Kluyveromyces marxianus INM3118 capable of reducing tryptophol as well as preparation method and application of Kluyveromyces marxianus INM3118 in whole wheat products

Abstract

The invention provides kluyveromyces marxianus INM3118 capable of reducing tryptophol, a preparation method of the kluyveromyces marxianus INM3118 and application of the kluyveromyces marxianus INM3118 to wholewheat products, the kluyveromyces marxianus INM3118 is preserved in Guangdong Microbial Culture Collection Center on August 13, 2024, the preservation number of the kluyveromyces marxianus INM3118 is GDMCC 65004, and the preservation address of the kluyveromyces marxianus INM3118 is No.59 building, No.100 Yard, Xianlie Middle Road, Guangzhou, Guangdong. The method has the advantages of effectively reducing the content of tryptophane after the whole wheat dough is fermented, improving the taste of the whole wheat product and reducing the bitter taste.

Description

Technical Field

[0001] The invention relates to Kluyveromyces marxianus INM3118 for reducing tryptophan, a preparation method thereof and application thereof in whole-wheat products. Background Art

[0002] Tryptophol is a chemical substance with a molecular formula of C10H11NO, a molecular weight of 161.2004, and a density of 1.219g / cm3. At present, the research on tryptophol is mainly focused on the chemical and pharmaceutical fields, mainly because tryptophol is an important chemical and pharmaceutical intermediate. However, in 2016, Qing and Peterson et al. showed that tryptophol is closely related to the bitterness of whole wheat products. Tryptophol is mainly a metabolite of tryptophan, and the production of tryptophan is closely related to the tryptophan fermentation process of brewer's yeast. In whole wheat fermented products, the application of brewer's yeast is indispensable. The tryptophan content in whole wheat flour is 192-398mg / 100g, so a large amount of tryptophol will be produced during the fermentation process, thus affecting the flavor of whole wheat products.

[0003] Kluyveromyces marxianus has the highest growth rate among eukaryotic microorganisms. It can grow at temperatures as high as 45-52°C. It has a wide range of metabolic substrates (including hexose sugars such as glucose, mannose, galactose, lactose, and pentose sugars such as xylose and arabinose). This makes it a good choice for fermenting lignocellulose to produce ethanol instead of brewer's yeast. Kluyveromyces marxianus has great benefits for human health. It can enhance the body's antibacterial, anti-disease, and antioxidant abilities, help prevent infection, delay aging, and protect the body's immune system. It can also lower cholesterol and blood sugar, improve immune function, relieve swelling and pain, improve endocrine and nutritional disorders, and reduce harmful substances in the body.

[0004] At present, there are few studies on the metabolism of tryptophan by Kluyveromyces marxianus. Patent: CN202010857 "A method for producing tryptophan by a cerevisiae strain" This invention discloses a method for producing tryptophan by a cerevisiae strain, using cerevisiae KMLY1-2 to ferment and produce tryptophan, and does not involve fermentation with Kluyveromyces marxianus to reduce tryptophan, so it is different from the application direction of this patent. It can be seen that the impact of tryptophan on whole wheat products is still in a blank stage in China. Therefore, the development of a safe and effective strain that reduces tryptophan to reduce the bitterness of whole wheat products has a very broad application prospect.

[0005] There are still some deficiencies in the practical application of tryptophan: (1) The microorganisms involved in the degradation of tryptophan are still unknown. (2) There is still a lack of a strain that can be directly used to degrade tryptophan in the production process of whole wheat products for industrial use. Summary of the invention

[0006] In view of the above problems, the present invention provides a Kluyveromyces marxianus INM3118 for reducing tryptophan, a preparation method thereof and an application in whole-wheat products. On the basis of not changing the existing process, the method for reducing tryptophan in whole-wheat products is prepared by fermenting whole-wheat flour seeds with Kluyveromyces marxianus, which not only reduces the content of tryptophan in the whole-wheat products, but also improves the taste of the whole-wheat products. The whole-wheat products produced by the preparation do not affect the overall process of the whole-wheat products after fermentation, which not only improves the taste of the whole-wheat products but also reduces the adverse factors brought by the whole-wheat products in the processing process.

