Saccharospora fibuligera and application thereof in rice wine

Abstract

The invention belongs to the technical field of microbial fermentation, and discloses saccharomycopsis fibuligera and application thereof in rice wine. The saccharomycopsis fibuligera strain disclosed by the invention is Saccharomycopsis fibuligera ZB440, and the preservation number of the saccharomycopsis fibuligera strain is GDMCC No: 64395. The saccharomycopsis fibuligera has the characteristics of high temperature resistance, acid resistance, high alcohol resistance, high saccharifying enzyme activity, high esterifying enzyme activity and high alcohol yield. The method can be applied to rice wine fermentation, and the flavor substances of esters, alcohols, aldehydes and ketones can be obviously improved.

Description

Technical Field

[0001] The invention relates to the technical field of microbial fermentation, and in particular to a spore-coated yeast and application thereof in rice wine. Background Art

[0002] Rice wine is a traditional drink in my country and is widely loved by consumers. Rice wine is a traditional drink made from glutinous rice, black rice, indica rice, etc., through a multi-step process of soaking, cooking, saccharification, microbial fermentation, etc. The alcohol content of rice wine can be as high as 20% voL. Rice wine is not only sweet and sour, but also contains a variety of healthy ingredients such as active biological peptides, amino acids, organic acids, vitamins, polyphenols, esters, etc. It has the functions of enhancing appetite, immunity, and effectively improving the secretion of digestive glands. It also has the effects of lowering blood pressure and blood lipids, relieving fatigue, and protecting the heart. Yeast in the rice wine brewing process has an important influence on the quality of rice wine.

[0003] The flavor characteristics of rice wine are mainly related to the raw materials, fermentation agent (rice koji), production process and microbial diversity. The fermentation process is the key to the flavor quality of rice wine, which mainly involves the joint action of koji microorganisms and environmental microorganisms. Glutinous rice is soaked, steamed and gelatinized, and then fermented under the action of molds, yeasts and other microorganisms, and a series of biochemical reactions such as saccharification, acidification, alcoholization and esterification occur, which degrades macromolecular substances such as starch, fat and protein in glutinous rice into small molecular flavor precursor substances such as monosaccharides, organic acids, amino acids and peptides, thereby giving rice wine rich nutrition and unique flavor characteristics. Therefore, microorganisms not only affect the quality of koji, but are also an important factor in promoting the formation of rice wine flavor quality.

[0004] There are many types of rice wine, and the types of yeast in rice wine vary. Therefore, studying the types and effects of yeast in rice wine is of great significance for regulating the winemaking process and improving the quality of rice wine. In the fermentation process of rice wine, the growth and metabolism of yeast mainly plays a key role in the winemaking stage and has the ability to produce aroma. Studies have shown that the primary metabolites necessary for yeast growth are ethanol, acetaldehyde and acetic acid, while secondary metabolism mainly produces higher alcohols, esters, thiols and rare terpenoid compounds. Deng Xiaoqian et al. analyzed the fungal flora diversity of 7 traditional Sichuan rice wines. The sequencing results showed that Saccharomycopsis, Saccharomyces cerevisiae and Wickham yeast were the dominant fungal genera in rice wine, and Saccharomyces cerevisiae was the main yeast that could be isolated through traditional microbial culture techniques. Saccharomyces cerevisiae is a winemaking yeast with a strong ethanol production ability. It produces ethanol through the glycolysis pathway and acetaldehyde pathway during the fermentation of rice wine. Higher alcohols are substances closely related to the flavor and safety of rice wine. The appropriate ratio of higher alcohols can give rice wine a harmonious and elegant aroma, but if the content of higher alcohols in rice wine is too high, it will lead to "easy drunkenness, headache" and other phenomena after drinking, which will damage the human nervous system. Esters usually have characteristics such as floral, fruity and milky aromas, and are one of the main aroma components of rice wine. Non-brewers' yeasts have weak alcohol production capacity, such as Saccharomyces cerevisiae, Candida, Wickerhamomyces anomalus and Pichia pastoris, but these yeasts have multiple enzyme activities, which are not only conducive to the saccharification and fermentation of rice wine, but also the main microorganisms for metabolic ester production during the fermentation process of rice wine, which can give rice wine a unique aroma. The volatile ester components in rice wine are mainly ethyl ester compounds, the precursors of which are ethanol and higher alcohols produced by yeast metabolism. For example, ethyl lactate, which exhibits fruity and creamy aroma characteristics, is formed by the combination of lactic acid produced by lactic acid bacteria metabolism and ethanol produced by yeast metabolism under the catalysis of acetyl coenzyme A. In the middle and late stages of rice wine fermentation, the organic acids and alcohols in the system can undergo esterification reactions under the action of yeast intracellular esterification enzymes to generate ester components with fruity aroma. In addition, the amino acids in rice wine mainly come from the enzymatic hydrolysis of proteins in the raw materials and the autolysis of yeast. During the fermentation process of rice wine, some amino acids are used by yeast to transform into higher alcohols, and the rest are used as part of rice wine to give it a variety of rich tastes such as umami, bitterness, sourness and saltiness.

