A method for synthesizing D-psicose by converting biomass hydrolysate using whole cells

Abstract

The present invention provides a method for synthesizing D-psicose by converting a biomass hydrolysate using whole cells, using a wet cell obtained from a culture solution after induction culture of a recombinant Escherichia coli as a biocatalyst, directly using the biomass hydrolysate as a substrate in the presence of metal ions, and directly performing a catalytic reaction without treatment to obtain D-psicose; the recombinant Escherichia coli is a recombinant Escherichia coli that simultaneously expresses glucose isomerase and D-psicose-3 epimerase. The method of the present invention can realize the one-step conversion of a biomass hydrolysate into a high-concentration D-psicose solution, using whole cells as a catalyst, without the need to purify the enzyme, reducing the process steps, reducing the inhibitory effect of impurities in the hydrolysate on the enzyme, so that the production cost can be significantly reduced, which is conducive to industrial production, and the conversion rate of D-psicose can reach more than 15%.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a method for synthesizing D-psicose by utilizing whole-cell conversion of biomass hydrolyzate. Background Art

[0002] Lignocellulose is a cheap, clean, renewable biological resource and the most abundant carbohydrate in nature. Photosynthesis on Earth can produce up to 15 billion to 20 billion tons of plant dry matter each year, of which more than 50% is lignocellulose biomass. Corncobs are composed of cellulose (32% to 36%), hemicellulose (35% to 40%), lignin (13.1%), and a small amount of ash, pectin, and nitrogen-containing compounds. Cellulose is a macromolecular polysaccharide composed of D-glucose with β-1,4 glycosidic bonds. Each cellulose molecule is composed of approximately 500 to 10,000 glucose molecules. Glucose-rich biomass hydrolysate can be obtained through pretreatment, cellulase hydrolysis, and other processes, which can be used in the production of high-value chemicals such as biofuels and nutritional functional chemicals.

[0003] Functional monosaccharide D-allulose is a ketohexose, the C-3 diastereomer of D-fructose, and a representative low-calorie rare sugar. Its caloric value is only 10% of sucrose. In 2014, the U.S. Food and Drug Administration approved D-allulose as a safe substitute for sucrose. D-allulose has many physiological functions, such as anti-hypertension, anti-hyperlipidemia, antioxidant and anti-atherosclerotic effects. In addition, D-allulose can be used as a precursor for drugs and other rare sugars.

[0004] At present, the main methods for synthesizing D-psicose are chemical synthesis and biosynthesis. There are three main chemical synthesis methods: (1) Using glucose as raw material and molybdate as catalyst, D-psicose can be catalytically produced by heat preservation reaction at 80-120℃ for 2-5h; (2) Using D-fructose as raw material, β-D-pyranose-psicose derivatives are designed and synthesized through the protection and deprotection of isopropylidene and benzyl ether of hydroxyl groups in sugar compounds, and then diisopropylidene-protected psicose is obtained through oxidation and reduction; (3) Ethanol and triethylamine are mixed and boiled to synthesize psicose. Chemical synthesis can prepare D-psicose, but it has problems such as poor economic efficiency, serious environmental pollution, easy production of chemical waste, and generation of worthless by-products. Therefore, the chemical synthesis of D-psicose has not been industrialized. There are two main biosynthetic methods: (1) using dihydroxyacetone phosphate (DHAP)-dependent aldolase to synthesize D-psicose. DHAP can react with D / L-glyceraldehyde under the action of aldolase to produce phosphate sugar, which can then be dephosphorylated to various rare sugars such as D / L-psicose and D / L-tagatose by phosphatase; (2) using D-fructose as a substrate, D-fructose is converted into D-psicose under the catalysis of D-allulose-3-epimerase (DAE).

[0005] Compared with chemical synthesis, biosynthesis has greater advantages: fewer by-products, high stereoselectivity, mild reaction conditions, and more suitable for industrial production. However, it still has problems such as high cost and low product yield. Biomass is widely available and renewable. Using biomass as a substrate can greatly reduce production costs, but biomass substrates have problems such as low hydrolysis efficiency, many impurities, and inhibition of enzyme activity. How to maximize the value of biomass raw materials to produce high-value chemicals is still a huge challenge. Summary of the invention

[0006] The technical problem to be solved by the present invention is: in view of the shortcomings of the prior art, a method for synthesizing D-psicose by converting biomass hydrolysate using whole cells is provided, and the method can realize one-step conversion of biomass hydrolysate into D-psicose solution.

