Primer group, kit and method for detecting variation of multiple modification genes influencing beta-thalassemia phenotype

Abstract

The invention relates to a primer group, a method and a kit for detecting various modification gene variations influencing beta-thalassemia (beta-thalassemia for short) phenotypes. The method comprises the following steps: (1) a collection module: obtaining and preparing a subject sample; (2) an amplification module: carrying out long fragment multiple PCR (Polymerase Chain Reaction) amplification on BCL11A, ZBTB7A, KLF1, HBS1L-MYB, GATA1, HBG1 / 2, HBBP1, GATAD2A, DNMT1 and CHD4 in the sample; (3) a library construction module: constructing a single-molecule long-read sequencing library; and (4) a sequencing module for sequencing and analyzing gene variation types. The kit comprises the following reagents: (1) a reagent for long-fragment multiplex PCR amplification; and (2) a reagent for constructing a single-molecule long-read sequencing library.

Description

Technical Field

[0001] The present invention relates to a primer set and method for detecting multiple modifying gene variations affecting beta-thalassemia phenotypes using a single-molecule long-read sequencing platform, as well as a kit suitable for the method. Background Art

[0002] β-thalassemia (β-thalassemia) is a hemolytic anemia caused by β-globin synthesis disorder due to a defect in the HBB gene that expresses β-globin. It is one of the most common single gene recessive genetic diseases in the world and also the genetic disease with the highest incidence in provinces and regions south of the Yangtze River in my country. [1-3] β-thalassemia has a wide spectrum of phenotypic variation in clinical practice. When the HBB genotype is the same or similar, the severity of the clinical phenotype may vary among patients. [4] There are two main reasons that affect the heterogeneity of β-thalassemia phenotype: α-thalassemia (α-thalassemia) gene (HBA1 / 2) type and fetal hemoglobin (Hemoglobin F, HbF) expression. The reduction or increase of α-globin caused by α-thalassemia gene mutation will affect the synthesis of β-globin and lead to α / β-globin imbalance, thus affecting the phenotype of β-thalassemia patients [5]. Hb F is composed of α-globin and γ-globin encoded by HBG1 / 2 genes. It begins to be expressed in the liver at 5 weeks of gestation. The content exceeds 90% when the fetus is 6 months old. It decreases rapidly around birth and is generally less than 1% at 2 years old. However, in some adults, there is a phenomenon of high expression of γ-globin leading to increased Hb F, which is called hereditary persistence of fetal hemoglobin (HPFH). [6] High expression of γ-globin in β-thalassemia patients can combine with free α-globin to form Hb F that can carry oxygen normally, reduce the imbalance of α / β-globin, and effectively relieve the symptoms of patients. [7] , so it is very important to study the formation mechanism of HPFH.

[0003] HPFH includes two types: deletion type and non-deletion type. The deletion type refers to the compensatory high expression of γ-globin encoded by HBG1 / 2 genes due to the deletion of a large fragment of the HBB gene, while the non-deletion type includes the high expression of γ-globin due to the mutation of modifier genes. Modifier genes are genes other than the HBB gene in β-thalassemia that can cause clinical phenotypic heterogeneity by affecting Hb F expression. Currently, modifier genes are mainly divided into three categories: (1) Important erythroid transcription factors, such as BCL11A [8] 、ZBTB7A / LRF [9] 、KLF1

[10] MYB

[11] and GATA1

[12] These transcription factors are involved in erythroid differentiation and growth pathways. Under normal circumstances, they inhibit the expression of γ-globin genes. However, when specific gene mutations occur, their inhibition of γ-globin genes is reduced, thereby increasing the expression of Hb F to alleviate the phenotype of β-thalassemia patients.

[13] There are often multiple sites on the same gene that affect its expression. Typical modification sites include rs766432 (BCL11A), rs483352838 (KLF1), and rs9399137 (HBS1L-MYB). (2) The cis-element mutations that bind to erythroid transcription factors relieve the inhibitory effect of transcription factors on γ-globin. For example, mutations in the proximal promoter of HBG1 / 2, such as -196C>T, -197C>T, and -198T>C, have also been found to reduce LRF and KLF1 enrichment.