[0007] The invention aims to achieve the following scheme: a strain of Kluyveromyces marxianus for reducing tryptophan,

[0008] The strain is Kluyveromyces marxianus INM3118, which was deposited in the Guangdong Provincial Microbiological Culture Collection Center on August 13, 2024, with the deposit number: GDMCC 65004, and the deposit address: 5th Floor, Building 59, No. 100, Xianlie Middle Road, Guangzhou City, Guangdong Province.

[0009] Furthermore, the colony characteristics of Kluyveromyces marxianus are as follows: after 48 hours of culture on solid malt extract plate medium, the size of a single Kluyveromyces marxianus colony is 1-2 mm, round in shape, with neat edges, opaque, milky white in color, raised in the middle, bright and smooth surface, and moist and easy to pick up.

[0010] A method for preparing Kluyveromyces marxianus for reducing tryptol is as follows:

[0011] (1) Isolation of Kluyveromyces marxianus: Isolate and screen Kluyveromyces marxianus from fermented milk curd samples. The milk curd product is made into a slurry and added into sterile water at a dilution concentration of 10 5 -10 6 , the dairy products of different dilution concentrations were evenly spread on the solid malt extract medium, and then placed in an incubator at 30°C for 48 hours. Then, white colonies on the solid malt extract medium were selected, and the Kluyveromyces marxianus with the correct morphology were screened;

[0012] (2) Screening of Kluyveromyces marxianus: The obtained Kluyveromyces marxianus was cultured to the logarithmic growth phase, and then inoculated with 1% of the strain, with a final concentration of 1×10 6 cfu / mL, inoculated into the screening culture medium solution, and placed in 30℃ for 3 days to obtain the fermentation liquid.

[0013] Furthermore, the formula of the screening medium is: the commercial malt extract medium is prepared according to the formula requirements, sterilized at 0.1 MPa and 121° C. for 15 min, and 0.1% tryptophan is added when used.

[0014] The application of a strain of Kluyveromyces marxianus that reduces tryptophan is based on the production process of whole wheat products. The inoculation amount is 10 4 -10 8 cfu / mL, the fermentation time was 12h and the fermentation temperature was 30℃.

[0015] Application of a strain of Kluyveromyces marxianus for reducing bitter substances in whole wheat.

[0016] Application of a strain of Kluyveromyces marxianus for reducing tryptophan.

[0017] Advantages of the present invention: (1) The screening method of the present invention is universal and can be widely used in screening strains for reducing the color alcohol content in whole wheat products.

[0018] (2) The Kluyveromyces marxianus provided by the present invention has the ability to reduce the bitter substances in whole wheat, and the whole wheat product after fermentation will not have any peculiar smell. It can be mixed with other grain flours in the later stage, that is, the nutrition and flavor of whole wheat are retained without any safety risks.

[0019] (3) It can effectively reduce the color alcohol content of whole wheat dough after fermentation, improve the taste of whole wheat products, and reduce bitterness. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is the result of screening different yeasts for degrading tryptophan.

[0021] Figure 2 This is a morphological observation diagram of the INM3118 strain on solid maltose plate culture medium.

[0022] Figure 3 This is a picture of the INM3118 strain observed under a microscope after Gram staining.

[0023] Figure 4 These are the results of the INM3118 strain cell culture stability test.

[0024] Figure 5 This is the result diagram of the color alcohol content of whole wheat bread in Example 3.

[0025] Figure 6 The inoculation concentration of Example 3 is 1.0×10 7 Results of colorant content in whole wheat bread after CFU / mL INN3118 strain.