[0007] In order to solve the above technical problems, the technical solution of the present invention is:

[0008] A method for synthesizing D-psicose by converting biomass hydrolyzate using whole cells, the method comprising:

[0009] Using wet cells obtained from the culture solution of recombinant Escherichia coli after induction culture as a catalyst, in the presence of metal ions, and using biomass hydrolyzate as a substrate, a catalytic reaction is carried out to produce D-psicose;

[0010] The recombinant Escherichia coli is a recombinant Escherichia coli that simultaneously expresses glucose isomerase and D-psicose-3-epimerase;

[0011] Furthermore, the recombinant Escherichia coli is a recombinant Escherichia coli containing a gene encoding glucose isomerase GI and a gene encoding DAE of D-psicose-3 epimerase.

[0012] The glucose isomerase encoding gene GI is derived from thermophilic anaerobic bacteria Thermoanaerobacter thermocopriae The nucleotide sequence is as shown in SEQ ID NO 1 or a nucleotide sequence in which the nucleotide sequence shown in SEQ ID NO 1 is replaced, deleted or added with one or more nucleotide residues and is still capable of expressing an enzyme having glucose isomerase activity; the gene encoding DAE of D-psicose-3-epimerase is derived from Acanthopanax spp. Caballeronia concitans The nucleotide sequence is as shown in SEQ ID NO 2 or a nucleotide sequence in which the nucleotide sequence shown in SEQ ID NO 2 is substituted, deleted or added with one or more nucleotide residues and is still capable of expressing an enzyme having D-psicose-3-epimerase activity.

[0013] Furthermore, the recombinant Escherichia coli contains a recombinant plasmid, and the recombinant plasmid contains a gene encoding glucose isomerase GI and a gene encoding DAE of D-psicose-3 epimerase.

[0014] Furthermore, the recombinant Escherichia coli is obtained by transforming the recombinant plasmid into Escherichia coli. The Escherichia coli is preferably Escherichia coli BL21 (DE3).

[0015] The recombinant plasmid is generally constructed by the following method:

[0016] from thermophilic anaerobic bacteria ( Thermoanaerobacter thermocopriae ) and the glucose isomerase encoding gene GI from the fungus Caballeronia concitans The D-psicose-3-epimerase encoding gene DAE (NCBI sequence number WP_040049840.1) was connected to a plasmid vector to obtain a recombinant plasmid. The nucleotide sequences of the GI gene and the DAE gene are shown in SEQ ID NO 1 and SEQ ID NO 2, respectively:

[0017] GI gene, SEQ ID NO 1:

[0018]

[0019] DAE gene, SEQ ID NO 2:

[0020] GTGAACAAAGTTGGCATGTTCTACACCTACTGGTCGACTGAGTGGATGGTCGACTTTCCGGCGACGGCGAAGCGCATCGCCGGACTCGGCTTTGACATGATGGAAATTTCGCTCGGCGAGTTTCACAATCTTCCGGACGCGAAGAAGCGTGAGCTGAAGTCGGTCGCCGACGATCTGGGCCTCACGGTGATGTGCTGTATCGGACTGAAGTCCGAATACGACTTTGCTTCGCCGGACAAGAGCGTTAGAGATGCCGGCACGGAATACGTGAAGCGCCTGCTCGACGATTGCCATCTGCTCGGCGCACCGGTTTTTGCCGGCCTCACATTCTGCGCGTGGCCGCAATCCCCACCGCTCGACATGAAGGACAAGCGCCCCTACGTCGACCGCGCAATCGACAGCGTTCGCCGTGTCATCAAGGTCGCTGAAGACTACGGCATCATTTATGCACTGGAGGTGGTGAATCGCTTCGAGCAGTGGCTGTGCAATGACGCGAAGGAAGCGCTTGCCTTCGCCGACGCGGTCGACAGTCCGGCGTGCAAGGTTCAGCTCGACACGTTCCACATGAATATCGAAGAGAGTTCCTTCCGCGATGCAATCCTCGCCTGCAAGGGCAAGATGGGCCATTTTCATCTGGGCGAAGCGAATCGCCTGCCGCCGGGTGAGGGTCGCCTGCCGTGGGATGAGATCTTCGGGGCGCTGAAGGAAATCGAATACGACGGCACTATCGTCATGGAACCGTTCATGCGCAAGGGCGGTTCGGTCAGCCGCGCGGTGGGCGTGTGGCGGGACATGTCGAACGGTGCGACGGACGAACAGATGGACGAGCGCGCTCGTCGCTCGCTGCAGTTTGTTCGTGAGAAACTGGCGTGA

[0021] The plasmid vector may be pETDuet, pACYCDuet, pCDDFDuet or pRSFDuet, preferably pACYCDuet.

