Picornaviridae. The virus particle has a diameter of 27 to 32 nm, an icosahedral symmetry, and a genome length of 7500 nt. The genome consists of three parts, including a 5' untranslated region (5'UTR), a single open reading frame (ORF) encoding structural and non-structural proteins, and a 3' untranslated region (3'UTR) with a short polyadenylic acid tail. Genotypes and subgenotypes are defined based on sequence variations at the VP1 / P2A junction. Hepatitis A is divided into seven genotypes, four of which (I, II, III, and VII) are from humans, and three (IV, V, and VI) are from apes. Human hepatitis A virus (HAV) types I, II, and III are further divided into six subtypes (IA, IB, IIA, IIB, IIIA, and IIIB). HAV is primarily transmitted through the fecal-oral route, including person-to-person contact, ingestion of contaminated water and food, especially shellfish, soft fruits and raw vegetables. In 1988, a severe hepatitis A pandemic occurred in Shanghai, China, which was caused by the ingestion of contaminated shellfish and resulted in approximately 310,000 cases of hepatitis A. Because shellfish are filter feeders, pathogens may accumulate in their bodies, and consumption of raw or undercooked shellfish may cause human illness. The increase in foodborne hepatitis A virus (HAV) outbreaks worldwide has necessitated the development of new methods to rapidly identify HAV-contaminated shellfish, which is critical to implementing prevention and reduction measures for illness caused by the virus.

[0003] Currently, the diagnosis of hepatitis A virus (HAV) infection mainly relies on enzyme-linked immunosorbent assay (ELISA), which measures the level of immunoglobulin M (IgM) antibodies against HAV in serum. However, this method has limitations in identifying recent infections due to the strict window period, which may lead to delayed detection of early infections. During the hepatitis A epidemic, rapid and accurate diagnosis is essential, and molecular diagnostic technology is an important supplement to serological testing. At present, the molecular detection methods used for hepatitis A virus mainly include variable temperature detection and constant temperature detection. Variable temperature detection mainly includes ordinary PCR, nested PCR, qPCR, and Droplet digital PCR (ddPCR), and constant temperature detection includes loop-mediated isothermal amplification (LAMP), recombinase polymerase amplification (RPA), etc. Reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR) is the standard method for quantitative detection of HAV in food, as described in ISO 15216-1. Although this method is reliable and accurate, it requires a long amplification procedure, skilled operators and precision equipment, and is greatly affected by inhibitors. Therefore, all PCR-based detection methods are not suitable for rapid on-site diagnosis in resource-limited settings. Therefore, there is an urgent need to design a new strategy to detect hepatitis A quickly, reliably, sensitively and economically using simple equipment.

[0004] RPA technology was first proposed by Piepenburg et al. in 2006. The reaction mainly relies on three enzymes, including recombinase, DNA polymerase, single-stranded binding protein, etc. to simulate the principle of nucleic acid amplification in vivo, and amplify nucleic acids in vitro at 37°C and constant temperature. Like PCR reaction, the RPA reaction product can be read according to the presence and structural design of the probe in the reaction system. RPA reaction system is mainly divided into three types. The first is basic reaction, which does not require probes, and the product can be observed by agarose gel electrophoresis; the second is fluorescence reaction, exo and fpg probes are designed, and real-time monitoring is performed by fluorescence quantitative equipment; the third is to design nfo probes and hybridize the product with colloidal gold test strips for color development. This study developed a detection method based on RT-RPA combined with lateral flow test strips (Lateral Flow, LF), which can be applied to point-of-care rapid testing (POCT) scenarios.

[0005] At present, RPA technology has been successfully applied to the detection of various human pathogens, including fungi, bacteria, viruses, etc., and has shown good performance and application prospects. So far, Mao-ling Sun et al. proposed to use reverse transcription multi-enzyme isothermal rapid amplification and lateral flow lateral test paper technology (RT-MIRA-LFD) to develop a convenient, sensitive and cost-effective HAV detection method, and Yue Zihan proposed to use multi-enzyme isothermal rapid amplification combined with lateral flow chromatography test strips and immunomagnetic bead enrichment method to detect hepatitis A virus. These detection methods are based on the use of hepatitis A virus DNA plasmids to screen primers and amplify nucleic acids, ignoring the problems of RNA extraction efficiency and reverse transcription efficiency, which are different from actual clinical detection.