[0026] Figure 7 It is an operation flow chart. DETAILED DESCRIPTION

[0027] The present invention will be further described below in conjunction with specific embodiments:

[0028] Unless otherwise specified, the experimental methods used in the following embodiments are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, can be obtained from commercial channels.

[0029] Example 1, see attached Figure 1-7 , a tryptol-reducing Kluyveromyces marxianus strain,

[0030] The strain is Kluyveromyces marxianus INM3118, which was deposited in the Guangdong Provincial Microbiological Culture Collection Center on August 13, 2024, with the deposit number: GDMCC 65004, and the deposit address: 5th Floor, Building 59, No. 100, Xianlie Middle Road, Guangzhou City, Guangdong Province.

[0031] A strain of Kluyveromyces marxianus that reduces color alcohols. The colony characteristics of Kluyveromyces marxianus are as follows: after culturing on solid malt extract plate medium for 48 hours, the size of a single colony of Kluyveromyces marxianus is 1-2 mm, round in shape, with neat edges, opaque, milky white in color, a raised center, a bright and smooth surface, and a moist texture that is easy to pick up.

[0032] A method for preparing Kluyveromyces marxianus with reduced tryptophan, 1. Processing of raw materials

[0033] Take the milk pimple sample from Ewenki Banner, Hulunbuir City, and dilute it to 10 with sterile saline. -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 Concentration, make bacterial dilution, take 0.1mL from each concentration dilution and evenly spread it on the malt juice solid culture medium plate, culture at 30℃ for 48h, select single colonies with white colonies, raised colonies, smooth surface and neat colony edges, streak the colonies on the malt juice solid culture medium for secondary purification, culture at 30℃ for 48h, pick single colonies for glycerol preservation, and name them NMY1001 to NMY1010 respectively. The screening process is as follows Figure 7 .

[0034] 2. Preliminary screening of bacterial strains

[0035] The 10 strains were inoculated into malt juice liquid medium at 1% inoculum and cultured at 30°C with a shaker at 220 rpm / min for 24 hours. Then, the 10 strains were inoculated into screening medium at 1% inoculum and cultured statically at 30°C for 24 hours until the final cell density reached 10 6 cfu / mL. Take samples from each tube and centrifuge at 10,000rpm / min for 10min. The supernatant is the sample. The results are as follows. Figure 1 shown.

[0036] The formula of the screening medium is: commercial malt extract medium is prepared according to the formula requirements, 0.1MPa, sterilized at 121℃ for 15min. 0.1% tryptophan is added when using.

[0037] Tryptophan detection method: Use high performance liquid chromatography equipment to detect tryptophan.

[0038] Liquid phase conditions: 10 μL sample was injected into CAPCELL PAK ADME (4.6×250 mm, 5 μ), mobile phase: 0.1% phosphoric acid in phase A, acetonitrile in phase B; flow rate: 1.0 ml / min; column temperature: 30°C; detector: DAD, wavelength 284 nm, detection time 0-25 min; mobile phase ratio was 20%-95% mobile phase B, and the standard was dissolved in methanol.

[0039] The three strains NMY1002, NMY1004 and NMY1008 with the highest trypanol degradation rates were selected for rescreening.

[0040] 3. Strain rescreening

[0041] The yeast strains NMY1002, NMY1004 and NMY1008 selected in the initial screening were reactivated and cultured, and the medium seed was prepared according to the national standard GB / T14612-2008 method, with a bacterial concentration of 10 6 cfu / mL, fermentation time 12h, fermentation temperature 30℃, made into whole wheat bread for sensory evaluation, the results are shown in Table 1

[0042] Table 1 Sensory analysis of fermented bread

[0043]

[0044]

[0045] Note: The maximum score for each indicator is 5 points, and the higher the score, the better the result.

[0046] From the results in Table 1, we can see that NMY1002 has the best sensory evaluation result. As the target strain for rescreening, the morphological observation of this strain on the solid maltose plate medium is as follows: Figure 2 As shown, the colony diameter is 4-5mm, the colony is milky white, the colony is convex and round, the surface is smooth, and the colony edge is neat. After Gram staining, it is observed under a microscope. The results are as follows Figure 3 shown.

