Application of a target for inhibiting the invasion of Mycobacterium tuberculosis cells

Abstract

The present application relates to the field of biotechnology, and in particular to an application of a target for inhibiting the invasion of Mycobacterium tuberculosis cells. Specifically, it is at least one of the following applications of a substance that reduces the content of Rv2185c protein: 1) Application in the preparation of products for the treatment or auxiliary treatment of tuberculosis; 2) Application in the preparation of products for the prevention or inhibition of Mycobacterium tuberculosis infection. The protein encoded by the Rv2185c gene is located on the membrane of Mycobacterium tuberculosis and can interact with phospholipids (PI4P, PIP2, PIP3) on the surface of host cells, thereby inhibiting the phagocytosis of Mycobacterium tuberculosis by macrophages. Therefore, with Rv2185c The gene is a target for inhibiting the invasion of Mycobacterium tuberculosis cells. By reducing the content of Rv2185c protein on the membrane of Mycobacterium tuberculosis, it can provide a new direction for the treatment of tuberculosis or the inhibition of Mycobacterium tuberculosis infection.

Description

Technical Field

[0001] The present application belongs to the field of biotechnology, and in particular relates to an application of a target for inhibiting the invasion of Mycobacterium tuberculosis cells. Background Art

[0002] Mycobacterium tuberculosis (Mtb) is an intracellular parasite. Existing studies have shown that after being inhaled into the alveolar cavity of the human lung, Mtb interacts with alveolar macrophages and then invades the cells, which is phagocytosis. Phagocytosis is an important part of the host's innate and adaptive immune response to pathogens. Unlike macropinocytosis, it relies on cell surface receptors to recognize and bind pathogens.

[0003] The binding and phagocytosis of Mycobacterium tuberculosis to macrophages can be mediated by different types of receptors, including complement receptors, mannose receptors, surfactant receptors, scavenger receptors, and Fcγ receptors. Summary of the invention

[0004] The purpose of the present application is to provide an application of a target for inhibiting the invasion of Mycobacterium tuberculosis cells, aiming to provide a new Mycobacterium tuberculosis target to better address the technical problems of tuberculosis.

[0005] In order to achieve the above application purpose, the technical solution adopted in this application is as follows:

[0006] The application provides an application, namely at least one of the following applications of a substance for reducing the content of Rv2185c protein:

[0007] 1) Application in the preparation of products for the treatment or auxiliary treatment of tuberculosis;

[0008] 2) Use in the preparation of products for preventing or inhibiting Mycobacterium tuberculosis infection.

[0009] The present application discovered a role played by a Mycobacterium tuberculosis membrane protein in the phagocytosis of Mycobacterium tuberculosis by macrophages. Specifically, the Rv2185c protein located on the Mycobacterium tuberculosis membrane can interact with the phospholipids on the surface of the host cell: phosphatidylinositol-4-phosphate (PI4P), phosphatidylinositol-4,5-bisphosphate (PIP2), and phosphatidylinositol-3,4,5-triphosphate (PIP3), thereby inhibiting macrophages from phagocytizing Mycobacterium tuberculosis. Therefore, by using this as a target for inhibiting the invasion of Mycobacterium tuberculosis cells and reducing the content of Rv2185c protein on the Mycobacterium tuberculosis membrane, a new direction can be provided for the treatment of tuberculosis or the inhibition of Mycobacterium tuberculosis infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings required for use in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0011] Figure 1 A in the embodiment of the present application Rv2185c The location of the gene in the genome; B is bacterial PCR verification Rv2185c Electrophoresis diagram of gene knockout strains and complemented strains, where the second lane from the left is the wild-type strain (represented by H37Rv), and the third and fifth lanes are Rv2185c Knockout strains ( △Rv2185c ), Lane 4 is the complemented strain ( △Rv2185c::Rv2185c express);

[0012] Figure 2 A is a graph showing the bacterial load of THP-1 macrophages infected with different strains in the examples of the present application; B is a graph showing the phagocytic level of macrophages detected by flow cytometry; C is a graph showing the phagocytic ratio of different macrophages to different strains detected by flow cytometry, and D is the statistical result of C;

[0013] Figure 3 A is a diagram showing the adhesion and invasion experimental results of the present application example; B is a diagram showing the phagocytic level of macrophages after Rv2185c antibody blocking;

[0014] Figure 4 For the present application embodiment, the expression with Rv2185cThe gene and control plasmids were transfected into cells, and the localization of Rv2185c protein was detected by laser confocal microscopy;

[0015] Figure 5 This is a diagram of the experimental results of the membrane lipid test paper verification of the embodiment of the present application.