[0006] Patent CN108034763A discloses primers, probes and kits for detecting hepatitis A and hepatitis E viruses, and discloses a set of primers and probes for detecting hepatitis A virus by recombinase polymerase amplification. However, the results show that a fluorescent PCR instrument is still required, and the detection sensitivity is limited. Patent CN108841926A discloses primers, probes and kits for dual detection of hepatitis E virus and hepatitis A virus by RT-RPA-lateral flow chromatography, and discloses a set of primers and probes for detecting hepatitis A virus by recombinase polymerase amplification. The primers and probes are selected from the VIP1 region, and the primer and probe design is not representative or specific. The viral RNA is reverse transcribed into cDNA before the reaction amplification, and the cDNA is then amplified by RPA, which complicates the operation. Through the results of this study, we have developed a one-step RT-RPA method that uses LFD (lateral flow) test strips for rapid visual detection and extensive screening of hepatitis A virus. This detection method not only solves the problem of reverse transcription efficiency, but also provides data support for the use of RPA technology to detect hepatitis A virus at home and abroad to date. More importantly, it meets the urgent need for direct on-site diagnosis of hepatitis A virus. Summary of the invention

[0007] The invention provides a primer probe for RT-RPA rapid detection of hepatitis A virus.

[0008] The present invention also provides an application of a primer probe for RT-RPA rapid detection of hepatitis A virus.

[0009] The present invention also provides a rapid detection method for hepatitis A virus, using the primer probe for RT-RPA rapid detection of hepatitis A virus described in the present invention.

[0010] The technical solution of the present invention is:

[0011] A primer probe for RT-RPA rapid detection of hepatitis A virus, comprising:

[0012] The forward primer sequence shown in SEQ ID NO: 1;

[0013] The reverse primer sequence shown in SEQ ID NO:2:

[0014] The probe sequence shown in SEQ ID NO:3.

[0015] SEQ ID NO:1TTTTGGRACGTCRCCTTGCAGTGTTAACTTG;

[0016] SEQ ID NO:2CAGTCCTCCGGGCGTTGAATGGTTTTTGTC;

[0017] SEQ ID NO:3TCTTARGCTAATACTTCTATGAAGAGATGCTTGGAT AGGGTAACAGC;

[0018] R stands for A or G.

[0019] An affinity marker is attached to the 5' end of the reverse primer sequence, and the affinity marker includes but is not limited to biotin and its derivatives, digoxigenin, sugars, IgG, vitamins, etc. As an embodiment of the present invention, the affinity marker is biotin.

[0020] The probe sequence is inserted with a mesonucleotide analogue at a position close to the middle in the direction from the 5' end to the 3' end. Specifically, the mesonucleotide analogue is inserted between the 30th and 31st positions in the direction from the 5' end to the 3' end. The mesonucleotide analogue is tetrahydrofuran (THF), which serves as the recognition site of the NFO enzyme (endonuclease IV).

[0021] The 5' end of the probe sequence is attached with a fluorescent group, and the fluorescent group includes but is not limited to fluorescein dyes, rhodamine dyes, and Cy series cyanine dyes. Fluorescent dyes include but are not limited to 6-carboxyfluorescein (FAM), fluorescein isothiocyanate (FITC), tetrachlorofluorescein (TET), rhodamine dyes include but are not limited to rhodamine (TAMRA), tetramethylrhodamine isothiocyanate (TRITC), and red rhodamine (RBITC). Cy series cyanine dyes include but are not limited to Cy2, Cy3, Cy5, Cy7, Cy3B, Cy3.5, and Cy5.5. As an embodiment of the present invention, the fluorescent group is 6-carboxyfluorescein (FAM). The 3' end of the probe sequence is labeled with a polymerase extension blocking group, and the polymerase extension blocking group includes but is not limited to SpacerC6, an amine group, a phosphate group, etc. As an embodiment of the present invention, the polymerase extension blocking group is Spacer C6.

[0022] As described above, the end design of the primer probe is only one implementation method. Other modifications or replacements can be made according to needs and in accordance with technical principles, and they are all regarded as equivalent technical solutions of the present invention.