[14] The variant site rs2071348 on the HBBP1 pseudogene was also found to be associated with the phenotype of β-thalassemia

[15] ; (3) Epigenetic-related genes such as GATAD2A

[16] DNMT1

[17] and CHD4

[18] Mutations in γ-globin can regulate γ-globin gene expression by changing the epigenetic modification state of γ-globin gene. Stem cell transplantation is currently a relatively mature treatment for β-thalassemia, but due to the difficulty in finding donors and high costs, many patients often do not receive timely and effective treatment. Recent studies have shown that editing and modifying genes such as BCL11A through CRISPR / Cas9 to reactivate endogenous γ-globin expression is expected to become a new method for treating β-thalassemia

[19] Therefore, in-depth research on modifier gene variations is of great significance for understanding the clinical phenotypic heterogeneity and precise treatment of β-thalassemia patients.

[0004] β-thalassemia modifying gene mutations include large deletions, duplications, and point mutations. The most common method for detecting deletions and duplications is gap-PCR (Gap-PCR), while point mutations can be detected using Sanger sequencing and next-generation sequencing (NGS). However, these methods have the following limitations:

[0005] 1. It is impossible to comprehensively analyze the multiple modifying gene variations of β-thalassemia in one detection system;

[0006] 2. Neither Sanger sequencing nor NGS can detect multiple cis- and trans-variants in the same gene region;

[0007] 3. Due to the limitation of sequencing read length, NGS cannot accurately analyze sequences within repetitive regions. Summary of the invention

[0008] In view of this, the present invention provides a method based on long-fragment multiplex PCR amplification and single-molecule long-read sequencing to detect multiple modifier gene variations that affect the β-thalassemia phenotype. There are 10 regions of these modifier genes or related genes, including BCL11A, ZBTB7A, KLF1, HBS1L-MYB, GATA1, HBG1 / 2, HBBP1, GATAD2A, DNMT1 and CHD4. First, these target fragments are amplified by the long-fragment multiplex PCR method, combined with the characteristics of the single-molecule long-read sequencing platform, such as the length measurement, to achieve accurate, rapid and high-throughput detection of multiple modifier gene variations of β-thalassemia. The method involved in the present invention is simple to operate, and the quality of long-fragment PCR and single-molecule long-read libraries is reliable and reproducible, which is conducive to the application of single-molecule long-read sequencing technology in clinical detection.

[0009] The purpose of the present invention is to solve the problems of incomplete coverage of β-thalassemia-related modifier genes, cumbersome genetic diagnosis and detection methods, and single detection of variant types by different methods, which leads to missed detection and misdetection in clinical practice. Through long-fragment multiplex PCR and preparation of single-molecule long-read sequencing libraries, the goal of comprehensive, accurate and rapid batch detection of multiple variants of β-thalassemia-related modifier genes is achieved. The 26 primers used for long-range multiplex PCR are as follows: BCL11A-F, BCL11A-R, ZBTB7A-F, ZBTB7A-R, KLF1-F, KLF1-R, HBS1L-MYB-F, HBS1L-MYB-R, GATA1-F, GATA1-R, HBG1-F, HBG2-R, HBBP1-F, HBBP1-R, GATAD2A-F, GATAD2A-R, DNMT1-F, DNMT1-R, CHD4E40-F, CHD4E38-R, CHD4E37-F, CHD4E26-R, CHD4E25-F, CHD4E13-R, CHD4E12-F and CHD4E2-R.

[0010] In a specific embodiment, the primer sequence is selected from SEQ ID NO: 1-26 in Table 1.

[0011] In a preferred embodiment, the primer set amplifies 13 target fragments, which can at least simultaneously detect large fragment deletions and duplications caused by HBG1 and HBG2 gene recombination, as well as at least 109 point mutations as shown in Table 2.

[0012] In one embodiment, 5-50 nt of DNA with different sequences, i.e., DNA barcodes, can be added to the 5' end of the primers to distinguish different samples; preferably, the 5' end barcodes of the F and R primers can be the same or different, and those skilled in the art can choose as needed.

[0013] In a preferred experimental scheme, the primer set is used for amplification of one system, or can be used separately for amplification of two or more systems. Combined with the subsequent single-molecule long-fragment sequencing platform, the variation types of all gene fragments within the primer range can be detected.

[0014] According to a second aspect of the present invention, a kit for simultaneously detecting multiple mutations in thalassemia-related modifier genes and related regulatory regions is provided, comprising the following reagents:

[0015] (1) Reagents for long-fragment multiplex PCR amplification;

[0016] (2) Reagents used to construct single-molecule long-read sequencing libraries.

[0017] In one embodiment, the reagents for multiplex-long fragment PCR amplification include DNA polymerase, reaction buffer and primer set.