[0047] The NMY1002 obtained by the above screening was subjected to ITS sequencing identification. After comparative analysis, the 28SrRNA region sequence obtained from the strain of the present invention was 99.82% similar to Kluyveromyces marxianus. It can be determined that the strain is a strain of Kluyveromyces marxianus, which can be used in the food fermentation industry. It is named Kluyveromyces marxianus INM3118. The strain was deposited in the Guangdong Provincial Microbiological Culture Collection Center on August 13, 2024, with the deposit number: GDMCC65004. Therefore, INM3118 and NMY1002 in this application refer to the same strain. The NMY1002 strain of the present invention was genetically identified, and its gene sequence is as follows:

[0048] ACGGCGGCATTTAACCATTACGCCAGCATCCTTGACAAAAGTCGCAATCCTCAGTCCCAGCT

[0049] GGCTGTATTCCCACGGGCTATAACACTCTACCGAAGCAGAGCCACATTCCCGAGGATTTATCC

[0050] AACCGCTAAAACTGATGCTGGCCCAGCGAAAGCCGAAGCAAACGCCATGTCTGATCAAATGCC

[0051] CTTCCTTTCAACAATTTCACGTACTTTTTCACTCTCTTTTCAAAGTTCTTTTCATCTTTCCA

[0052] TCACTGTACTTGTTCGCTATCGGTCTCTCGCCAATATTTAGCTTTAGATGGAATTTACCACCC

[0053] ACTTAGAGCTGCATTCCCAAACAACTCGACTCGTCGAAAGCACTTTACAAATAACTGGGATCC

[0054] TCGCCACACGGGATTCTCACCCTCTATGACGTCCTGTTCCAAGGAACATAGACAAGGACCAGC

[0055] TACAAAGTCGCCTTCTTCAAATTACAACTCGGACGTCGAAGACGCCAGATTTCAAATTTGAGC

[0056] TTTTGCCGCTTCACTCGCCGTTACTAAGGCAATCCCGGTTGGTTTCTTTTCCTC

[0057] Example 2 Genetic stability detection of Kluyveromyces marxianus INM3118

[0058] The Kluyveromyces marxianus INM3118 in Example 1 was propagated for 10 generations on the screening liquid medium. The first, fifth and tenth generation samples were centrifuged at 10,000 rpm / min for 10 min to obtain the supernatant, which was used as the sample. Physical and chemical indexes were tested. The method for testing the color alcohol content was referenced to Example 1. At the same time, sensory evaluation was performed to determine its stability in propagation. The specific data is shown in Figure 4 .

[0059] Figure 4 The results showed that the fermentation performance of Kluyveromyces marxianus INM3118 of different generations was normal, the tryptophan reduction rate content varied within 5%, the strain had good genetic stability and met the requirements for production and use.

[0060] Example 3 Preparation of whole-wheat bread using Kluyveromyces marxianus INM3118 whole-wheat flour

[0061] Kluyveromyces marxianus INM3118 was inoculated into whole wheat flour seeds to prepare whole wheat flour seeds according to the national standard GB / T14612-2008 method. The concentration of inoculation of Kluyveromyces marxianus INM3118 was 10 4 -10 8 CFU / mL, whole wheat bread was made respectively, and a control group without adding experimental Kluyveromyces marxianus was used as a control group.

[0062] Extraction of tryptophan: Take 5g of whole wheat bread and dissolve it in 10 times the weight of methanol, centrifuge at 8000rpm / min, 5℃ for 10min, filter through 0.45μm filter membrane, freeze-dry, and dissolve in 1 times the weight of methanol. The method for detecting tryptophan in bread is as shown in Example 1. Figure 5 shown.