[0023] The primer probe for RT-RPA rapid detection of hepatitis A virus provided by the present invention can be used for detecting hepatitis A virus, has many advantages such as simple operation, rapid reaction, readability by naked eye, high sensitivity, strong specificity, accurate results, etc., and can also be prepared into reagents or detection systems for hepatitis A virus detection. These reagents or detection systems can be assembled into kits that are easy to use, carry, and store, providing an efficient and convenient solution for the detection of hepatitis A virus in different application scenarios (such as food, body fluids, excrement, vomitus, environment, etc.).

[0024] A reagent or detection system or kit for rapid detection of hepatitis A virus contains the primer probe for RT-RPA rapid detection of hepatitis A virus described in the present invention.

[0025] The present invention is a kind of hepatitis A virus rapid test reagent or detection system or kit, and also contains lateral flow chromatography test strips, and the lateral flow chromatography test strips are provided with quality control lines and detection lines. Specifically, the general setting of the existing LFD test strips is adopted, and the sample loading area, the binding area, and the detection area are sequentially arranged in the flow direction of the sample liquid, and the colloidal gold in the binding area is attached with an antibody of a fluorescent group, that is, a colloidal gold marker; the detection area includes a test line (Test line, T) and a quality control line (Control line, C), and the test line has a ligand of an affinity marker, and the ligand of the affinity marker includes but is not limited to avidin, lectin, staphylococcal protein A SPA, hormone, antibody of an affinity marker, etc.; the quality control line has a secondary antibody of a colloidal gold marker, and the secondary antibody is a general technology in the art, and each commercially available kit is configured, which will not be repeated here. As an embodiment of the present invention, the antibody of the fluorescent group attached to the colloidal gold is an antibody of 6-carboxyfluorescein (FAM), and the ligand of the affinity marker is avidin. Lateral flow chromatography technology is a conventional technology in the field. As long as it does not violate the principle of lateral flow chromatography technology, any modification, replacement, and simplification based on the prior art made on the basis of the implementation mode of the present invention shall be deemed as an equivalent technical solution of the technical solution of the present invention. The protection scope of the present invention is not limited to the implementation mode.

[0026] The rapid detection reagent or detection system or kit for hepatitis A virus of the present invention also contains substances such as buffer, enzyme, magnesium ion, dNTP, etc., which are conventional components used for RPA amplification. The enzyme includes reverse transcriptase, recombinase, single-strand binding protein SSB, DNA polymerase and NFO enzyme (endonuclease IV), etc.

[0027] The reagent, detection system or kit for rapid detection of hepatitis A virus of the present invention also contains a positive standard substance and / or a negative standard substance. The positive standard substance is hepatitis A virus genome RNA, and the negative control substance is sterile ddH2O.

[0028] A rapid detection method for hepatitis A virus, comprising the following steps:

[0029] (1) extracting viral RNA from the sample to be tested, and performing RT-RPA amplification reaction with the primer probe for RT-RPA rapid detection of hepatitis A virus of the present invention, or a reagent or detection system or kit containing the primer probe for RT-RPA rapid detection of hepatitis A virus of the present invention;

[0030] (2) Take the amplified solution and perform a color test on a lateral flow chromatography test strip.

[0031] In step (1), the temperature of the RT-PRA amplification reaction is 42±5°C for 15-20 minutes, preferably 37°C-42°C for 15 minutes, more preferably 42°C for 15 minutes.

[0032] In step (1), the RT-PRA amplification reaction system also contains buffer, enzyme, magnesium ion, dNTP and other substances, which are conventional components used in RPA amplification. The enzymes include reverse transcriptase, recombinase, single-stranded binding protein SSB, DNA polymerase and NFO enzyme (endonuclease IV).