[0018] In a preferred embodiment, the primer set in the kit contains 26 primers, a total of 13 pairs of primers as follows: BCL11A-F&BCL11A-R, ZBTB7A-F&ZBTB7A-R, KLF1-F&KLF1-R, HBS1L-MYB-F&HBS1L-MYB-R, GATA1-F&GATA1-R, HBG1 / 2-F&HBGl / 2-R, HBBP1-F&HBBP1-R, GATAD2A-F&GATAD2A-R, DNMT1-F&DNMT1-R, CHD4E40-F&CHD4E38-R, CHD4E37-F&CHD4E26-R, CHD4E25-F&CHD4E13-R and CHD4E12-F&CHD4E2-R. The primers can amplify the entire sequence within the primer range, including any type of variation within the primer range.

[0019] Preferably, the amplification product of each primer is between about 2 kb and 13 kb. Preferably, if there is a SNP at the primer position, a degenerate base primer is used.

[0020] In a preferred embodiment, the primer sequences are shown in SEQ ID NOs: 1-26 in Table 1.

[0021] In a preferred embodiment, 5-50 nt DNA (Barcode) of different sequences can be added to the 5' end of the primers in the kit to distinguish different samples; preferably, the 5' end Barcodes of the F and R primers can be the same or different, and those skilled in the art can choose according to needs.

[0022] In one embodiment, for the kit, the long-fragment PCR amplification product may be purified or not before the next step of the reaction, and those skilled in the art may choose as needed.

[0023] In another embodiment, in the kit, the reagents for constructing a single-molecule long-read sequencing library include end repair enzymes, adapters, ligases, DNA purification magnetic beads, reaction buffers, and exonucleases.

[0024] In a preferred embodiment, the kit can at least simultaneously detect large deletions and duplications caused by HBG1 and HBG2 gene recombination, as well as at least 109 point mutations as shown in Table 2.

[0025] Among them, the point mutations and structural variations at the gene loci described in this article can be queried in LOVD, ClinVar and references; detailed mutation information is shown in Table 2.

[0026] In a specific embodiment, for the kit, long-range PCR amplification can be completed in one reaction tube or two to more reaction tubes.

[0027] In a preferred embodiment, the single-molecule long-read sequencing is selected from the SMRT and Nanopore technology platforms of PacBio based on single-molecule real-time sequencing.

[0028] In a specific embodiment, PacBio library adapter ligation can be performed using blunt-end ligation or TA ligation.

[0029] In a specific embodiment, the PacBio universal blunt end adapter sequence is 5'-pATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGA GAGAT-3' (SEQ ID NO: 27), and a blunt end stem-loop structure adapter adapter is formed by annealing. 5-50nt of different sequence DNA (Barcode) can be added to the stem to form adapter adapters with different Barcodes. PacBio libraries with different Barcodes can be mixed together for sequencing.

[0030] In a specific embodiment, the PacBio universal TA adapter sequence is 5'-pATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGA GAGATT-3' (SEQ ID NO: 28), and a blunt-ended stem-loop structure adapter adapter is formed by annealing. 5-50 nt of different sequence DNA (Barcode) can be added to the stem to form adapter adapters with different Barcodes. PacBio libraries with different Barcodes can be mixed together for sequencing.

[0031] In one embodiment, the PacBio connector may or may not have a barcode. Preferably, the PacBio connector has a barcode designed by PacBio or a barcode designed by the company itself, and those skilled in the art can choose according to their needs.

[0032] In a preferred embodiment, the PacBio library is compatible with the Pacific Biosciences sequencing platform.

[0033] In a preferred embodiment, the reagents used to construct the single-molecule long-read Nanopore library include end repair enzymes, linkers, ligases, DNA purification magnetic beads, 80% ethanol and reaction buffer.

[0034] In one embodiment, Nanopore library adapter ligation can be performed using blunt-end ligation or TA ligation.

[0035] In one embodiment, the Nanopore connector may or may not have a barcode. Preferably, the Nanopore connector has a barcode designed by ONT or a self-designed barcode, and those skilled in the art can select one according to their needs.

[0036] A third aspect of the present invention provides a method for detecting multiple variations of multiple β-thalassemia modifying genes, comprising the following steps:

[0037] (1) Collection module: obtaining and preparing subject samples;

[0038] (2) Amplification module: long-fragment multiplex PCR amplification of BCL11A, ZBTB7A, KLF1, HBS1L-MYB, GATA1, HBG1 / 2, HBBP1, GATAD2A, DNMT1 and CHD4 in the sample;

[0039] (3) Library construction module: construction of single-molecule long-read sequencing library;

[0040] (4) Sequencing module: sequence and analyze gene mutation types.