[0022] Furthermore, the recombinant plasmid can be constructed by one of the following methods:

[0023] (1) Connecting the glucose isomerase encoding gene GI whose nucleotide sequence is shown in SEQ ID NO 1 to a plasmid vector to obtain a GI-inserted plasmid p-GI;

[0024] Then, the gene DAE encoding D-psicose-3-epimerase whose nucleotide sequence is shown in SEQ ID NO 2 is connected to p-GI to obtain a recombinant plasmid p-GI-DAE into which GI and DAE are inserted;

[0025] (2) connecting the DAE gene encoding D-psicose-3-epimerase whose nucleotide sequence is shown in SEQ ID NO 2 to a plasmid vector to obtain a plasmid p-DAE into which DAE is inserted;

[0026] Then, the gene encoding glucose isomerase, GI, whose nucleotide sequence is shown as SEQ ID NO 1, is connected to p-DAE to obtain a recombinant plasmid p-DAE-GI in which DAE and GI are inserted.

[0027] Furthermore, preferably, the recombinant plasmid is pACYCDuet-GI-DAE.

[0028] The pACYCDuet-GI-DAE was constructed as follows:

[0029] The gene GI encoding glucose isomerase with a nucleotide sequence as shown in SEQ ID NO 1 is connected to the plasmid vector pACYCDuet to obtain the plasmid pACYCDuet-GI inserted with GI; then the gene DAE encoding D-psicose-3-isomerase with a nucleotide sequence as shown in SEQ ID NO 2 is connected to pACYCDuet-GI to obtain the recombinant plasmid pACYCDuet-GI-DAE inserted with GI and DAE.

[0030] As an improved technical solution, in the reaction, the pH of the reaction system is 6.0-8.0, preferably the pH value is 6.0.

[0031] The reaction temperature is 65-100°C, preferably 75°C.

[0032] The reaction time is 2-6 h, preferably 4 h.

[0033] The metal ion is preferably Co 2+, further, Co 2+ The concentration is 0.1-3.5 mM, preferably Co 2+ The concentration is 2mM.

[0034] The biomass hydrolysate can be hydrolysate of various biomass, such as corn cob hydrolysate and the like.

[0035] In a preferred embodiment, the biomass is corn cobs, and the concentration of glucose in the hydrolyzate is 50-180 g / L.

[0036] The concentration of wet bacteria is preferably 40~50 g / L.

[0037] As an improved technical solution, the wet cells obtained from the culture solution of the recombinant Escherichia coli after induction culture are obtained by the following method:

[0038] The recombinant E. coli was cultured in LB medium at 37°C until OD 600 When the pH value is 0.6-1.0, add IPTG with a final concentration of 0.1-1 mM, induce at 28°C for 10-14 h, and collect the wet cells.

[0039] In a preferred embodiment, the method for synthesizing D-psicose by converting whole-cell biomass hydrolysate is carried out according to the following steps:

[0040] The wet cells obtained from the culture medium of the recombinant Escherichia coli containing the recombinant plasmid pACYCDuet-GI-DAE were used as biocatalysts. 2+ In the presence of , the biomass hydrolyzate is used as a substrate, the catalytic reaction is carried out at 75°C and pH 6 for 2 to 6 hours, and the supernatant is collected by centrifugation to obtain a sugar solution rich in D-psicose, which can be purified to obtain -psicose;

[0041] The beneficial effects of the present invention are:

[0042] (1) The present invention directly uses whole cells as catalysts, does not require enzyme purification, simplifies the process flow, reduces production costs, and is conducive to industrial production. Compared with the prior art that uses D-psicose-3-epimerase alone to convert D-fructose into D-psicose, the production cost is greatly reduced.

[0043] (2) The present invention uses biomass hydrolysate as a substrate, adds recombinant Escherichia coli (which can simultaneously express glucose epimerase and D-psicose-3-epimerase) to the induced wet cells, and synthesizes D-psicose after a catalytic reaction. Through this process, biomass hydrolysate can be directly used as a raw material, which expands the selection of products for high-value utilization of biomass and provides a new direction for biomass utilization. At the same time, after screening of GI and DAE and screening of vectors, the recombinant Escherichia coli constructed by the present invention greatly improves the conversion rate: when the recombinant Escherichia coli can simultaneously express glucose epimerase and D-psicose-3-epimerase, the conversion rate of biomass hydrolysate to obtain D-psicose can reach more than 15%, which is the highest reported so far. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 This graph shows the effect of temperature on the relative enzyme activity of recombinant Escherichia coli containing different recombinant plasmids.

[0045] Figure 2 This is a graph showing the effect of pH on the relative enzyme activity of recombinant Escherichia coli containing different recombinant plasmids.