[0005] At present, rice wine is made from rice, which is liquefied and saccharified, and then fermented with active dry yeast. The active dry yeast is brewer's yeast, which has strong ethanol production ability but weak ester production ability, and contributes little to the flavor of rice wine. Therefore, it is necessary to find a fragrance-producing yeast that can be used in rice wine and has strong ester production ability to enhance the aroma of rice wine. Summary of the invention

[0006] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a capsule-covered spore yeast and its application in rice wine.

[0007] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0008] In a first aspect, the present invention provides a Saccharomycopsis fibuligera yeast, wherein the Saccharomycopsis fibuligera yeast is Saccharomycopsis fibuligera ZB440, and its deposit number is GDMCC No: 64395.

[0009] The capsule-covered spore yeast strain ZB440 of the present invention is named Saccharomycopsis fibuligeraZB440, and its Latin name is classified as Saccharomycopsis fibuligera. It was deposited in Guangdong Provincial Microbiological Culture Collection Center on March 7, 2024, with a deposit number of GDMCC No: 64395, and the deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0010] The yeast strain ZB440 of the present invention is a strain obtained from sweet wine koji through the steps of culturing, separation, purification, screening, etc., to obtain Saccharomycopsis fibuligera, which has strong high temperature resistance, acid resistance and alcohol resistance, and has high saccharifying enzyme, esterifying enzyme activity and alcohol yield. The strain can be applied to rice wine fermentation, can increase the content of key flavor substances in rice wine, and enrich the aroma of rice wine.

[0011] In a second aspect, the present invention provides the bacterial body, fermentation supernatant and / or intracellular substances of the Saccharomyces cerevisiae.

[0012] In a third aspect, the present invention provides a rice wine flavoring agent, comprising the aforementioned Saccharomyces cerevisiae or the aforementioned bacterial body, fermentation supernatant and / or intracellular matter.

[0013] In a fourth aspect, the present invention applies the Saccharomyces cerevisiae to winemaking.

[0014] As a preferred embodiment of the application of the present invention, the winemaking is rice wine brewing, that is, fermenting to prepare rice wine.

[0015] The spore yeast of the present invention is used for brewing rice wine, and the alcohol content and amino acid nitrogen index of the rice wine are qualified, and at the same time, the content of key flavor substances in the rice wine can be increased, and the typical flavor substances of the rice wine can be enriched.

[0016] In a fifth aspect, the Saccharomyces cerevisiae described in the present invention is used to increase the content of flavor substances in rice wine.

[0017] As a preferred embodiment of the application of the present invention, the flavor substances include esters, alcohols, aldehydes, and ketones.

[0018] As a further preferred embodiment of the application of the present invention, the flavor substance includes at least one of ethyl acetate, isoamyl acetate, vinyl acetate, ethyl heptanoate, isovanillic aldehyde, 3-furfural, 1-octen-3-ol, 1-octanol, 1-hexadecanol, acetic acid, tetradecanoic acid, nonanal, and diacetyl.

[0019] In a sixth aspect, the present invention provides a rice wine obtained by fermenting the aforementioned Capsella vesiculospora yeast.