[0033] In step (2), the detection area on the lateral flow chromatography test strip is respectively provided with a test line (Test line, T) and a quality control line (Control line, C). Specifically, a loading area, a binding area, and a detection area are sequentially provided in the direction of sample flow. An antibody with a fluorescent group is attached to the colloidal gold in the binding area to generate a colloidal gold marker; the detection area includes a test line (Test line, T) and a quality control line (Control line, C). The test line has a ligand of an affinity marker, and the ligand of the affinity marker includes but is not limited to avidin, plant lectin, Staphylococcus a protein SPA, hormone, antibody of an affinity marker, etc.; the quality control area has a secondary antibody of a colloidal gold marker, which is a common technology in the art and is configured in each commercially available kit, which will not be repeated here. The result is interpreted as:

[0034] (1) Positive: Two colored bands appear on the test strip, one in the quality control area and the other in the test area;

[0035] (2) Negative: The test strip only has a colored band in the quality control area, and no band in the test area;

[0036] (3) Invalid: No bands appear in either the quality control area or the test area of ​​the test strip.

[0037] In step (2), the amplified solution is diluted first and then tested on a lateral flow chromatography test strip. The dilution multiple is adjusted according to the situation and can be 5-10 times or 10-20 times. The dilution solvent is ddH2O.

[0038] In step (2), the time for the color development test of the lateral flow chromatography test strip is 5 minutes.

[0039] Beneficial effects:

[0040] (1) The present invention is based on the analysis of the complete gene sequences of all hepatitis A virus type I, II and III genotypes downloaded from NCBI, and the primer probes are designed according to the relatively conservative regions, which can successfully detect the required target genotypes and can be used for the detection of all current hepatitis A viruses. Compared with the prior art, the present invention has a wider genotype coverage, and is a universal primer and probe for hepatitis A virus detection, which is more specific and sensitive. In addition to the present invention, there are currently no RPA-specific primers and probes for hepatitis A virus. The present invention brings great help to the prevention and control of viral epidemics, especially for the prevention and control of foodborne viral epidemics.

[0041] (2) The present invention successfully established a detection method for hepatitis A virus RT-RPA-LFD. The sensitivity of the hepatitis A virus detection method was evaluated by using hepatitis A virus standards, and the results showed that a sensitivity of 10 copies / μL could be achieved within an amplification time of 15 minutes. The specificity of the hepatitis A virus detection method was evaluated by using GI and GII type Norovirus RNA standards, and the results showed that the method had a high degree of specificity.

[0042] (3) The RT-RPA amplification system of the present invention directly targets hepatitis A virus RNA, and only requires two primers and one probe for target amplification (target single amplification system), without adding other additional amplification primers, which simplifies the requirements of the RT-RPA amplification system for the amplification primer and probe system, while achieving rapid, sensitive and accurate detection of the target. In addition, the primer and probe screening is strictly in accordance with RNA virus detection, and the establishment of the detection method is also based on RNA virus detection.

[0043] (4) The method of the present invention is simple and has strong specificity. A probe is added to the kit. The probe is designed so that it does not dimerize with the primer to cause false positives. It specifically binds to the target, which increases the specificity of the detection. During amplification, only hydrolysis buffer, primers, probes and templates need to be added, and magnesium ions are added to start the reaction. The professional requirements for operators are low. Compared with traditional RT-qPCR technology, this detection method is faster, simpler, and more sensitive, and exhibits more superior reaction characteristics. This is currently the fastest detection method for hepatitis A virus and truly realizes real-time and on-site diagnosis and treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 Primer design process for HAV RPA. Lines of the same color represent nucleic acid sequences from the same genotype. The target position of the primer is indicated by a black line. The selected sequences are grouped together for comparison, and primers and probes are designed based on relatively conserved regions, named HAVF / HHAVP / HAVR.

[0045] Figure 2 The target positions of the HAV RPA primers and probes. The three designed RT-RPA primers and probes are represented by three different colors. The best primers and probes used in this study are shown in a blue background. The reference sequence is IB (sequence number: KX035096.1).

[0046] Figure 3 Schematic diagram of RT-RPA-LFD detection.

[0047] Figure 4 a is the sensitivity detection picture of hepatitis A virus RT-RPA-LFD, Figure 4 b Specific detection of hepatitis A virus by RT-RPA-LFD.

[0048] Figure 5 Stability test of RT-RPA-LFD for hepatitis A virus.

[0049] Figure 6 Detection of Hepatitis A virus by conventional RT-qPCR assay.

[0050] Figure 7 Table 2 Hepatitis A virus primer probe at a template concentration of 10 2 Schematic diagram of RT-RPA-LFD detection results at 10 copies / μL.