[0046] Figure 3 The optimal Co 2+ Concentration results graph.

[0047] Figure 4 The figure is a bar graph comparing the enzyme activities of recombinant Escherichia coli containing different recombinant plasmids under the optimal conditions.

[0048] Figure 5 Bar graph comparing the D-psicose conversion rates of recombinant Escherichia coli containing the co-expression plasmid pACYCDuet-GI-DAE at different substrate concentrations and temperatures.

[0049] Figure 6 This is a bar chart comparing the relative enzyme activities of recombinant Escherichia coli containing the co-expression plasmid pACYCDuet-GI-DAE at different temperatures. DETAILED DESCRIPTION

[0050] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0051] Example 1

[0052] Using D-glucose as substrate (glucose concentration was 50 g / L), metal ions Co 2+(concentration of 1 mM) and wet cells of recombinant Escherichia coli after induction (wet cell concentration of 40 g / L), adjust pH to 7.0, control reaction temperature to 90°C, and catalyze for 5 min. After terminating the reaction, high-speed centrifugation for 10 min was performed to collect the supernatant, and D-psicose was obtained. The recombinant Escherichia coli is a recombinant Escherichia coli that simultaneously expresses glucose isomerase and D-psicose-3-dimerase;

[0053] Wet cells were prepared as follows:

[0054] (1) Construction of recombinant plasmid pACYCDuet-TtGIase-ToDAEase:

[0055] Derived from Thermoanaerobacter thermocopriae The GI gene fragment (synthesized by Qingke Company) was used as a template, and PCR amplification was performed with primers pET1-GI-F: CTTTAATAAGGAGATATACCATGGAATACTTCAAGAACGT and pET1-GI-R: ACTTAAGCATTATGCGGCCGCTTAGTGATGATGATGGTGATG to obtain the target fragment GI. The amplification program is shown in Table 1:

[0056] Table 1

[0057]

[0058] The plasmid pACYCDuet backbone was amplified using pET1-GI line-F: GGTATATCTCCTTATTAAAGTTAAACAAAAT and pET1-GI line-R: GCGGCCGCATAATGCTTAAG as primers to obtain the linear pACYCDuet vector. The amplification procedure is shown in Table 2:

[0059] Table 2

[0060]

[0061] The GI fragment was connected to the linear pACYCDuet vector by one-step cloning according to the instructions of the one-step cloning kit (ClonExpress Ultra One Step Cloning Kit C115, Vazyme Biotech, Nanjing, China); then it was introduced into DH5α competent cells and verified by colony PCR. The single colony corresponding to the positive clone was picked and verified by sequencing to obtain the pACYCDuet-GI plasmid.

[0062] Derived from Caballeronia concitansThe DAE gene fragment (synthesized by Qingke Company) was used as a template, pET1-DAE-F: GATATACATATGGCAGATCTCATGAAGCAGAAAATCGGTAT was used as an upstream primer, and pET1-DAE-R: CAGCCTAGGTTAATTAATCATTAGTGGTGGTGGTGATGAT was used as a downstream primer for PCR amplification to obtain the target fragment DAE; the amplification program is shown in Table 1.

[0063] The pACYCDuet-GI plasmid backbone was amplified using pET1-DAE line -F TTAATTAACCTAGGCTGCTG as the upstream primer and pET1-DAE line-RGAGATCTGCCATATGTATAT as the downstream primer to obtain the linear pACYCDuet-GI vector. The amplification procedure is shown in Table 2.

[0064] The DAE fragment was connected to the linear pACYCDuet-GI vector by one-step cloning, and the recombinant plasmid pACYCDuet-GI-DAE was obtained by sequencing verification.

[0065] The recombinant plasmids pETDuet-GI-DAE, pETDuet-DAE-GI, pACYCDuet-GI-DAE, pACYCDuet-DAE-GI, pCDFDuet-GI-DAE, pCDFDuet-DAE-GI, and pRSFDuet-DAE-GI were constructed by the same one-step cloning method. The primers and primer sequences used in the construction are shown in Tables 3 and 4, respectively.