[0020] In a seventh aspect, the present invention provides a method for preparing rice wine, wherein the Saccharomyces cerevisiae is added to wine-making raw materials and fermented to obtain rice wine.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] The yeast strain ZB440 of the present invention is a strain obtained from sweet wine koji through the steps of cultivation, separation, purification, screening, etc., to obtain Saccharomycopsis fibuligera, which has the characteristics of high temperature resistance, acid resistance and alcohol resistance, high saccharifying enzyme and esterifying enzyme activities and high alcohol yield. The strain can be applied to rice wine fermentation, and has a significant effect on improving ester, alcohol, aldehyde and ketone flavor substances. Among them, ethyl acetate, isopentyl acetate, vinyl acetate, ethyl heptanoate, isovanillin, 3-furfural, 1-octen-3-ol, 1-octanol, 1-hexadecanol, acetic acid, tetradecanoic acid, nonanal, diacetyl and the like are considered to be typical aroma substances of rice wine by research, and the improvement rate is all above 100%. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 is the colony morphology of yeast strain ZB440;

[0024] Figure 2 This is a bacterial morphology diagram of yeast strain ZB440;

[0025] Figure 3 This is a phylogenetic tree analysis diagram;

[0026] Figure 4 is the growth curve of yeast strain ZB440;

[0027] Figure 5 This is a graph showing the acidity tolerance of yeast strain ZB440;

[0028] Figure 6 This is a temperature tolerance test chart of yeast strain ZB440;

[0029] Figure 7 This is a graph showing the ethanol tolerance test of yeast strain ZB440;

[0030] Figure 8 It is a flavor chromatogram of fermented rice wine; in the figure, A is the active dry yeast of yeast strain; B is the yeast strain ZB440. DETAILED DESCRIPTION

[0031] To better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. It should be understood by those skilled in the art that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0032] Unless otherwise specified, the experimental methods used in the examples are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, can be obtained from commercial channels.

[0033] The formula of the culture medium involved in the following examples is:

[0034] Malt extract medium: 130.0 g malt extract powder, 0.1 g chloramphenicol, 15.0 g agar, 1.0 L distilled water;

[0035] Bran medium: 100.0 g bran, 15.0 g distilled water.

[0036] Example 1: Isolation and screening of the yeast strain ZB440

[0037] (1) Cultivation

[0038] Weigh 10g of sweet koji wine samples from farmers in Hunan Province, add them into glass test tubes containing 90ml of sterile water, and dilute them in series at a ratio of 1:10 to obtain 1:10 2 , 1:10 3 , 1:10 4 , 1:10 5 , 1:10 6 The diluted bacterial suspension was then taken out, and 100 μL of the bacterial suspensions of different dilutions were added to the pre-prepared malt juice solid plate, spread evenly, and inverted in a 30°C constant temperature incubator to culture until colonies grew.

[0039] (2) Separation and purification

[0040] Yeast colonies of different morphologies were selected and the isolated strains were continuously purified by the plate streak method using malt extract medium.

[0041] (3) Screening

[0042] A film-forming yeast with obvious fruity aroma was obtained by smelling. The morphological characteristics were identified according to YEAST and the yeast was examined under a microscope to observe the bacterial morphology, yeast colony morphology and bacterial morphology. Figure 1 , Figure 2 As shown, the colonies were cultured in malt juice at 28°C for 48 hours. They were milky white in color, with a large diameter, a slight bulge in the middle, irregular edges, and slightly raised. The colonies were dry and wrinkled. The cell morphology was oval, with budding at one or more ends, and was recorded as strain ZB440.

[0043] (4) Strain identification and preservation

[0044] The genomic DNA of yeast strain ZB440 was extracted using Shanghai Sangon Ezup column yeast genomic DNA extraction kit according to the instructions and sent to Beijing Novogene Technology Co., Ltd. for sequencing. The 18S rDNA region fragment of the extracted genomic DNA of yeast strain ZB440 was sequenced, and the sequencing primer sequences were: ITS2 (5'-CGTAA-CAAGGTTTCCGTAGGTGAAC-3'); ITS5 (5'-GGAAGTAAAA GTCGTAACAAGG-3')

[0045] The resulting sequence is as follows:

[0046] GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAGAAA

[0047] TTTAATAATTTTGAAATGGATTTTTTTGTTTTGGCAAGAGCATGAGAGCTT

[0048] TTACTGGGCAAGAAGACAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTA

[0049] AGTGCGCGGTCTTGCTAGGCTTGTAAGTTTCTTTCTTGCTATTCCAAACGGT

[0050] GAGAGATTTCTGTGCTTTTGTTATAGGACAATTAAAACCGTTTCAATACAAC

[0051] ACACTGTGGAGTTTCATATCTTTGCAACTTTTTCTTTGGGCATTCGAGCAA

[0052] TCGGGGCCCAGAGGTAACAAACACAAACAATTTTATTTATTCATTAAATTTT

[0053] TGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATTAAAAACTT

[0054] TCAACAACGGATCTCTTGGTTCTCGCATCGATGATCGTAACAAGGTTTCCG

[0055] TAGGTGAACCTGCGGAAGGATCATTAATGTTATTTGTTTTTAGACCTGCGCT

[0056] TAACTGCGCGGTTTAATAAACTCTTATACACAGTGTTTTTGTTTGCGAATTT

[0057] GGTTTAGTTTGTTGGTTTTCATTCGAAAGGATGAAGATTGATTGCTAAATCT

[0058] TATTCAGCTTTTAAACTCAGATCTCTTTTTAAGAGAAATGTATTTTTTTAAT

[0059] TACAACTAGTCGATTTTACAAACTAAAAGTTTAAAACTTTCAGCAACGGAT

[0060] CTCTTGGTTCTCGCATCGATGAGAAA

[0061] The results of strain identification and sequencing were imported into the NCBI website (https: / / www.ncbi.nlm.nih.gov / ) for nucleic acid sequence Blast. Strains with a similarity of more than 97% were selected based on the comparison results, and their fasta format sequence files were downloaded. The downloaded sequence files were imported into Mega 11 software for sequence comparison, and a phylogenetic tree was constructed based on the comparison results. Figure 3 .

[0062] Combined with biological characteristics observation and sequencing analysis, the yeast strain ZB440 was identified as Saccharomycopsis fibuligera ZB440. Its Latin name was named Saccharomycopsis fibuligera. It was deposited in Guangdong Microbiological Culture Collection on March 7, 2024, with the deposit number GDMCC No: 64395. The deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0063] Example 2: Enzyme production characteristics of Saccharomyces cerevisiae ZB440

[0064] The activated Cyperus cingulate yeast strain ZB440 was inoculated into bran culture medium, 5 g of the fermented bran culture medium was diluted 50 times with sterile water, and the supernatant was used as the crude enzyme solution after centrifugation at 4000 rpm for 20 min. The amylase activity and saccharification enzyme activity of Cyperus cingulate yeast strain ZB440 were determined by the dinitrosalicylic acid method (DNS method), and the acid protease activity was determined by the Folin-phenol method.

[0065] The results are shown in Table 1:

[0066] Table 1 Enzyme production test results

[0067] index Amylase Glucoamylase Acid protease Esterase Enzyme activity U / g 362 4104 593 670

[0068] The test results showed that the yeast strain ZB440 could produce amylase, saccharifying enzyme and acid protease, among which the saccharifying enzyme had a higher activity, reaching 4104U / g.

[0069] Example 3: Growth curve of Saccharomyces cerevisiae ZB440

[0070] Pick an appropriate amount of ZB440 yeast strains of spore-coated spores and inoculate them into malt juice liquid medium, shake and culture them at 30℃ and 180rpm for 48h to obtain seed liquid, inoculate the seed liquid into a triangular flask of malt juice liquid medium at an inoculation ratio of 0.5%, and repeat three times. The blank control is used for the blank control, shake and culture at 30℃ and 180r / min, and observe whether the bacterial solution in the triangular flask is turbid and the turbidity every 2h, and measure the OD of the turbid bacterial solution at the same time. 600 .

[0071] The results of the test are as follows Figure 4 As shown in the figure, the OD 600 The value increased slowly, indicating that the strain was in the lag phase; during the 8h-18h culture period, OD 600 The value increases exponentially, indicating that the strain is in the logarithmic growth phase; after 18h-36h of culture, the OD600 value tends to be stable, indicating that the strain enters the stable phase, and then the yeast gradually enters the decay phase, and the growth curve is consistent with the general yeast growth law.

[0072] Example 4: pH tolerance of Saccharomyces cerevisiae ZB440

[0073] Pick an appropriate amount of ZB440 yeast strains of spore-coated malt juice liquid culture medium, shake and culture at 30°C and 180rpm for 48h to obtain seed liquid, and inoculate the seed liquid into a triangular flask filled with sterilized malt juice liquid culture medium of different pH values ​​(2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5) at an inoculation ratio of 0.5%, and repeat three times for each pH value. The blank control is not inoculated, and shake and culture at 30°C and 180r / min for 48h. Observe whether the bacterial solution in the triangular flask is turbid and the turbidity at each pH, ​​and measure the OD of the turbid bacterial solution at the same time. 600 .

[0074] The results of the test are as follows Figure 5 As shown in the figure, it shows that the strain grows well at pH 3.5-5.5 and can tolerate a culture medium with a minimum pH of 3.5.