[0016] Statistical analysis was performed using GraphPad Prism 8.0 software, and data were expressed as mean ± standard deviation. One-way ANOVA was used for comparison between groups, and unpaired t-test was used for comparison between two independent groups. Statistical significance P values ​​are expressed as follows: P ≤ 0.05 indicates significant, and P values ​​less than 0.0001, 0.001, 0.01, and 0.05 indicate extremely significant, very significant, moderately significant, and slightly significant, respectively, and are expressed as ****, ***, **, and *, respectively. DETAILED DESCRIPTION

[0017] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present application more clearly understood, the present application is further described in detail below in conjunction with the embodiments. It should be noted that the following embodiments are only for illustrating the invention and should not be regarded as limiting the present application.

[0018] In this application, the term "and / or" describes the association relationship of associated objects, indicating that there may be three relationships. For example, A and / or B can mean: A exists alone, A and B exist at the same time, and B exists alone. A and B can be singular or plural. The character " / " generally indicates that the associated objects are in an "or" relationship.

[0019] In this application, "at least one" means one or more, "more than one" means two or more. "At least one of the following" or similar expressions refers to any combination of these items, including any combination of single or plural items.

[0020] It should be understood that in the various embodiments of the present application, the size of the serial numbers of the above-mentioned processes does not mean the order of execution, some or all of the steps can be executed in parallel or sequentially, and the execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of the present application.

[0021] The terms used in the embodiments of the present application are only for the purpose of describing specific embodiments, and are not intended to limit the present application. The singular forms "a", "said" and "the" used in the embodiments of the present application and the appended claims are also intended to include plural forms, unless the context clearly indicates other meanings.

[0022] The terms "first" and "second" are used only for descriptive purposes to distinguish objects such as substances from each other, and should not be understood as indicating or implying relative importance or implicitly indicating the number of indicated technical features. For example, without departing from the scope of the embodiments of the present application, the first XX may also be referred to as the second XX, and similarly, the second XX may also be referred to as the first XX. Thus, the features defined as "first" and "second" may explicitly or implicitly include one or more of the features.

[0023] In the present application example, by constructing Mycobacterium tuberculosis Rv2185c Knockout strains ( △Rv2185 ), infected THP1 macrophages with it, and found that it can affect the phagocytosis of Mycobacterium tuberculosis by macrophages, and further confirmed by experiments that Rv2185c protein can interact with phospholipids PI4P, PIP2, and PIP3 on the surface of host cell membranes. This discovery provides a new target for the treatment of tuberculosis. To this end, the following solution is proposed in the embodiment of this application.

[0024] The application provided in the application example is at least one of the following applications of a substance for reducing the content of Rv2185c protein:

[0025] 1) Application in the preparation of products for the treatment or auxiliary treatment of tuberculosis;

[0026] 2) Use in the preparation of products for preventing or inhibiting Mycobacterium tuberculosis infection.

[0027] The substance for reducing the content of Rv2185c protein in the embodiment of the present application has the effect of reducing the expression of Rv2185c protein on the membrane of Mycobacterium tuberculosis. In this way, the phagocytosis of Mycobacterium tuberculosis by macrophages can be effectively promoted. Therefore, the above-mentioned substance can be used to treat tuberculosis or assist in the treatment of tuberculosis, prevent Mycobacterium tuberculosis infection or inhibit Mycobacterium tuberculosis infection.