[0066] Table 3

[0067] Co-expression plasmid Primers used for construction pETDuet-GI-DAE pET1-GI-F, pET1-GI-R, pET1-GI line-F, pET1-GI line-R, pET1-DAE-F, pET1-DAE-R, pET1-DAE line-F, pET1-DAE line-R pETDuet-DAE-GI pET2-DAE-F, pET2-DAE-R, pET2-GI-F, pET2-GI-R, pET1-GI line-F, pET1-GI line-R, pET1-DAE line-F, pET1-DAE line-R pACYCDuet-GI-DAE pET1-GI-F, pET1-GI-R, pET1-GI line-F, pET1-GI line-R, pET1-DAE-F, pET1-DAE-R, pET1-DAE line-F, pET1-DAE line-R pACYCDuet-DAE-GI pET2-DAE-F, pACYC2-DAE-R, pET2-GI-F, pET2-GI-R, pET1-GI line-F, pET1-GI line-R, pET1-DAE line-F, pET1-DAE line-R pCDFDuet-GI-ADE pET1-GI line-F, pCDF1-GI line-R, pCDF1-GI-F, pET1-GI-R, pET1-DAE-F, pET1-DAE-R, pET1-DAE line-F, pET1-DAE line-R pCDFdUET-DAE-GI pET1-GI line-F, pCDF1-GI line-R, pET2-GI-F, pET2-GI-R, pCDF2-DAE-F, pET2-DAE-R, pET1-DAE line-F, pET1-DAE line-R pRSFDuet-DAE-GI pET1-GI line-F, pCDF1-GI line-R, pET2-GI-F, pET2-GI-R, pCDF2-DAE-F, pET2-DAE-R, pET1-DAE line-F, pET1-DAE line-R

[0068] Table 4

[0069] pET1-GI-F ctttaagaaggagatataccatggaatacttcaagaacgt pET1-GI-R cttaagcattatgcggccgcttagtgatgatgatggtgat pET1-GI line-F gcggccgcataatgctta pET1-GI line-R ggtatatctccttcttaaagt pET1-DAE-F gatatacatatggcagatctcatgaagcagaaaatcggtat pET1-DAE-R cagcctaggttaattaatcattagtggtggtggtgatgat pET1-DAE line-F ttaattaacctaggctgctg pET1-DAE line-R gagatctgccatatgtatat pET2-DAE-F gcggccgcataatgctta pET2-DAE-R ggtatatctccttcttaaagt pET2-GI-F atatacatatggcagatctcatggaatacttcaagaacgt pET2-GI-R cagcagcctaggttaattaattagtgatgatgatggtgat pACYC1-GI-R agcatcaccatcatcatcactaagcggccgcataatgcttaag pACYC1-GI line-R gcggccgcataatgcttaag pACYC2-DAE-R ttaagcattatgcggccgcttagtggtggtggtgatg pCDF1-GI line-R gagatctgccatatgtatat pCDF1-GI-F ctttaataaggagatataccatggaatacttcaagaacgttcc pCDF2-DAE-F tatacatatggcagatctcatgaagcagaaaatcggtat

[0070] (2) Transformation of recombinant plasmids: The recombinant plasmids pETDuet-GI-DAE, pETDuet-DAE-GI, pACYCDuet-GI-DAE, pACYCDuet-DAE-GI, pCDFDuet-GI-DAE, pCDFDuet-DAE-GI, and pRSFDuet-DAE-GI were transformed into Escherichia coli DE3 to obtain recombinant Escherichia coli A, B, C, D, E, F, and G.

[0071] (3) Induced expression of recombinant proteins GI and DAE: Recombinant E. coli A, B, C, D, E, F, and G were cultured in LB medium at 37°C. OD600 When the pH value is 0.6-1.0, add IPTG with a final concentration of 0.1 mM, induce at 28°C for 10-14 h, and collect the wet cells.

[0072] LB liquid medium, including the following components: tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, dissolved in distilled water, adjusted to pH 7.0.

[0073] The reaction formula of the whole reaction process of the reaction system of the present invention is as follows:

[0074]

[0075] Among them, GI: glucose isomerase; DAE: D-psicose-3-epimerase.

[0076] The consumption of substrate D-fructose and the production of product D-psicose were detected by high performance liquid chromatography (HPLC), and the relative enzyme activity was calculated. The HPLC detection conditions were as follows: chromatographic analysis column Waters Sugar Ca, mobile phase 500 mg / L EDTA calcium salt, flow rate 0.4 mL / min, column temperature 80°C. Differential refractive index (RI) detector.

[0077] Example 2

[0078] The reaction temperature of the reaction system during the catalytic reaction was 100° C., and the remaining operations were the same as in Example 1.

[0079] Example 3

[0080] During the catalytic reaction, the reaction temperature of the entire reaction system was 95° C., and the remaining operations were the same as in Example 1.

[0081] Example 4

[0082] During the catalytic reaction, the reaction temperature of the entire reaction system was 85° C., and the remaining operations were the same as in Example 1.

[0083] Example 5

[0084] During the catalytic reaction, the reaction temperature of the entire reaction system was 80° C., and the remaining operations were the same as in Example 1.

