Liposome transfection method of chicken primordial gonad cells

Abstract

The invention discloses a liposome transfection method of chicken primordial gonad cells, and belongs to the field of cell transfection. The method comprises the following steps: rinsing chicken primordial gonad cells by using an OPTI-MEM culture solution, and then culturing the chicken primordial gonad cells; mixing and incubating the plasmid and the liposome transfection reagent to prepare a transfection mixture; wherein the plasmids comprise a donor plasmid and a PPARG (peroxisome proliferator activated receptor G) targeting plasmid; and mixing and incubating the transfection mixture and the primordial gonad cells. The gene editing positive cells are successfully obtained by optimizing the transfection process, and a large number of gene editing positive cells are obtained after amplification culture and flow sorting and can be used for preparing the gene editing chicken, so that the preparation time of the gene editing chicken is saved, and the preparation success rate of the gene editing chicken is increased.

Description

Technical Field

[0001] The invention relates to the field of cell transfection, in particular to a liposome transfection method for chicken primitive gonad cells. Background Art

[0002] There are many chicken breeds in my country. Although they retain extensive genetic diversity, they generally face problems that affect economic benefits, such as slow growth, low feed conversion rate, and excessive abdominal fat deposition, in the process of breed development and utilization. Gene editing breeding is considered to be a key frontier technology to solve this problem, accelerate breeding progress, and develop high-performance breeds. At present, gene editing technologies mostly use clustered regularly interspaced short palindromic repeats (CRISPR) and Cas9 protein editing technologies. The characteristics of these technologies are that they require exogenous introduction of guide RNA and Cas9 and its variant enzymes, and most of them use transfection plasmids. In chicken breeds, gene editing technology mediated by primordial gonad cells (PGCs) is the most widely used. In the process of using PGCs as vectors to prepare gene-edited chickens, it is necessary to go through the steps of PGCs isolation and expansion, PGCs editing, and PGCs transplantation. PGCs editing is the key link in determining whether gene editing is successful. PGCs are embryonic stem cells with strong self-protection and face transfection difficulties. At present, most teams use electrotransfection in the process of editing PGCs, but electrotransfection has the disadvantages of high equipment cost, high use cost, and large cell demand. Liposome transfection has the advantages of quick operation, strong safety and low cost. If it can be applied to PGCs gene editing, it will greatly reduce the editing difficulty and cost of PGCs.

[0003] In view of this, the present invention provides a liposome transfection method for chicken PGCs. By optimizing the transfection process, gene-edited positive cells are successfully obtained, and a large number of gene-edited positive cells are obtained after expanded culture and flow sorting for the preparation of gene-edited chickens. Summary of the invention

[0004] The purpose of the present invention is to provide a liposome transfection method for chicken primordial gonad cells to solve the problems existing in the above-mentioned prior art, and to improve the transfection efficiency of PGCs by optimizing the liposome transfection process, thereby saving the preparation time of gene-edited chickens and increasing the preparation success rate of gene-edited chickens.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides a liposome transfection method for chicken primordial gonad cells, comprising the following steps:

[0007] The chicken primordial gonad cells were cultured after being rinsed with OPTI-MEM culture medium;

[0008] The plasmid and the liposome transfection reagent are mixed and incubated to prepare a transfection mixture; wherein the plasmid includes a donor plasmid and a PPARG targeting plasmid;

[0009] The transfection mixture and the primordial gonad cells are mixed and incubated.

[0010] Preferably, the rinsing step comprises: collecting chicken primordial gonad cells, centrifuging, collecting the precipitate, resuspending and rinsing with OPTI-MEM culture medium, centrifuging again, and repeating the resuspending and rinsing.

[0011] Preferably, the chicken primordial gonad cells are rinsed and inoculated at a density of 2×10 5 ~3×10 5 Cells / mL were inoculated into culture plates for culture.

[0012] Preferably, the mass ratio of the donor plasmid to the PPARG targeting plasmid is 1:1.

[0013] Preferably, the method for constructing the donor plasmid comprises the steps of using pMD18-T as a starting plasmid and constructing the mCherry fluorescent protein expression cassette as shown in SEQ ID NO: 5 onto the starting plasmid by homologous recombination.

[0014] Preferably, the method for constructing the PPARG targeting plasmid comprises the steps of integrating the DNA fragment corresponding to any one of the sgRNAs shown in SEQ ID NOs: 1-4 into the BbSI site of PX459, respectively.