[0028] Specifically, the nucleotide sequence of the gene encoding the above Rv2185c protein is shown in SEQ ID No.1.

[0029] SEQ ID No. 1, genomic DNA, length 435bp:

[0030] Gtggcggacaagacgacacagacgatttacatcgacgcggatccaggcgaggtgatgaaggcgatcgccgacatcgaagcctacccgcaatggatttcggagtataagg aagtcgagatcctagaggccgacgacgagggctacccgaaacgagcgcgaatgttgatggacgcagccatcttcaaagacaccttgatcatgtcctacgagtggccgga agaccgccaatcgcttagctggactctcgaatccagctcgctgctaaagtccctcgaaggcacgtatcgcttggcgcccaagggttctggcactgaggtcacctacgag cttgccgtcgaccttgctgtccccatgatcgggatgctcaagcgtaaggcggaacgcaggttgatagacggcgcgttgaaggatctgaagaaacgagtcgagggctga.

[0031] In some embodiments, the substance that reduces the content of Rv2185c protein includes a substance that inhibits the synthesis of Rv2185c protein, a substance that promotes the degradation of Rv2185c protein, a substance that knocks down Rv2185c Genetic material, knockout Rv2185c At least one of the genetic materials.

[0032] In some embodiments, knockdown Rv2185c The gene-silencing substance can be any substance that can make the gene encoding Rv2185c protein unable to express, such as silencing Rv2185c Genetic material. For example, including silencing Rv2185c At least one of the miRNA, siRNA, dsRNA, and shRNA of a gene.

[0033] In some embodiments, knockout Rv2185c The genetic material may be in any manner that causes the Mycobacterium tuberculosis cell to not produce Rv2185c A substance that produces a functional protein product of a gene, such as by removing all or part of the coding gene sequence, introducing a frameshift mutation so that no functional protein is produced, removing or changing regulatory components (such as promoter editing) so that the coding gene sequence is not transcribed, or preventing translation by binding to mRNA. Usually, the knockout is performed at the genomic DNA level, so that the offspring of the cell also carry the knockout permanently.

[0034] Specifically, knockout Rv2185cGenetic material can be any substance that can make Rv2185c A substance in which a gene has mutated (the mutation may be in the form of deletion mutation and / or insertion mutation and / or base substitution) and has lost its activity, including at least one of the zinc finger protein ZFN gene editing system, the TALENs gene editing system, and the CRISPR / Cas9 gene editing system.

[0035] In some embodiments, knockout Rv2185c Gene material can be used to knock out Rv2185c CRISPR / Cas9 gene editing system for knockout Rv2185c The CRISPR / Cas9 gene editing system includes Cas9 nuclease and targeting Rv2185c The sgRNA targeting the gene. The targeting nucleotide sequences of the sgRNA are shown in SEQ ID No.2 and SEQ ID No.3.

[0036] Targeting Rv2185c The target sequence of the sgRNA of the gene is:

[0037] SEQ ID No.2: CGCAATGGATTTCGGAGTAT;

[0038] SEQ ID No. 3: GACGGCGCGTTGAAGGATCT.

[0039] For example, the present application cloned the designed and synthesized Rv2185c-sgRNA1 (SEQ ID No. 2) and Rv2185c-sgRNA2 (SEQ ID No. 3) sequences into the pYC1876 plasmid (the nucleotide sequence is shown in SEQ ID No. 4), and further obtained Rv2185c Gene knockout plasmid pYC1876-Rv2185c.

[0040] Further, a H37Rv strain containing the pYC1759 plasmid (nucleotide sequence as shown in SEQ ID No. 5) was prepared, namely H37Rv:pYC1759. Rv2185c The gene-directed knockout plasmid pYC1876-Rv2185c was transformed into the competent bacterial solution of H37Rv:pYC1759 to obtain Rv2185c Knockout Mycobacterium tuberculosis (Δ Rv2185c ).