[0075] Example 5: Temperature tolerance of Saccharomyces cerevisiae ZB440

[0076] Pick an appropriate amount of ZB440 yeast strains of spore-coated spores and inoculate them into malt juice liquid culture medium, shake and culture them at 30°C and 180rpm for 48h to obtain seed liquid, and place the seed liquid in a triangular flask of malt juice liquid culture medium at an inoculation ratio of 0.5%, and shake and culture them at 180r / min for 48h at five temperatures of 28°C, 30°C, 34°C, 37°C, and 40°C. Repeat three times at each temperature, and the blank control without inoculation is used to observe whether the bacterial solution in the triangular flask is turbid and the turbidity at each temperature, and at the same time measure the OD of the turbid bacterial solution 600 .

[0077] The results of the test are as follows Figure 6 As shown in the figure, it shows that when the temperature gradually increases, the activity of the strain shows an upward trend. As the temperature continues to rise, the growth of the strain is significantly inhibited. When the temperature does not exceed 37°C, the strain still has good survival vitality and can tolerate up to 37°C.

[0078] Example 6: Ethanol tolerance of Saccharomyces cerevisiae ZB440

[0079] Pick an appropriate amount of ZB440 yeast strains of spore-coated spores and inoculate them into malt liquid medium, shake and culture them at 30°C and 180rpm for 48h to obtain seed solution, and inoculate the seed solution at a ratio of 0.5% in a triangular flask of malt liquid medium with different ethanol contents (3%, 6%, 9%, 12%, 15%, and 18%), and shake and culture them at 30°C and 180r / min for 48h. Three replicates are made for each ethanol content, and the blank control is the one without inoculation. Observe whether the bacterial solution in the triangular flask is turbid and the turbidity at each ethanol content, and measure the OD of the turbid bacterial solution at the same time. 600 .

[0080] The results of the test are as follows Figure 7 As shown in the figure, it is shown that when the volume fraction of ethanol added to the culture medium is less than 6%, the yeast strain has better growth activity. When the ethanol addition amount is higher than 6%, the growth of yeast is inhibited, and the highest ethanol tolerance is 6%.

[0081] Example 7: Application of Saccharomyces cerevisiae ZB440 in rice wine

[0082] The control group was Angel active dry yeast and the experimental group was Saccharomyces cerevisiae ZB440.

[0083] (1) Liquefaction

[0084] Weigh glutinous rice and water according to the material-liquid ratio of 1:1-3.5, put them into the saccharification pot, add 0.5‰-2‰ liquefaction enzyme for rice, raise the temperature to 90℃-98℃, keep warm for 60min-90min, stir well during the whole process to avoid sticking the pot;

[0085] (2) Saccharification

[0086] Cool down the water to 60-70℃, add 0.5‰-2‰ saccharifying enzyme for rice, keep warm for 1h-2h, stir well during the whole process to avoid sticking the pot;

[0087] (3) Cooling and feeding

[0088] The saccharified mash was cooled to 28°C-35°C, the water evaporated from liquefaction and saccharification was replenished by weight, and then 0.5%-2% yeast activation solution was added to the control group and the experimental group.

[0089] (4) Fermentation

[0090] Pre-ferment at 28℃-32℃ for 2d-5d, then transfer to post-fermentation at 10℃-18℃ for 1d-4d;

[0091] (5) Pressing

[0092] The clear wine was collected by filtering using perlite as a filter aid;

[0093] (6) Decoction

[0094] Keep the wine at 70-90℃ for 10-40 minutes for sterilization. Store the sterilized wine at room temperature and measure the physical and chemical indicators and volatile flavor substances.

[0095] The physical and chemical indicators and sensory evaluation were determined according to GB / T 13662-2018 Yellow Wine.

[0096] The test results are shown in Table 2:

[0097] Table 2 Test results of physical and chemical indicators

[0098] strain Alcohol content %vol Total acid g / L Amino acid nitrogen g / L pH Active Dry Yeast 16.66 3.87 0.32 4.45 Yeast ZB440 15.11 5.48 0.56 4.40

[0099] The results showed that compared with the rice wine obtained by active dry yeast, the alcohol content of the rice wine fermented with Saccharomyces cerevisiae ZB440 was slightly lower, but the levels of total acid and amino acid nitrogen were higher, and the pH was similar.