[0015] Preferably, after the plasmid and the liposome transfection reagent are diluted and mixed with OPTI-MEM culture medium, the two dilutions are combined, mixed and incubated to obtain the transfection mixture; wherein the mass volume ratio of the plasmid and the OPTI-MEM culture medium is 2 μg:50 μL, and the volume ratio of the liposome transfection reagent to the OPTI-MEM culture medium is 3:50.

[0016] Preferably, the liposome transfection reagent includes Lipofectamine Stem Reagent, and the mixed incubation time is 10 to 15 minutes.

[0017] Preferably, the transfection mixture and the primordial gonadal cells are mixed and incubated for 6 hours, and the volume ratio of the transfection mixture to the primordial gonadal cells is 100 μL:1 mL.

[0018] The invention also provides application of the method in improving the transfection efficiency of chicken primordial gonad cells.

[0019] The present invention discloses the following technical effects:

[0020] The liposome-mediated chicken PGCs transfection method provided by the present invention is convenient to operate and has low equipment requirements compared to transfection methods such as electrofection, lentivirus and adenovirus, and is a more economical transfection method. The present invention tests the transfection efficiency of PGCs cultured in MEF feeder layers by four transfection reagents under the recommended operation method in the transfection reagent manual (transfection process one) and the optimized operation method of the present invention (transfection process two). It is found that during the transfection process, by temporarily removing the PGCs culture medium and using OPTI-MEM as the transfection incubation condition, the transfection efficiency can be significantly improved (transfection process two), up to 20.8 times. Under the optimized operation method of the present invention, Lipofectamine 2000, Lipofectamine 3000, Lipofectamine Stem Reagent and Attractene Transfection Reagent all show a transfection efficiency of more than 0.5%, which can meet the needs of obtaining positive cells by flow sorting. Lipofectamine Stem Reagent shows the best transfection efficiency, which is 2.65%. The present invention provides an efficient chicken PGCs transfection method, which can significantly improve the transfection efficiency of PGCs, thereby helping to save the preparation time of gene-edited chickens and increase the preparation success rate of gene-edited chickens. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0022] Figure 1 The donor plasmid for the completed construction;

[0023] Figure 2 A donor plasmid for adding homologous sequences;

[0024] Figure 3 Schematic diagram of CRISPR / Cas9-mediated insertion of mCherry expression cassette into the genome;

[0025] Figure 4 Schematic diagram of two transfection processes;

[0026] Figure 5 Editing efficiency of four sgRNAs; A: fluorescence image and electrophoresis image; B: sequencing results;

[0027] Figure 6This is a schematic diagram of the transfection results of Lipofectamine Stem Reagent;

[0028] Figure 7 This is a flow cytometry statistical diagram of transfection results of four transfection reagents in transfection process 2;

[0029] Figure 8 Statistics of transfection results of two transfection processes with different transfection reagents;

[0030] Fig. 9 This is a fluorescence image of PGCs stably expressing mCherry after flow cytometry screening. DETAILED DESCRIPTION

[0031] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0032] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0033] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0034] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0035] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0036] Example 1

[0037] 1. Preparation of PGCs Feeder Layer

[0038] Take out the frozen primary mouse embryonic fibroblasts (MEF) from liquid nitrogen, thaw in a 37°C water bath, centrifuge to remove the freezing solution, and then inoculate into a 6-well plate. Use DMEM / F12 medium containing 10% fetal bovine serum, 5% CO2, and 37°C to culture until the confluence is above 95%. Treat with 10μg / mL mitomycin C for 2h, and replace with normal growth medium for use.

[0039] 2. Get PGCs

[0040] Fertilized White Leghorn eggs were incubated at a constant temperature and humidity until embryonic day 6.5-7 (Hamburger Hamilton Stages 30, HH30), and the gonads were removed and digested with 0.025% trypsin to obtain PGCs, which were then inoculated onto a MEF feeder layer for propagation.

[0041] 3. Design of sgRNA targeting PPARG gene

[0042] The online tool CHOPCHOP (https: / / chopchop.cbu.uib.no / ) was used to design PPARG sgRNA based on the Gallus gallus (galGal6) genome. The four sgRNAs with the highest scores (as shown in Table 1) were selected and handed over to GenScript to synthesize the corresponding DNA fragments and integrate them into the BbSI site of PX459 respectively.