[0063] Table 2 Sensory evaluation results of whole wheat bread

[0064]

[0065] Note: Each assessment has a maximum score of 10 points, with a scoring interval of 0.1. The comprehensive score is the sum of all items. The higher the score, the better the result.

[0066] Depend on Figure 5As shown in Table 2, Kluyveromyces marxianus INM3118 can significantly reduce the tryptophan content in whole wheat bread, and the more the inoculation amount, the lower the tryptophan content; however, too high an inoculation concentration of Kluyveromyces marxianus INM3118 affects the flavor of bread because the metabolism of Kluyveromyces marxianus affects the sourness, bitterness and taste of bread. The most suitable inoculation concentration is 1.0×10 7 CFU / mL, the concentration of this strain can effectively reduce the tryptophan content to 14.45±0.13mg / Kg. The test results are as follows Figure 6 ,, and can improve the flavor and taste of whole wheat bread.

[0067] Example 4 Preparation of whole-wheat toast with Kluyveromyces marxianus INM3118 flour

[0068] The final concentration of Kluyveromyces marxianus INM3118 was 10 7 CFU / mL of whole wheat flour was used to make whole wheat toast, and no experimental strain Kluyveromyces marxianus was added as a control group. The color alcohol content was extracted and detected according to the methods in Examples 1 and 3. At the same time, professional tasters were invited to conduct sensory evaluation on the flavor of whole wheat toast. The results are recorded in Table 3.

[0069] Table 3 Whole wheat toast testing and sensory evaluation results

[0070]

[0071] Note: Each sensory evaluation item has a full score of 10 points, with a scoring interval of 0.1, and the comprehensive score is the sum of the values ​​of each item.

[0072] From the results in Table 3, we can see that 10 7 CFU / mL Kluyveromyces marxianus INM3118 can significantly reduce the colorant content of whole wheat toast; in addition, it can also improve the sensory evaluation of whole wheat toast, increase the aroma of toast, improve the flavor and taste of whole wheat toast, and make the whole wheat toast fragrant, sweet and sour.

[0073] Example 5 Preparation of whole wheat European bread with Kluyveromyces marxianus INM3118

[0074] The final concentration of Kluyveromyces marxianus INM3118 was 10 7 CFU / mL of whole wheat flour seeds were prepared, and then whole wheat European bread was prepared according to the national standard GB / T14612-2008 method, and no experimental strain Kluyveromyces marxianus was added as the control group. After the fermentation was completed, the color alcohol content in the whole wheat European bread was extracted and detected according to the methods in Examples 1 and 3, and professional appraisers were invited to conduct sensory evaluation on the flavor of the whole wheat European bread. The results are recorded in Table 4.

[0075] Table 4 Testing and sensory evaluation results of whole wheat European bread

[0076]

[0077] Note: Each sensory evaluation item has a full score of 10 points, with a scoring interval of 0.1, and the comprehensive score is the sum of the values ​​of each item.

[0078] From the results in Table 4, we can see that the final concentration of 10 7 CFU / mL Kluyveromyces marxianus INM3118 can significantly reduce the content of colorant in whole-wheat European bread; in addition, it can also improve the sensory evaluation of whole-wheat European bread, increase the aroma of whole-wheat European bread, and improve the flavor and taste of whole-wheat European bread, making the whole-wheat European bread fragrant and sweet and sour.

[0079] Example 6 Preparation of whole-wheat meal bread with Kluyveromyces marxianus INM3118

[0080] The final concentration of Kluyveromyces marxianus INM3118 was 10 7 CFU / mL of whole wheat flour was used to make dough, and a control group without adding the experimental bacteria Kluyveromyces marxianus was used as a control group, and then meal packs were made according to the national standard GB / T14612-2008 method.

[0081] After fermentation, the colorant content in the whole-wheat bread was extracted and detected according to the methods in Examples 1 and 3. At the same time, professional appraisers were asked to conduct sensory evaluation on the flavor of the whole-wheat European bread. The results are recorded in Table 5.