[0041] For example, the present application converts the Rv2185cThe gene sequence was inserted into the BamH I and Cla I restriction sites of the pYC874_L5 plasmid (nucleotide sequence as shown in SEQ ID No. 6) to obtain the pYC874_L5-Rv2185c plasmid. Rv2185c Knockout Mycobacterium tuberculosis (Δ Rv2185c ) was transferred into the pYC874_L5-Rv2185c plasmid to obtain the complement Rv2185c Gene Δ Rv2185c strain (Δ Rv2185c :: Rv2185c strains).

[0042] The product corresponding to the application provided in the embodiment of the present application includes a substance that reduces the content of Rv2185c protein. Specifically, the active ingredient of the product provided in the embodiment of the present application includes a substance that reduces the content of Rv2185c protein. The product includes at least one of the following: 1) a product for treating or assisting in the treatment of tuberculosis; 2) a product for preventing or inhibiting infection with Mycobacterium tuberculosis.

[0043] Furthermore, the substance that reduces the content of Rv2185c protein includes a substance that inhibits the synthesis of Rv2185c protein, a substance that promotes the degradation of Rv2185c protein, a substance that knocks down Rv2185c Genetic material, knockout Rv2185c Further, knocking down Rv2185c Genetic substances include silencing Rv2185c At least one of miRNA, siRNA, dsRNA, and shRNA for a gene; Knockout Rv2185c The gene material includes at least one of the zinc finger protein ZFN gene editing system, the TALENs gene editing system, and the CRISPR / Cas9 gene editing system.

[0044] Specifically, the CRISPR / Cas9 gene editing system or the recombinant plasmid contains a targeting Rv2185c The sgRNA of the gene, the targeting nucleotide sequence of the sgRNA is shown as SEQ ID No.2 and SEQ ID No.3.

[0045] Specifically, the above-mentioned product may be a drug or an inhibitor.

[0046] In some embodiments, the Mycobacterium tuberculosis is specifically Mycobacterium tuberculosis H37Rv.

[0047] The following describes the invention in conjunction with specific embodiments.

[0048] Example 1 Mycobacterium tuberculosis Rv2185c Construction of gene knockout and complementation strains

[0049] according to Rv2185c Gene sequence and CRISPR-Cas system’s specificity in cutting the target sequence, and the design of PAM sequence recognized by Cas9-sgRNA complex Rv2185c Targeted cleavage sgRNA, this application designs Mycobacterium tuberculosis Rv2185c The sgRNA sequences for the knockout strains are as follows:

[0050] Rv2185c-sgRNA1 (SEQ ID No. 2)CGCAATGGATTTCGGAGTAT;

[0051] Rv2185c-sgRNA2 (SEQ ID No. 3)GACGGCGCGTTGAAGGATCT;

[0052] A directional knockout framework sequence containing the Rv2185c-sgRNA1 / Rv2185c-sgRNA2 sequence was synthesized. The framework sequence contained promoter, sgRNA scafold and terminator sequence information. A BamHI restriction site was added to both ends of the framework sequence, i.e., the 5' end, and an NheI restriction site was added to the 3' end.

[0053] The synthesized directional knockout framework sequence containing the Rv2185c-sgRNA1 / Rv2185c-sgRNA2 sequence was double-digested with BamHI and NheI, and then ligated into the pYC1876 vector containing Cas9 that was also double-digested with BamHI and NheI to form Rv2185c Gene-directed knockout plasmid: pYC1876-Rv2185c.

[0054] Preparation of competent H37Rv strain: First, the monoclonal H37Rv strain was inoculated into 5 mL of complete culture medium, wherein the complete culture medium was mixed with 7H9 (product of BD Company, USA, catalog number: 271310) and enrichment solution OADC (product of BD Company, USA, catalog number: 212351) in a volume ratio of 9:1; then cultured at 37°C 150rpm until saturation (about 15 days); then 3 mL of saturated bacterial solution was inoculated into 100 mL of the same complete culture medium, and cultured at 37°C 150rpm until OD = 0.6-0.8; then 10 mL of 2M glycine was added and cultured for 24 h; the cells were collected; the supernatant was discarded, and then washed 5 times with preheated glycerol water (glycerol volume percentage 10%); finally, the cells were resuspended with 2 mL of 10% glycerol, mixed thoroughly, and each 200 μL was dispensed and placed in a -80°C refrigerator for later use.