[0043] Table 1 sgRNA information

[0044]

[0045] 4. Construction of expression vector plasmid PPARG-mCherry donor plasmid

[0046] pMD18-T was used as the starting plasmid (see Figure 1 ), the mCherry fluorescent protein expression cassette sequence consisting of HS4N-CMV enhancer-CAG promoter-mCherry-HS4N was artificially synthesized (Nanjing GenScript, SEQ ID NO: 5) and then inserted into the KpnI and NotI restriction endonuclease sites of the vector by homologous recombination (see Table 2), thereby obtaining the donor plasmid (see Figure 2). After obtaining the donor plasmid, refer to the PPARG (ENSGALG00010027917) sequence in the ENSEMBL database to obtain the 800bp upstream and downstream sequences of sgRNA3 as the homologous sequences inserted into the donor plasmid, and add the targeting sequence of sgRNA3 on both sides of the homologous sequence to form a sandwich structure of sgRNA3 target-homologous arm-mCherry expression cassette-homologous arm-sgRNA3 target. The homologous sequence was synthesized by GenScript and inserted into the KpnI and NotI sites of the blank donor plasmid using the homologous recombination method (see Table 2) to form the following. Figure 1 The complete donor plasmid is shown in B. After co-transfection of the donor plasmid and the PPARG targeting plasmid, the mCherry expression cassette can be inserted into the genome, forming a stable mCherry fluorescence expression (see Figure 3 ).

[0047] Table 2 Homologous recombination reaction system and conditions

[0048]

[0049]

[0050] Sequence of expression cassette (SEQ ID NO: 5):

[0051] GAGCTCACGGGGACAGCCCCCCCCCAAAGCCCCCAGGGATGTAATTACGTCCCTCCCCCGCTAGGGG

[0052] GCAGCAGCGAGCCGCCCGGGGCTCCGCTCCGGTCCGGCGCTCCCCCCGCATCCCCGAGCCGGCAGC

[0053] GTGCGGGGACAGCCCGGGCACGGGGAAGGTGGCACGGGATCGCTTTCCTCTGAACGCTTCTCGCTGC

[0054] TCTTTGAGCCTGCAGACACCTGGGGGGATACGGGGAAAAAGCTTTAGGCTGCTGAGCCTGCATGTTT

[0055] GATGGTGTCTGGATGCAAGCAGAAGGGGTGGAAGAGCTTGCCTGGAGAGATACAGCTGGGTCAGTA

[0056] GGACTGGGACAGGCAGCTGGAGAATTGCCATGTAGATGTTCATACAATCGTCAAATCATGAAGGCTGG

[0057] AAAAGCCCTCCAAGATCCCCAAGACCAACCCCAACCCACCCACCGTGCCCACTGGCCATGTCCCTCA

[0058] GTGCCACATCCCCACAGTTCTTCATCACCTCCAGGGACGGTGACCCCCCCACCTCCGTGGGCAGCTGT

[0059] GCCACTGCAGCACCGCTCTTTGGAGAAGGTAAATCTTGCTAAATCCAGCCCGACCCTCCCCTGGCAC

[0060] AACGTAAGGCCATTATCTCTCATCCAACTCCAGGACGGAGTCAGTGAGAATATTTTAACCCTAGAAAG

[0061] ATAGTCTGCGTAAAATTGACGCATGCATTCTTGAAATATTGCTCTCTCTTTCTAAATAGCGCGAATCCGT

[0062] CGCTGTGCATTTAGGACATCTCAGTCGCCGCTTGGAGCTCCCGTGAGGCGTGCTTGTCAATGCGGTAA

[0063] GTGTCACTGATTTTGAACTATAACGACCGCGTGAGTCAAAATGACGCATGATTATCTTTTACGTGACTT

[0064] TTAAGATTTAACTCATACGATAATTATATTGTTATTTCATGTTCTACTTACGTGATAACTTATTATATATATA

[0065] TTTTCTTGTTATAGATATCATTAATATcgatGGCGCGCCGGATTCGACATTGATTATTGACTAGTTATTAATA

[0066] GTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAAT

[0067] GGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGT

[0068] AACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAG

[0069] TACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGC

[0070] ATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATT

[0071] ACCATGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAAT

[0072] TTTGTATTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGGGGGGCGCGCGCC

[0073] AGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAGAGGTGCGGCGGCAGCCAATC