[0085] Example 6

[0086] Using D-glucose as substrate (substrate concentration of 50 g / L), metal ions Co 2+(concentration of 1 mM) and induced recombinant Escherichia coli wet cells (concentration of wet cells is 40 g / L), the pH is adjusted to 6.0, the reaction temperature is controlled at 90°C, and after 5 minutes of catalytic reaction, the reaction is terminated and high-speed centrifugation is performed for 10 minutes to collect the supernatant to obtain D-psicose.

[0087] Example 7

[0088] During the catalytic reaction, the reaction pH of the entire reaction system was 6.5, and the remaining operations were the same as in Example 6.

[0089] Example 8

[0090] During the catalytic reaction, the reaction pH of the entire reaction system was 7.0, and the remaining operations were the same as in Example 6.

[0091] Example 9

[0092] During the catalytic reaction, the reaction pH of the entire reaction system was 7.5, and the remaining operations were the same as in Example 6.

[0093] Example 10

[0094] During the catalytic reaction, the reaction pH of the entire reaction system was 8.0, and the remaining operations were the same as in Example 6.

[0095] Embodiment 11

[0096] Using D-glucose as substrate (substrate concentration of 50 g / L), metal ions Co 2+ (concentration is 2 mM) and induced recombinant Escherichia coli wet cells (concentration of wet cells is 40 g / L), adjust the pH to 6.0, control the reaction temperature to 90°C, and after 5 minutes of catalytic reaction, terminate the reaction and centrifuge at high speed for 10 minutes to collect the supernatant to obtain D-psicose.

[0097] Example 12

[0098] The total amount of Co in the reaction system 2+ The concentration was 0.1 mM, and the rest of the operations were the same as in Example 11.

[0099] Embodiment 13

[0100] The total amount of Co in the reaction system 2+ The concentration was 0.5 mM, and the rest of the operations were the same as in Example 11.

[0101] Embodiment 14

[0102] The total amount of Co in the reaction system 2+ The concentration was 1 mM, and the rest of the operations were the same as in Example 11.

[0103] Embodiment 15

[0104] The total amount of Co in the reaction system 2+ The concentration was 1.5 mM, and the rest of the operations were the same as in Example 11.

[0105] Example 16

[0106] The total amount of Co in the reaction system 2+ The concentration was 2.5 mM, and the rest of the operations were the same as in Example 11.

[0107] Embodiment 17

[0108] The total amount of Co in the reaction system 2+ The concentration was 3 mM, and the rest of the operations were the same as in Example 11.

[0109] Embodiment 18

[0110] The total amount of Co in the reaction system 2+ The concentration was 3.5 mM, and the rest of the operations were the same as in Example 11.

[0111] Embodiment 19

[0112] Using D-glucose as substrate (substrate concentrations of 100 g / L, 200 g / L, and 300 g / L, respectively), metal ions Co 2+ (concentration is 2 mM) and induced recombinant Escherichia coli wet cells (concentration of wet cells is 40 g / L), adjust the pH to 6.0, control the reaction temperature to 75°C, and after 4 hours of catalytic reaction, terminate the reaction and centrifuge at high speed for 10 minutes to collect the supernatant to obtain D-psicose.

[0113] The consumption of substrate D-fructose and the production of product D-psicose were detected by high performance liquid chromatography (HPLC), and the conversion rate of D-psicose was calculated. The HPLC detection conditions were as follows: chromatographic analysis column Waters Sugar Ca, mobile phase 500 mg / L EDTA calcium salt, flow rate 0.4 mL / min, column temperature 80°C. Differential refractive index (RI) detector.

[0114] Embodiment 20

[0115] During the catalytic reaction, the reaction temperature of the entire reaction system was 90°C, and the remaining operations were the same as in Example 19.

[0116] Embodiment 21

[0117] During the catalytic reaction, the reaction temperature of the entire reaction system was 80°C, and the remaining operations were the same as in Example 19.

[0118] Embodiment 22

[0119] During the catalytic reaction, the reaction temperature of the entire reaction system was 70°C, and the remaining operations were the same as in Example 19.

[0120] Embodiment 23

[0121] During the catalytic reaction, the reaction temperature of the entire reaction system was 65°C, and the remaining operations were the same as in Example 19.

[0122] Embodiment 24

[0123] Corncob hydrolyzate was used as the reaction substrate during the catalytic reaction, and the reaction system and other operations of the entire reaction system were the same as those of Example 19 (the glucose concentration in the corncob hydrolyzate was 125 g / L). The reaction results are shown in Table 5.