[0055] Take 2ul (100ng) of knockout auxiliary plasmid pYC1759 and add it to the competent H37Rv strain prepared above. The pYC1759 plasmid was transferred into the H37Rv background strain with the electric shock parameters of 2.5kV, 25μF and 1000Ω. The electroporated strain was added with 3mL complete medium (7H9 and enrichment solution OADC with a volume ratio of 9:1) for recovery culture for 3 days. The recovered cells were collected and spread on the above complete medium plate containing 25μg / mL to screen the H37Rv strain containing the pYC1759 plasmid: H37Rv:pYC1759.

[0056] The H37Rv:pYC1759 strain prepared above was made into H37Rv:pYC1759 competent state according to the above H37Rv strain competent state preparation method; Rv2185c The gene-directed knockout plasmid pYC1876-Rv2185c was transformed into the competent bacterial solution of H37Rv:pYC1759, specifically including taking 2 μL (200ng) of pYC1876-Rv2185c plasmid and adding it to 200 μL of the competent bacterial solution of H37Rv:pYC1759, and transforming pYC1876-Rv2185c into the H37Rv:pYC1759 strain with the electric shock parameters of 2.5 kV, 25 μF, and 1000 Ω. The electroporated strain was added with 3 mL of complete medium containing 25 μg / mL kanamycin (7H9 and enrichment solution OADC were composed of a volume ratio of 9:1) for recovery culture for three days; the recovered bacteria were collected and coated with 25 μg / mL kanamycin + 50 μg / mL bleomycin + 50 ng / mL ATC complete medium (7H9 and enrichment solution OADC in a volume ratio of 9:1) was placed on the plate. At the same time, a control group of pYC1876 empty plasmid was transformed to determine the transformation efficiency.

[0057] The single clones grown on the plate were used for preliminary verification of gene knockout by colony PCR, and the PCR products were analyzed by DNA electrophoresis and sequenced by Sanger sequencing for the PCR products of the successful knockout strains; Rv2185c Knockout strains ΔRv2185c The sequence of the primer pair Rv2185c-size-F / R for colony PCR identification is as follows:

[0058] Rv2185c-size-F (SEQ ID No. 7):

[0059] TGCACTGCAGGTGGCGGACAAGACGACAC;

[0060] Rv2185c-size-R (SEQ ID No. 8):

[0061] CCCAAGCTTTCAGCCCTCGACTCGTTTCTT.

[0062] Construction of complementing strain of Mycobacterium tuberculosis: The gene fragment to be complemented is connected to an expression vector to construct a recombinant plasmid, which is then transferred into the knockout strain for expression. Rv2185c The gene sequence (shown in SEQ ID No.1) was ligated into the BamH I and Cla I restriction sites of the pYC874_L5 plasmid (nucleotide sequence shown in SEQ ID No.6) to obtain the pYC874_L5-Rv2185c plasmid. Rv2185c Transfer into pYC874_L5-Rv2185c plasmid to obtain complement Rv2185c Gene Δ Rv2185c strain (Δ Rv2185c :: Rv2185c strain).

[0063] The results of PCR product DNA gel analysis are as follows Figure 1 As shown in B, in lanes 3 and 5 Rv2185c The gene was successfully knocked out, and the PCR product was consistent with the expected size, lane 4 △Rv2185c::Rv2185c The complement strain was constructed successfully. Rv2185c Knockout strains ΔRv2185c After expansion and cultivation, its genome was extracted for further whole genome sequencing analysis.

[0064] The Rv2185c knockout strain was expanded and transferred to 3 mL of 7H9+OADC non-resistant complete medium at a dilution of 1:100 and cultured for 5 more days. Then, the strain was graded diluted and plated on 7H10 plates containing 2% sucrose. After clones grew out, they were plated on Kanamycin plates, Zeocin plates, and non-resistant plates in turn to confirm whether the resistance was lost.