[0074] AGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCG

[0075] AAGCGCGCGGCGGGCGGGAGTCGCTGCGTTGCCTTCGCCCCGTGCCCCGCTCCGCGCCGCCTCGCGC

[0076] CGCCCGCCCCGGCTCTGACTGACCGCGTTACTCCCACAGGTGAGCGGGCGGGACGGCCCTTCTCCTC

[0077] CGGGCTGTAATTAGCGCTTGGTTTAATGACGGCTCGTTTCTTTTCTGTGGCTGCGTGAAAGCCTTAAA

[0078] GGGCTCCGGGAGGGCCCTTTGTGCGGGGGGGAGCGGCTCGGGGGGTGCGTGCGTGTGTGTGTGCGT

[0079] GGGGAGCGCCGCGTGCGGCCCGCGCTGCCCGGCGGCTGTGAGCGCTGCGGGCGCGGCGCGGGGCTT

[0080] TGTGCGCTCCGCGTGTGCGCGAGGGGAGCGCGGCCGGGGGCGGTGCCCCGCGGTGCGGGGGGGCTG

[0081] CGAGGGGAACAAAGGCTGCGTGCGGGGTGTGTGCGTGGGGGGGTGAGCAGGGGGTGTGGGCGCGG

[0082] CGGTCGGGCTGTAACCCCCCCCTGCACCCCCCTCCCCGAGTTGCTGAGCACGGCCCGGCTTCGGGTG

[0083] CGGGGCTCCGTGCGGGGCGTGGCGCGGGGCTCGCCGTGCCGGGCGGGGGGTGGCGGCAGGTGGGG

[0084] GTGCCGGGCGGGGCGGGGCCGCCTCGGGCCGGGGAGGGCTCGGGGGAGGGGCGCGGCGGCCCCGG

[0085] AGCGCCGGCGGCTGTCGAGGCGCGGCGAGCCGCAGCCATTGCCTTTTATGGTAATCGTGCGAGAGGG

[0086] CGCAGGGACTTCCTTTGTCCCAAATCTGGCGGAGCCGAAATCTGGGAGGCGCCGCCGCACCCCCTCT

[0087] AGCGGGCGCGGGCGAAGCGGTGCGGCGCCGGCAGGAAGGAAATGGGCGGGGAGGGCCTTCGTGCG

[0088] TCGCCGCGCCGCCGTCCCCTTCTCCATCTCCAGCCTCGGGGCTGCCGCAGGGGGACGGCTGCCTTCG

[0089] GGGGGGACGGGGCAGGGCGGGGTTCGGCTTCTGGCGTGTGACCGGCGGCTCTAGAGCCTCTGCTAA

[0090] CCATGTTCATGCCTTCTTCTTTTTCCTACAGATCCTTAATTAAGCGACGCGTGCGGGATCCGCTCAATTG

[0091] GCTGCTAGCgctGTCGACgccactaacttctccctgttgaaacaagcaggggatgtcgaagagaatcccgggccaatggtgagcaagggcgaggag

[0092] gataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgccc

[0093] ctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctac

[0094] gtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtga

[0095] cccaggactcctccctgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggct

[0096] gggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgagg

[0097] tcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtgg

[0098] aacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtaaACCGGTTAGgggcccgtttaaacccgctgatcagcct

[0099] cgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgc

[0100] atcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcaggcatgctggggatgcggtg

[0101] ggctctatggcggcgcgccTAAAAGTTTTGTTACTTTATAGAAGAAATTTTGAGTTTTTGTTTTTTTTTAATAAATA