[0124] Table 5

[0125] substrate glucose concentration D-allulose conversion rate corncob hydrolysate (25% dry basis) 125 g / L 16% glucose solution 125 g / L 19.1%

[0126] Embodiment 25

[0127] The reaction temperature during the catalytic reaction was 55 o C, the reaction system and other operations of the entire reaction system are the same as those of Example 24. The reaction results are as follows Figure 6 shown.

[0128] Embodiment 26

[0129] The reaction system temperature during the catalytic reaction was 60 o C, the reaction system and other operations of the entire reaction system are the same as those of Example 24. The reaction results are as follows Figure 6 shown.

[0130] Embodiment 27

[0131] The reaction system temperature during the catalytic reaction was 65 o C, the reaction system and other operations of the entire reaction system are the same as those of Example 24. The reaction results are as follows Figure 6 shown.

[0132] Embodiment 28

[0133] The reaction system temperature during the catalytic reaction was 70 o C, the reaction system and other operations of the entire reaction system are the same as those of Example 24. The reaction results are as follows Figure 6 shown.

[0134] Embodiment 29

[0135] The reaction temperature during the catalytic reaction was 75 o C, the reaction system and other operations of the entire reaction system are the same as those of Example 24. The reaction results are as follows Figure 6shown.

[0136] Embodiment 30

[0137] The reaction system temperature during the catalytic reaction was 80 o C, the reaction system and other operations of the entire reaction system are the same as those of Example 24. The reaction results are as follows Figure 6 shown.

[0138] Embodiment 31

[0139] The reaction temperature during the catalytic reaction was 85 o C, the reaction system and other operations of the entire reaction system are the same as those of Example 24. The reaction results are as follows Figure 6 shown.

[0140] In order to better demonstrate that the method of the present invention can improve the conversion rate of D-psicose and produce D-psicose under weak acid conditions, the present invention also prepared two comparative examples.

[0141] Comparative Example 1

[0142] The difference from the operation of Example 19 is that the co-expression plasmid is derived from Acidocellulose Bacteria ( Acidothermus cellulolyticus The co-expression plasmid pETDuet-Dosp-DAE / Acce-GI was constructed by combining GI from Dorea sp. and DAE from Dorea sp. The reaction temperature was 65°C, the reaction pH was 6.5, and the metal ion was Co 2+ (Concentration is 0.4 mM).

[0143] Comparative Example 2

[0144] The difference from the operation of Example 19 is that the co-expression plasmid is derived from Bessica caldectes ( Caldicellulosiruptor bescii DSM 6725) and derived from Ruminococcus sp. 5_1_39BFAA DAE constructed pET28(a)-GI-DAE; the reaction temperature was 70°C, the reaction pH was 7.0, and no exogenous metal ions were added.

[0145] The relative enzyme activities of the E. coli containing the co-expression plasmid pACYCDuet-GI-DAE in Examples 1-5 of the present invention are shown in Table 6 below. The relative enzyme activities of all recombinant E. coli are affected by temperature as follows: Figure 1 In Examples 6-10, the relative enzyme activities of E. coli C containing the co-expression plasmid pACYCDuet-GI-DAE are shown in Table 7 below. The relative enzyme activities of all recombinant E. coli are affected by pH as follows: Figure 2The relative enzyme activities of E. coli C containing the co-expression plasmid pACYCDuet-GI-DAE in Examples 11-18 are shown in Table 8 below. The optimal Co 2+ Concentration Figure 3 ; The comparison of enzyme activities of all recombinant E. coli under their respective optimal conditions is shown below Figure 4 The D-psicose conversion rates of E. coli C containing the co-expression plasmid pACYCDuet-GI-DAE in Examples 19-23 and Comparative Examples 1-2 are shown in Table 9 below, and the D-psicose conversion rate of E. coli C containing the co-expression plasmid pACYCDuet-GI-DAE at different substrate concentrations and temperatures is shown in the bar chart ( Figure 5 );

[0146] Table 6

[0147] Example Substrate concentration Wet cell concentration <![CDATA[Co 2+ Concentration]]> temperature pH Relative enzyme activity Example 1 50 g / L 40 g / L 1 mM 90℃ 7.0 100% Example 2 50 g / L 40 g / L 1 mM 100℃ 7.0 92% Example 3 50 g / L 40 g / L 1 mM 95℃ 7.0 98% Example 4 50 g / L 40 g / L 1 mM 85℃ 7.0 67.6% Example 5 50 g / L 40 g / L 1 mM 80℃ 7.0 65%

[0148] Table 7

[0149] Example Substrate concentration Wet cell concentration <![CDATA[Co 2+ Concentration]]> temperature pH Relative enzyme activity Example 6 50 g / L 40 g / L 1 mM 90℃ 6.0 100% Example 7 50 g / L 40 g / L 1 mM 90℃ 6.5 61% Example 8 50 g / L 40 g / L 1 mM 90℃ 7.0 40% Example 9 50 g / L 40 g / L 1 mM 90℃ 7.5 30.7% Example 10 50 g / L 40 g / L 1 mM 90℃ 8.0 22.6%