[0100] The detection method of volatile flavor substances is:

[0101] Extraction conditions: take 5 mL of sample into a 20 mL headspace bottle, add 2-octanol (1.00 mg / L), incubate at 40°C and 300 r / min for 10 min, extract with a DVB / CAR / PDMS three-phase extraction head for 30 min, and inject at 250°C for 10 min by thermal desorption. Use gas chromatography-mass spectrometry (GC-MS) to determine the volatile flavor substances in rice wine.

[0102] GC conditions: HP-INNOWAX capillary column (60m×0.25mm×0.25μm); injection port temperature 250°C; carrier gas is high-purity helium (He), constant flow mode, column flow rate 1.2mL / min; heating program is initial temperature 40°C, hold for 5min, increase to 250°C at 5°C / min, and hold for 10min.

[0103] MS conditions: mass spectrometer interface temperature 250°C; electron ionization (EI), ion source temperature 250°C, ionization energy 70 eV; detector voltage 1 400 V; mass scanning range 29-5 500 amu.

[0104] Qualitative and quantitative analysis: Qualitative analysis was performed by combining the matching results with the 2024 mass spectral library of the National Institute of Standards and Technology (NIST) and the retention index value, and semi-quantitative analysis was performed by using the internal standard method. The test results are shown in Table 3 and Figure 8 shown.

[0105] Table 3 Detection results of volatile flavor substances (unit: mg / L)

[0106]

[0107] The test results show that in terms of flavor substances, the rice wine fermented by Saccharomyces cerevisiae ZB440 has a significant improvement in ester, alcohol, aldehyde and ketone flavor substances compared with the rice wine fermented by active dry yeast. Among them, ethyl acetate, isoamyl acetate, vinyl acetate, ethyl heptanoate, isovanillic acid, and 3-furfural are considered to be typical aroma substances of rice wine. Ethyl acetate, isoamyl acetate, and vinyl acetate are the main aroma components of rice wine, showing the aroma of banana or apple fruits, giving people a mellow and slightly sweet feeling; ethyl heptanoate has the aroma of jackfruit; isovanillic acid has an olive-like aroma and a strong milky aroma; 3-furfural can react with other flavor substances in the wine to form new aromatic compounds, thereby enriching the aroma of the wine and making the taste softer and mellower. In addition, 1-octen-3-ol, 1-octanol, and 1-hexadecanol have pleasant mellow aromas and can blend the mellow taste of rice wine. Acetic acid and tetradecanoic acid are important flavoring substances in rice wine, which together with other flavor substances form a unique aroma and remove the bitterness and miscellaneous taste of the wine. Nonanal has a rose and citrus-like aroma, and diacetyl has a strong creamy, fermented, creamy, and sweet aroma.

[0108] It can be seen that the Saccharomyces cerevisiae ZB440 has a significant promoting effect on the content of key flavor substances in rice wine during rice wine fermentation.

[0109] Table 4 Sensory evaluation results

[0110]

[0111] The sensory evaluation results showed that the flavor and aroma of rice wine made with yeast ZB440 were better than those of the control group.

[0112] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

Claims

1. A cyst-coated spore yeast, characterized in that: The yeast of the present invention is Saccharomycopsis fibuligera ZB440, and its deposit number is GDMCC No:64395.

2. The bacterial body, fermentation supernatant and / or intracellular matter of the Mycosporangiophora vesicerariae according to claim 1.

3. A rice wine flavoring agent, characterized in that: The method comprises the yeast of claim 1 or the bacterial body, fermentation supernatant and / or intracellular matter of claim 2.

4. Use of the yeast of claim 1 in brewing.

5. The use according to claim 4, characterized in that: The brewing of wine is rice wine brewing.

6. Use of the yeast of claim 1 in increasing the content of flavor substances in rice wine.

7. The use according to claim 6, characterized in that: The flavor substances include esters, alcohols, aldehydes and ketones.

8. The use according to claim 7, characterized in that: The flavor substances include at least one of ethyl acetate, isoamyl acetate, vinyl acetate, ethyl heptanoate, isovanillic aldehyde, 3-furfural, 1-octen-3-ol, 1-octanol, 1-hexadecanol, acetic acid, tetradecanoic acid, nonanal, and diacetyl.

9. A rice wine, characterized in that: The method is obtained by fermenting the spore-coated yeast of claim 1.

10. A method for preparing rice wine, characterized in that: The spore-coated yeast according to claim 1 is added into brewing raw materials and fermented to obtain rice wine.

Images