[0102] AATAAACATAAATAAATTGTTTGTTGAATTTATTATTAGTATGTAAGTGTAAATATAATAAAACTTAATAT

[0103] CTATTCAAATTAATAAATAAACCTCGATATACAGACCGATAAAACACATGCGTCAATTTTACGCATGATT

[0104] ATCTTTAACGTACGTCACAATATGATTATCTTTCTAGGGTTAAGGCCGGCCaaaagggcgaattcGAGCTCACG

[0105] GGGACAGCCCCCCCCCAAAGCCCCCAGGGATGTAATTACGTCCCTCCCCCGCTAGGGGGCAGCAGCG

[0106] AGCCGCCCGGGGCTCCGCTCCGGTCCGGCGCTCCCCCCGCATCCCCGAGCCGGCAGCGTGCGGGGAC

[0107] AGCCCGGGCACGGGGAAGGTGGCACGGGATCGCTTTCCTCTGAACGCTTCTCGCTGCTCTTTGAGCC

[0108] TGCAGACACCTGGGGGGATACGGGGAAAAAGCTTTAGGCTGCTGAGCCTGCATGTTTGATGGTGTCT

[0109] GGATGCAAGCAGAAGGGGTGGAAGAGCTTGCCTGGAGAGATACAGCTGGGTCAGTAGGACTGGGAC

[0110] AGGCAGCTGGAGAATTGCCATGTAGATGTTCATACAATCGTCAAATCATGAAGGCTGGAAAAGCCCTC

[0111] CAAGATCCCCAAGACCAACCCCAACCCACCCACCGTGCCCACTGGCCATGTCCCTCAGTGCCACATC

[0112] CCCACAGTTCTTCATCACCTCCAGGGACGGTGACCCCCCCACCTCCGTGGGCAGCTGTGCCACTGCA

[0113] GCACCGCTCTTTGGAAGGTAAATCTTGCTAAATCCAGCCCGACCCTCCCCTGGCACAACGTAAGGCCATTATCTCTCATCCAACTCCAGGACGGAGTCAGTGAGAATATT.

[0114] 5. Propagation and purification of targeting plasmid and donor plasmid

[0115] Competent cells (DH5α) were used for plasmid propagation. 10 μL of PPARG-mCherry donor plasmid after homologous recombination was added to 50 μL competent cells (Novozyme), incubated on ice for 30 min, then heat-shocked at 42°C for 45 s, incubated on ice for 2 min, and then coated on LB culture plates containing ampicillin. After 16 h, single clones were picked and propagated in LB medium containing ampicillin, and then sequenced and verified using universal primers M13F-TGTAAAACGACGGCCAGT and M13R-CAGGAAACAGCTATGACC. After the sequence was correct, it was expanded in LB medium containing ampicillin. Similar to the donor plasmid, the PPARG targeting plasmid was expanded in LB medium containing ampicillin, and then purified using Magen's endotoxin-free plasmid extraction kit to obtain high-quality plasmids.

[0116] 6. sgRNA targeting efficiency test

[0117] Chicken fibroblasts (DF-1) were used as test cells. DF-1 was cultured in DMEM medium containing 10% fetal bovine serum, 5% CO2, and 37°C. DF-1 was inoculated into a 24-well plate, and when the confluence reached 60%, it was transfected with a blank PX459 plasmid and four sgRNA PPARG targeting plasmids according to the Lipofectamine 3000 operation manual, with 3 replicates per group. After 24 hours of transfection, 2.5 μg / mL of puromycin was used for induction for 3 days for visualization. Next, the DNA of each sample was extracted. The primers shown in Table 3 were used to amplify the DNA fragment containing the sgRNA target sequence for each sample. The DNA fragments were recovered and purified for T7I restriction enzyme verification and editing efficiency verification.

[0118] Table 3 Primers for amplifying sgRNA target sequences

[0119]

[0120] 7. PGCs transfection

[0121] The transfection efficiency of PGCs was tested using 2 different transfection protocols and 4 different liposomal transfection reagents (Table 4).

[0122] Table 4 Transfection reagent types

[0123]

[0124] Each transfection reagent was used to prepare the optimal transfection system according to its instructions (Table 5).

[0125] Table 5 Transfection system

[0126]

[0127]

[0128] The transfection process can be divided into two parts: preparing cells and transfection. In the two different transfection processes, the operation of the transfection part is the same, but there are differences in preparing cells. In transfection process 1 (recommended method in the reagent manual), the cultured cells are collected into a centrifuge tube and counted, and inoculated into a 12-well plate, with 2 to 3 × 10 cells per well. 5 cells (1mL) (see Figure 4 In transfection process 2 (optimized method of the present invention), cultured cells were collected into centrifuge tubes, resuspended and rinsed twice with reduced serum medium OPTI-MEM, then resuspended and counted with OPTI-MEM, and then inoculated into 12-well plates, with 2 to 3 × 10 cells per well. 5 cells (1mL) (see Figure 4 After the cells are prepared, prepare the transfection reagent. For Lipofectamine 2000, Lipofectamine Stem Reagent, and Attractene Transfection Reagent, dilute the transfection reagent and plasmid into 50 μL OPTI-MEM, mix gently by pipetting, then combine the two tubes of mixture together, mix gently by pipetting, and incubate for 10-15 minutes to form a 100 μL transfection mixture (see Figure 4 For Lipofectamine 3000, dilute the plasmid and Lipofectamine 3000 into 50 μL OPTI-MEM, add 4 μL P3000 to the plasmid dilution, then combine the two tubes of mixture and gently pipette to mix and incubate for 10-15 minutes to form a 100 μL transfection mixture ( Figure 4 ). Finally, the 8 transfection reagent mixtures were added to the prepared cells and incubated for 6 hours. After completion, the cells were collected by centrifugation at 400×g for 5 minutes, inoculated into the MEF feeder layer embedding dish and co-cultured for 48 hours, and then the number of positive cells was counted.