[0150] Table 8

[0151] Example Substrate concentration Wet cell concentration <![CDATA[Co 2+ Concentration]]> temperature pH Relative enzyme activity Embodiment 11 50 g / L 40 g / L 2 mM 90℃ 6.0 100% Example 12 50 g / L 40 g / L 0.1 mM 90℃ 6.0 37.28% Embodiment 13 50 g / L 40 g / L 0.5 mM 90℃ 6.0 81.52% Embodiment 14 50 g / L 40 g / L 1 mM 90℃ 6.0 96.81% Embodiment 15 50 g / L 40 g / L 1.5 mM 90℃ 6.0 89.79% Example 16 50 g / L 40 g / L 2.5 mM 90℃ 6.0 92.05% Embodiment 17 50 g / L 40 g / L 3 mM 90℃ 6.0 85.31% Embodiment 18 50 g / L 40 g / L 3.5 mM 90℃ 6.0 55.64%

[0152] Table 9

[0153] Example Substrate concentration Wet cell concentration <![CDATA[Co 2+ Concentration]]> temperature pH Conversion rate Embodiment 19 100 g / L 40 g / L 2 mM 75℃ 6.0 19.12% Embodiment 20 100 g / L 40 g / L 2 mM 90℃ 6.0 14% Embodiment 21 100 g / L 40 g / L 2 mM 80℃ 6.0 19.03% Embodiment 22 100 g / L 40 g / L 2 mM 70℃ 6.0 18.17% Embodiment 23 100 g / L 40 g / L 2 mM 65℃ 6.0 17.88% Comparative Example 1 100 g / L 40 g / L 1 mM 65℃ 6.5 18.2% Comparative Example 2 100 g / L <![CDATA[OD 600 30]]> none 70℃ 7.0 18.6%

[0154] Through Tables 6 to 9 and Figures 1 to 5 The data show that the present invention uses D-glucose as a substrate and adds metal ions Co 2+ The wet cells of the induced recombinant Escherichia coli (capable of simultaneously expressing glucose isomerase and D-psicose-3-epimerase) can realize a one-step conversion from D-glucose to D-psicose after a catalytic reaction. Compared with the prior art (the process in Comparative Examples 1-2), this process can realize the production of D-psicose under weak acid conditions and relatively high temperature conditions; by comparison Figure 1-4 It can be found that among all co-expressing cells, the co-expressing cell pACYCDuet-TtGI-ToDAE4 has the best catalytic efficiency; Figure 5 It was found that under the conditions most suitable for the industrial production of D-psicose (temperature 75°C, pH 6.0), the recombinant Escherichia coli achieved a maximum D-psicose conversion rate of 19.12%, which is higher than the existing technology.

[0155] Compared with using glucose directly as the substrate, the conversion rate of corn cob hydrolysate as the substrate is only 16.1%, although it is lower due to the presence of small molecule impurities in the substrate solution. However, it is still the only and highest reported in the prior art.

[0156] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for synthesizing D-psicose by converting biomass hydrolysate using whole cells, characterized in that The method is: The wet cells obtained from the culture solution of the recombinant Escherichia coli after induction culture are used as biocatalysts, and in the presence of metal ions, biomass hydrolyzate is used as a substrate to carry out a catalytic reaction to obtain D-psicose; The recombinant Escherichia coli is a recombinant Escherichia coli that simultaneously expresses glucose isomerase and D-psicose-3-epimerase; The recombinant Escherichia coli is a recombinant Escherichia coli containing a gene encoding glucose isomerase GI and a gene encoding DAE of D-psicose-3 epimerase; The recombinant Escherichia coli is obtained by transforming the recombinant plasmid into Escherichia coli; The recombinant plasmid is pACYCDuet-GI-DAE, which is constructed by the following method: The GI gene encoding glucose isomerase whose nucleotide sequence is shown in SEQ ID NO 1 is connected to the plasmid vector pACYCDuet to obtain the GI-inserted plasmid pACYCDuet-GI; then the DAE gene encoding D-psicose-3-epimerase whose nucleotide sequence is shown in SEQ ID NO 2 is connected to pACYCDuet-GI to obtain the recombinant plasmid pACYCDuet-GI-DAE inserted with GI and DAE; The pH value of the reaction system was 6.0, the reaction temperature was 75°C, and Co 2+ The concentration is 2 mM; the reaction time is 2-6 h.

Images