[0065] Example 2 Bacterial load counting experiment

[0066] After infecting macrophage THP-1 cells with the cultured Mycobacterium tuberculosis strain at an infection multiplicity of 5, the cells were cultured in a 37°C, 5% CO2 incubator for the corresponding time and then counted. Remove the cell culture supernatant and wash the cells twice with PBS preheated at 37°C for the following experiments: a. After washing, add 1 mL of 0.1% SDS solution to each well to lyse the cells, add 1 mL of the lysed cell solution to a centrifuge tube containing 9 mL of PBS, and then continue to dilute with PBS to 10 -3 times. Absorb 10 -2 , 10 -3For gradient dilution of lysate, add 50 μL to each four-grid plate, set two replicates for each gradient, and spread evenly with an L-shaped coating stick. After it is absorbed and dried, wrap it with tin foil and place it in an incubator at 37°C for three weeks for single colony counting; b. Flow cytometry, collect macrophages infected with different Mycobacterium tuberculosis strains, add 200 ul of PBS buffer and 200 ul of 4% paraformaldehyde for fixation overnight, and use flow cytometry to detect the proportion of macrophages infected with Mycobacterium tuberculosis.

[0067] The results are as follows Figure 2 As shown, gene knockout strains are shown in A △Rv2185c Compared with wild-type H37Rv and complemented strains △ Rv2185c::Rv2185c Compared with the control group, the number of cells phagocytosing bacteria increased. Flow cytometry in B was used to detect the phagocytic level of macrophages, which showed that macrophages △Rv2185c The phagocytic level of H37Rv was significantly higher than that of H37Rv and △Rv2185c::Rv2185c In C, flow cytometry was used to detect the phagocytic ratio of macrophages to different strains. The flow cytometry results showed that the macrophages △Rv2185c The phagocytic level of H37Rv was significantly higher than that of H37Rv and △Rv2185c::Rv2185c , these results show that Rv2185c The deletion of the gene can promote the phagocytosis of Mycobacterium tuberculosis by macrophages.

[0068] Example 3 Adhesion and invasion experiment

[0069] (1) THP-1 cells were resuspended in RPMI-1640 complete medium to a volume of 5 × 10 5 The density of cells / mL was adjusted, and the inducer phorbol myristate 5-acetate (PMA) was added to make the final concentration 40 ng / mL. 1 mL of the volume was added to each well of a 12-well cell culture plate, and the cells were cultured in a cell culture incubator for 24 h until they adhered to the wall. The RPMI-1640 complete medium was replaced once, and the culture was continued for 12 h before H37Rv and △ Rv2185c Infect cells at MOI = 10.

[0070] (2) In the cell adhesion experiment, the cells were treated at 30 min and 60 min after infection with Mycobacterium tuberculosis. The cell culture supernatant was first aspirated, and the cells were washed five times with PBS. 0.1% SDS was added to each well to lyse the cells. After dilution, the cells were spread on 7H10 four-grid solid culture medium for Mycobacterium tuberculosis colony counting experiment.

[0071] (3) In the cell invasion experiment, the cells were treated at 30 min, 60 min, 90 min, and 120 min after infection with Mycobacterium tuberculosis. The cell culture supernatant was first aspirated, and the cells were washed three times with PBS. 1 mL of RPMI-1640 complete medium containing 20 mg / mL gentamicin was added to each well, and the cells were cultured in a cell culture incubator for 1 h. After washing the cells three times with PBS, 0.1% SDS was added to each well to lyse the cells. After dilution, the cells were spread on a 7H10 four-grid solid culture medium for the Mycobacterium tuberculosis colony counting experiment.

[0072] The results are as follows Figure 3 As shown in A, the cell adhesion and invasion experiments confirmed the above results, while B showed that after Rv2185c antibody blocking, macrophages △Rv2185c There was no significant difference in the phagocytosis level between H37Rv and H37Rv.