[0129] 8. Transfection effect

[0130] It has been verified that sgRNA3 has the highest gene editing efficiency (see Figure 5 Therefore, PX459-sgRNA3 was used as the PPARG targeting plasmid for PGCs and its donor plasmid was constructed. Co-transfection of the PPARG gene targeting plasmid and the PPARG-mCherry donor plasmid can insert the mCherry expression module at the target position of the target gene, making the cells emit red fluorescence (see Figure 6 ).

[0131] After PGCs were transfected with the above four transfection reagents, the transfection efficiency was calculated using flow cytometry. The statistical results showed that the four transfection reagents all showed better transfection effects using the operation steps of transfection process 2, and the transfection efficiency was increased by at least 22.8 times (see Figure 7 , Figure 8 and Table 6). When the operation steps of transfection process 2 were uniformly used, Lipofectamine Stem Reagent showed the highest transfection efficiency, which could reach 2.65%. After flow cytometry sorting, a stable fluorescent expression gene insertion cell line could be established (see Fig. 9 ). Therefore, rinsing PGCs twice with OPTI-MEM during transfection and transfecting cells in an OPTI-MEM environment can effectively improve the transfection efficiency of the liposome method. Among the four transfection reagents, Lipofectamine Stem Reagent has the highest transfection efficiency for PGCs.

[0132] Table 6 Transfection results statistics

[0133] Transfection process 1 (%) Transfection process 2 (%) Comparison 0.000±0.000 0.000±0.000 Lipofectamine2000 0.050±0.010 1.140±0.030 Lipofectamine3000 0.050±0.010 1.685±0.155 LipofectamineStemReagent 0.065±0.005 2.650±0.110 Attractene Transfection Reagent 0.025±0.005 0.570±0.007

[0134] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A liposome transfection method for chicken primordial gonad cells, characterized in that: The following steps are involved: The chicken primordial gonad cells were cultured after being rinsed with OPTI-MEM culture medium; The plasmid and the liposome transfection reagent are mixed and incubated to prepare a transfection mixture; wherein the plasmid includes a donor plasmid and a PPARG targeting plasmid; The transfection mixture and the primordial gonad cells are mixed and incubated.

2. The method according to claim 1, characterized in that The rinsing step comprises: collecting chicken primordial gonad cells, centrifuging, collecting the precipitate, resuspending and rinsing with OPTI-MEM culture medium, centrifuging again, and repeating the resuspending and rinsing.

3. The method according to claim 1, characterized in that After the chicken primordial gonad cells were rinsed, the inoculation density was 2×10 5 ~3×10 5 Cells / mL were inoculated into culture plates for culture.

4. The method according to claim 1, characterized in that The mass ratio of the donor plasmid to the PPARG targeting plasmid is 1:

1.

5. The method according to claim 1, characterized in that The method for constructing the donor plasmid includes the steps of using pMD18-T as a starting plasmid and constructing the mCherry fluorescent protein expression cassette shown in SEQ ID NO: 5 onto the starting plasmid by homologous recombination.

6. The method according to claim 1, characterized in that The method for constructing the PPARG targeting plasmid comprises the steps of integrating a DNA fragment corresponding to any one of the sgRNAs shown in SEQ ID NOs: 1-4 into the BbSI site of PX459.

7. The method according to claim 1, characterized in that The plasmid and the liposome transfection reagent are diluted and mixed with OPTI-MEM culture medium respectively, and then the two dilutions are combined and mixed and incubated to obtain the transfection mixture; wherein the mass volume ratio of the plasmid and the OPTI-MEM culture medium is 2 μg:50 μL, and the volume ratio of the liposome transfection reagent to the OPTI-MEM culture medium is 3:

50.

8. The method according to claim 7, characterized in that The liposome transfection reagent includes LipofectamineStem Reagent, and the mixed incubation time is 10 to 15 minutes.

9. The method according to claim 1, characterized in that The transfection mixture and the primordial gonad cells were mixed and incubated for 6 hours, and the volume ratio of the transfection mixture to the primordial gonad cells was 100 μL:1 mL.

10. Use of the method according to any one of claims 1 to 9 in improving the transfection efficiency of chicken primordial gonad cells.

Images