[0051] Figure 8 Table 2 is a schematic diagram of the RT-RPA-LFD detection results of hepatitis A virus primer probe when the template concentration is 10 copies / μL. DETAILED DESCRIPTION

[0052] The present invention will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and are not intended to limit the scope of the present invention. In addition, it should be understood that after reading the content taught by the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms fall within the scope limited by the appended claims of the application equally.

[0053] The materials, reagents and instruments of the present invention are as follows:

[0054] PCR product recovery kit, transfer RNA, DNA Marker, and agarose were purchased from Tiangen Biochemical Technology Co., Ltd.; T7 in vitro transcription kit and one-step reverse transcription kit were purchased from Novozyme Biotechnology Co., Ltd.; RNA isothermal amplification kit (colloidal gold test strip type) was purchased from Anpu Future Biotechnology Co., Ltd.; nucleic acid detection test strips were purchased from Anpu Future Biotechnology Co., Ltd.; RPA primers and probes were synthesized at Biolige Biotechnology Co., Ltd.; Quant-iT TM RiboGreen TM RNA Reagent and Kit and TURBO DNase were purchased from Thermo Fisher Scientific.

[0055] The clean bench and biological safety cabinet were purchased from Singapore Yisi Technology Co., Ltd.; the PCR instrument, vortex oscillator, and small desktop centrifuge were purchased from Bioer Technology Co., Ltd.; the fluorescence quantitative PCR instrument was purchased from Hongshi Medical Technology Co., Ltd.; the multifunctional microplate reader was purchased from Boten Instrument Co., Ltd.; and the gel imaging analyzer was purchased from Bio-Rad Life Sciences Products Co., Ltd.

[0056] Example 1 Design and screening of RPA primers and probes for detecting hepatitis A virus

[0057] like Figure 1 and Figure 2 As shown, all the full gene sequences of hepatitis A virus in NCBI were compared and analyzed by bioinformatics, and primers and probes were designed by selecting conservative regions. The nucleic acid sequence of the RPA primer set is shown in Table 1:

[0058] Table 1 Primers and probes for hepatitis A virus RPA

[0059]

[0060]

[0061] HAVR is labeled with biotin at the 5' end; HAVP is labeled with FAM (6-carboxyfluorescein) at the 5' end, THF (tetrahydrofuran ion) in the middle, and a polymerase extension blocking group (Spacer C6) at the 3' end. The number a indicates the position of the 5' end of the primer or probe on IB (sequence number: KX035096.1). R represents A or G.

[0062] Example 2 RT-RPA-LFD rapid detection method for hepatitis A virus

[0063] According to the instructions of the RNA isothermal amplification kit purchased from Anpu Future Biotechnology Co., Ltd. and the reaction conditions of the RT-RPA-LFD rapid test method, a total of 50 μL of the system was prepared: including 29.4 μL of A buffer, 2 μL of 10 μM forward primer, 2 μL of 10 μM reverse primer, 0.6 μL of 10 μM probe, 2.5 μl of B buffer, 2 μl of RNA template, and ddH2O to make up the rest. Add B buffer to the inside of the reaction tube cap, turn the reaction tube upside down 8 to 10 times to mix thoroughly, centrifuge and incubate at 42 ° C for 15 minutes. After the reaction is completed, take 5 μL of the amplified product, dilute it 10 times with ddH2O, and mix evenly. Drop 50 μL of the diluted product into the sample well of the test strip, and observe and read the results of the quality control line and the test line within 5 minutes.

[0064] Result interpretation: 1. Positive (+): Two red strips appear on the test strip, one at the control line (Control Line, C line) and one at the test line (Test line, T line). A positive result indicates that the sample contains the target nucleic acid fragment to be detected, and its content is greater than or equal to the minimum detection amount of the test strip;

[0065] 2. Negative (-): A red band appears in the quality control area (C line) of the test strip, and there is no band in the detection area (T line). A negative result indicates that the sample does not contain the target nucleic acid to be detected or its content is lower than the minimum detection amount of the test strip;

[0066] 3. Invalid: No bands appear in the control area (C line) and the test area (T line) of the test strip. This result indicates that the test strip used is invalid, damaged or operated incorrectly. At this time, you should read the instructions carefully and re-amplify and test in strict accordance with the instructions. If the problem still exists, stop using this batch of products and contact the supplier.