[0082] Table 5 Testing and sensory evaluation results of whole wheat meal bread

[0083]

[0084] Note: Each sensory evaluation item has a full score of 10 points, with a scoring interval of 0.1, and the comprehensive score is the sum of the values ​​of each item.

[0085] From the results in Table 5, we can see that inoculation of 10 7 CFU / mL Kluyveromyces marxianus INM3118 can significantly reduce the content of colorant produced during the fermentation process; in addition, it can also improve the sensory evaluation of lunch buns, increase the aroma of lunch buns, and improve the flavor and taste of whole-wheat lunch buns, making the whole-wheat lunch buns fragrant and sweet and sour.

[0086] Based on the results of the above embodiments, the Kluyveromyces marxianus INM3118 provided by the present invention is applied to whole wheat fermentation. On the basis of not changing the existing process, the content of color alcohol in the relevant whole wheat products can be significantly reduced, and the aroma and taste of the whole wheat products can be improved, thereby significantly improving the quality of the whole wheat products.

[0087] The above-mentioned embodiments only express several implementation methods of the present invention, and the description is relatively specific and detailed, but it cannot be understood as limiting the scope of the invention patent. It should be pointed out that for ordinary technicians in this field, several modifications and improvements can be made without departing from the concept of the present invention. Therefore, the protection scope of the patent of the present invention shall be based on the attached claims.

Claims

1. A strain of Kluyveromyces marxianus for reducing tryptophan, characterized in that: The strain is Kluyveromyces marxianus INM3118, which was deposited in the Guangdong Provincial Microbiological Culture Collection Center on August 13, 2024, with the deposit number: GDMCC 65004, and the deposit address: 5th Floor, Building 59, No. 100, Xianlie Middle Road, Guangzhou City, Guangdong Province.

2. The tryptophan-reducing Kluyveromyces marxianus strain according to claim 1, characterized in that: The colony characteristics of Kluyveromyces marxianus are as follows: after 48 hours of culture on solid malt extract plate medium, the size of a single Kluyveromyces marxianus colony is 1-2 mm, round in shape, with neat edges, opaque, milky white in color, a raised center, a bright and smooth surface, and a moist texture that is easy to pick up.

3. A method for preparing Kluyveromyces marxianus with reduced tryptophan as claimed in claim 1, characterized in that: as follows: (1) Isolation of Kluyveromyces marxianus: Isolate and screen Kluyveromyces marxianus from fermented milk curd samples. The milk curd product is made into a slurry and added into sterile water at a dilution concentration of 10 5 -10 6 , the dairy products of different dilution concentrations were evenly spread on the solid malt extract medium, and then placed in an incubator for 48 hours at 30°C, and then white colonies on the solid malt extract medium were selected, and the Kluyveromyces marxianus with the correct morphology were screened; (2) Screening of Kluyveromyces marxianus: The obtained Kluyveromyces marxianus was cultured to the logarithmic growth phase, and then inoculated with 1% of the strain, with a final concentration of 1×10 6 cfu / mL, inoculated into the screening culture medium solution, and placed in 30℃ for 3 days to obtain the fermentation liquid.

4. The method for preparing Kluyveromyces marxianus with reduced tryptophan according to claim 3, characterized in that: The formula of the screening culture medium is as follows: the commercial malt extract culture medium is prepared according to the formula requirements, sterilized at 0.1 MPa and 121°C for 15 min, and 0.1% tryptophan is added when used.

5. The use of a strain of Kluyveromyces marxianus for reducing tryptophan as claimed in claim 1, characterized in that: According to the production process of whole wheat products, the inoculation amount in fermented whole wheat flour is 10 4 -10 8 cfu / mL, the fermentation time was 12h and the fermentation temperature was 30℃.

6. Use of the Kluyveromyces marxianus strain for reducing whole wheat bitter substances as claimed in claim 1.

7. Use of the Kluyveromyces marxianus strain for reducing tryptophan as claimed in claim 1.

Images