[0073] Example 4 Colocalization Experiment

[0074] Gene synthesis of a plasmid expressing Rv2185-FLAG, specifically, synthesizing a eukaryotic cell expression plasmid with Rv2185 and Flag tags in the PcDNA3.1 backbone. Add DMEM complete medium to the HeLa cell suspension and resuspend the cells to a density of 1×10 5 / mL, added to the laser confocal culture dish, 1 mL per well. The cells were cultured in a 37℃, 5% CO2 incubator for at least 6 h to allow the cells to completely adhere to the wall. The Thermo Fisher Lipo3000 transfection kit was used for transfection. The experimental group was transfected with Rv2185c-Flag plasmid, and the control group was transfected with Flag empty plasmid, each transfection for 48 h. The cell culture supernatant was discarded, and PBS preheated at 37℃ was added and washed twice. 4% paraformaldehyde was fixed for 15 min. 0.1% Triton X-100 was punched for 10 min; PBS was washed twice, 2 min each time. 3% BSA in PBS was blocked at room temperature for 2 h. Incubation of primary antibody: Add anti-Flag antibody, diluted 1:300, incubate at 4℃ overnight; equilibrate at room temperature for 1 h, and wash 3 times with PBS, 2 min each time. Incubation of secondary antibody: Add fluorescent labeled secondary antibody, diluted 1:1000, incubate at room temperature, away from light for 1 h. Wash with PBS three times, 5 min each time.

[0075] Cell membrane staining: Add wheat germ agglutinin (WGA) dye, dilute it at a volume ratio of 1:1000, and incubate it in the dark for 10 minutes. Wash it with PBS 3 times, 5 minutes each time. Cell nucleus staining: Add 4',6-diamidino-2-phenylindole (DAPI) dye, dilute it at a volume ratio of 1:1000, and incubate it in the dark for 10 minutes. Add antiquencher to seal the slide, and use the ultra-high resolution laser confocal microscope ZEISS-LSM880 for co-localization photography and analysis.

[0076] The results are as follows Figure 4 As shown, the expression with Rv2185c The gene and control plasmids were transfected into cells, and the localization of Rv2185c protein was detected by laser confocal microscopy. The cell membrane and cell nucleus were marked with WGA and DAPI, respectively. The results showed that Rv2185c protein could not be detected in the control plasmid, but Rv2185c The gene could be detected in the cells and co-localized with WGA, suggesting that the Rv2185c protein was located in the cell membrane.

[0077] Example 5 Membrane lipid test strip experiment

[0078] The membrane lipid test paper comes from Echelon biosciences (P-6002). The P-6002 membrane lipid test paper is a 2cm×6cm hydrophobic membrane test paper strip that contains 15 important lipids with different biological functions commonly found in cell membranes, and the content of each lipid is 100 pmol. The test strip was incubated with the primary antibody Rv2185c (dilution ratio of 1:1000) at 4°C overnight. Then, it was washed three times with PBST, each time for 10 minutes, and then incubated with the secondary antibody (dilution ratio of 1:10000) at room temperature for 2 hours. Washed three times with PBST, each time for 10 minutes. Developed and exposed. The results are as follows Figure 5 As shown, the results of the membrane lipid test strip experiment proved that the Rv2185c protein interacted with the phospholipids PI4P, PIP2, and PIP3.

[0079] The above description is only a preferred embodiment of the present application and is not intended to limit the present application. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present application should be included in the protection scope of the present application.

Claims

1. At least one of the following uses of a substance for reducing the content of Rv2185c protein: 1) Application in the preparation of products for the treatment or auxiliary treatment of tuberculosis; 2) Use in the preparation of products for preventing or inhibiting Mycobacterium tuberculosis infection; The substance that reduces the content of Rv2185c protein includes knockout Rv2185c Gene material, the knockout Rv2185c Genetic material includes Rv2185c The CRISPR / Cas9 gene editing system of the sgRNA of the gene, the targeting nucleotide sequence of the sgRNA is shown in SEQ ID No.2 and SEQ ID No.

3.

2. The use according to claim 1, characterized in that: The nucleotide sequence of the gene encoding the Rv2185c protein is shown in SEQ ID No.1.

Images