[0067] The present invention adopts RPA (RPA reaction principle is as follows Figure 3 The method combines a lateral flow chromatography test strip with a FAM-labeled specific probe and a biotin-labeled primer, wherein the reaction principle is that a double-labeled nucleic acid amplification product is formed by immersing the sample end of the test strip in the amplification product, and the amplification product is combined with the anti-FAM antibody labeled with colloidal gold to form a complex. When the complex diffuses to the detection line, the complex is captured by the biotin ligand to form a colored detection line. The method has the advantages that the judgment result can be read by the naked eye, the detection is convenient, the reaction time is within 5 minutes, and the test strip is easy to carry.

[0068] Example 3 RT-RPA-LFD sensitivity detection of hepatitis A virus

[0069] The RNA standard of hepatitis A virus was diluted 10 times with enzyme-free water, and the concentration was diluted to 10 6 -10 1 The sensitivity of the established reaction system was verified by using the above RNA dilutions of each concentration gradient as templates and enzyme-free water as negative control. All RT-RPA-LFD reactions were incubated at 42°C for 15 minutes. The primers and probes in Table 1 were used, and the results were as follows: Figure 4 As shown in a, when the template concentration is 10 3 , 10 2 When the input volume reaches 5 copies / μL, the bands on the test strip are bright and the signal amplification is relatively strong. When the template concentration is 10 or 5 copies / μL, as the nucleic acid content in the sample to be tested decreases, the brightness of the test strip becomes weaker and weaker. When the concentration reaches 10 copies / μL, relatively faint but very clear bands will appear on the test strip; when the input volume reaches 5 copies / μL, no bands appear on the test strip, and the negative control also has no bands. The experiment was repeated three times, and the results showed the same pattern. This shows that the sensitivity of the universal hepatitis A virus RT-RPA-LFD detection method has reached 10 copies / μL.

[0070] like Figure 2 The designed primer probes, except for the primer probe sequences HAVF, HAVR, and HAVP shown in Table 1, other primer probe sequences are shown in Table 2. The sensitivity test results of the primer probes shown in Table 2 are shown in Figure 7 and Figure 8 As shown, when the template concentration is 10 2 When the template concentration was 10 copies / μL, only a few primer probe pairs showed weak bands on the T detection line; when the template concentration was 10 copies / μL, no band appeared on the T detection line. For banana, the sensitivity of the primer probe in Table 1 was the best, reaching 10 copies / μL.

[0071] Table 2 Primers and probes for hepatitis A virus RPA

[0072]

[0073] R3, R5 (Reversed primer) are labeled with biotin at the 5' end; P (probe) is labeled with FAM (6-carboxyfluorescein) at the 5' end, THF (tetrahydrofuran ion) in the middle, and a polymerase extension blocking group (Spacer C6) at the 3' end. R represents A or G; Y represents C or T. Sequence number: KX035096.1.

[0074] Example 4 RT-RPA-LFD specific detection of hepatitis A virus

[0075] According to literature research, the viruses transmitted in shellfish related to the epidemic are Norovirus (83.7%) and HAV (12.8%), HEV (0.3%), Sapo virus (0.3%), Astrovirus (0.5%), Rotavirus (0.3%), Aichi virus (0.3%), Enterovirus (0.3%) and Other viruses (3%). Therefore, the design is to specifically detect HAV among HAV and Norovirus GI and GII, and to establish a rapid detection method for hepatitis A virus based on Norovirus GI.1, Norovirus GII.4 and 10 of HAV. 3 The RNA standard with 100 copies / μL was used as template and enzyme-free water as negative control to verify the specificity of the established reaction system. All RT-RPA-LF reactions were incubated at 42°C for 15 minutes. The experiment was repeated three times. The primers and probes in Table 1 were used. The results are shown in Figure 4 As shown in b, in the test, the hepatitis A virus positive control showed clear bands, while GI-type norovirus, GII and negative controls did not show any bands. This shows that the hepatitis A virus RT-RPA-LFD detection method is highly specific for the recognition of hepatitis A virus. In the early design of the RPA primer and probe theory for HAV, in Pirme Blast, 100% of the HAV sequences were matched, indicating that the specificity is very good.

[0076] Example 5 RT-RPA-LFD Stability Detection of Hepatitis A Virus

[0077] Dilute the HAV RNA standard to a concentration of 10 3 , 10 2 The stability test was carried out with 10, 10, and 5 copies / μL of dilution as templates, and enzyme-free water as template as negative control. The experiment was repeated 7 times. The primers and probes in Table 1 were used, and the results were as follows Figure 5 As shown, 10 2 The detection rates of 10 copies, 10 copies, and 5 copies were 100%, 71.4%, and 0.0%, respectively. Probabilistic analysis of the reliability of RPA based on the results of 7 independent experiments showed that in 71.4% of cases, at least 10 copies / μL of hepatitis A virus molecules were detected; in 100% of cases, at least 10 copies / μL of hepatitis A virus molecules were detected. 2 copies / μL hepatitis A virus molecules.

[0078] Example 6 Detection of Hepatitis A Virus Using Traditional RT-qPCR Technology

[0079] The concentration of the hepatitis A virus RNA standard was adjusted from 108 Dilute to 10 copies / μL 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10 copies / μL as template, and enzyme-free water as template as negative control, and quantification was performed. Using the primers and probes in Table 1, the results are as follows Figure 6 As shown, when the Ct value is 33.29, the concentration of the hepatitis A virus RNA standard is 10 2 When the Ct value is 36.82, the concentration of the RNA standard of hepatitis A virus is 10 copies / μL. Therefore, compared with the traditional test results, this test method is faster, simpler and more sensitive.

[0080] The specific implementation of the present invention described above does not constitute a limitation on the protection scope of the present invention. Any other corresponding changes and modifications made based on the technical concept of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. A primer probe for RT-RPA rapid detection of hepatitis A virus, characterized in that: contain: The forward primer sequence shown in SEQ ID NO: 1; The reverse primer sequence shown in SEQ ID NO:2: The probe sequence shown in SEQ ID NO:

3.

2. A primer probe for RT-RPA rapid detection of hepatitis A virus according to claim 1, characterized in that: The 5' end of the reverse primer sequence is attached with an affinity marker; the probe sequence has a mesonucleotide analog inserted near the middle position from the 5' end to the 3' end; the 5' end of the probe sequence is attached with a fluorescent group, and the 3' end is labeled with a polymerase extension blocking group.

3. The primer probe for RT-RPA rapid detection of hepatitis A virus according to claim 1 or 2 is used for rapid detection of hepatitis A virus or for preparing a reagent, detection system or kit for rapid detection of hepatitis A virus.

4. A reagent or detection system or kit for rapid detection of hepatitis A virus, characterized in that: Contains a primer probe for RT-RPA rapid detection of hepatitis A virus as described in claim 1 or 2.

5. A rapid detection reagent or detection system or kit for hepatitis A virus according to claim 4, characterized in that: Also contains lateral flow chromatography test strips.

6. A rapid detection reagent or detection system or kit for hepatitis A virus according to claim 5, characterized in that: The lateral flow chromatography test strip detection area is provided with a detection line and a quality control line.

7. A hepatitis A virus detection reagent, detection system or kit according to claim 4, characterized in that: Also contains positive standards and / or negative standards.

8. A rapid detection method for hepatitis A virus, characterized in that the steps include: (1) extracting viral RNA from a sample to be tested, and performing RT-RPA amplification reaction with a primer probe for RT-RPA detection of hepatitis A virus according to claim 1 or 2, or a reagent, detection system or kit for detecting hepatitis A virus according to any one of claims 4 to 7; (2) Take the amplified solution and perform a color test on a lateral flow chromatography test strip.

9. A rapid detection method for hepatitis A virus according to claim 8, characterized in that: In step (1), the temperature of the RT-PRA amplification reaction is 42±5°C and the time is 15-20 minutes.

10. A rapid detection method for hepatitis A virus according to claim 8, characterized in that: In step (2), a detection area and a quality control area are provided on the lateral flow chromatography test strip.

Images