[0041] In one embodiment, the long fragment PCR primer set used in the method of the present invention is selected from the primers described above. Preferably, a DNA (Barcode) of 5-50 nt different sequences can be added to the 5' end of the primers described above to distinguish different samples.

[0042] In a preferred embodiment, the 5' end barcodes of the F and R primers may be the same or different, and those skilled in the art may select the barcodes as needed.

[0043] In a preferred embodiment, the method described herein can at least simultaneously detect large deletions and duplications caused by recombination of HBG1 and HBG2 genes, as well as at least 109 point mutations as shown in Table 2.

[0044] Among them, the point mutations and structural variations at the gene loci described in this article can be queried in LOVD, ClinVar and references; detailed mutation information is shown in Table 2.

[0045] In a preferred embodiment, in the method, long-fragment PCR amplification can be completed in one reaction tube or two or more reaction tubes.

[0046] In one embodiment, the sample is selected from a biological sample or genomic DNA extracted from a sample, wherein the biological sample is selected from a cultured cell line, blood, amniotic fluid, chorionic villi, gametes, blastocyst cells, joint fluid, urine, sweat, saliva, feces, cerebrospinal fluid, ascites, pleural effusion, bile or pancreatic fluid, etc.

[0047] In a specific embodiment, the single-molecule long-read sequencing of the method is selected from the SMRT and Nanopore technology platforms of PacBio based on single-molecule real-time sequencing.

[0048] In one embodiment, PacBio library adapter ligation can be performed using blunt-end ligation or TA ligation.

[0049] In one embodiment, the PacBio universal blunt end adapter sequence is 5'-pATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGA GAGAT-3' (SEQ ID NO: 27), and a blunt end stem-loop structure adapter adapter is formed by annealing. 5-50 nt of different sequence DNA (Barcode) can be added to the stem to form adapter adapters with different Barcodes. PacBio libraries with different Barcodes can be mixed together for sequencing.

[0050] In one embodiment, the PacBio universal TA adapter sequence is 5'-pATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGA GAGATT-3' (SEQ ID NO: 28), and a blunt-ended stem-loop structure adapter adapter is formed by annealing. 5-50 nt of different sequence DNA (Barcode) can be added to the stem to form adapter adapters with different Barcodes, and PacBio libraries with different Barcodes can be mixed together for sequencing.

[0051] In one embodiment, the PacBio connector may or may not have a barcode. In a preferred embodiment, the PacBio connector has a barcode designed by PacBio or a barcode designed by the company. Those skilled in the art can select as needed.

[0052] In a preferred embodiment, the PacBio library is compatible with the Pacific Biosciences sequencing platform.

[0053] In a preferred embodiment, the reagents used to construct the single-molecule long-read Nanopore library include end repair enzymes, linkers, ligases, DNA purification magnetic beads, 80% ethanol and reaction buffer.

[0054] In one embodiment, Nanopore library adapter ligation can be performed using blunt-end ligation or TA ligation.

[0055] In one embodiment, the Nanopore connector may be with or without a barcode, and those skilled in the art may choose according to need.

[0056] The method described in the present invention based on a specific combination of long-fragment multiplex PCR amplification and single-molecule long-read high-throughput sequencing can simultaneously detect multiple variations in multiple β-thalassemia-related modifier gene samples with high specificity, accuracy and speed.

[0057] The excellent technical effects of the method and kit of the present invention are mainly in the following aspects:

[0058] (1) Wide detection range. The present invention can simultaneously detect all variations of various modifier genes that have been found to affect the β-thalassemia phenotype, including but not limited to large deletions and duplications caused by HBG1 and HBG2 gene recombination, and at least 109 point mutations as shown in Table 2.

[0059] (2) It can distinguish the cis-trans relationship between two or more variants. With the advantage of long read length of single molecule, the present invention can accurately determine the cis-trans relationship between two or more variant sites on the same amplified fragment and perform haplotype typing.

[0060] (3) Sample diversification: The template used for PCR can be peripheral blood, dried blood spots, or extracted genomic DNA, or it can be a human cell line or other specific tissues.

[0061] (4) High-throughput detection. Single-molecule long-read sequencing can achieve 384 types of barcode adapters, and more types of barcode adapters can be designed according to needs. Or a dual-barcode system with primers and adapters can be used to achieve more barcode combinations. The high-throughput characteristics of the single-molecule long-read sequencing platform determine that high-throughput sample detection can be achieved.

[0062] (5) High accuracy. PacBio's dumbbell-shaped library can be read multiple times during sequencing, and the base accuracy of the sequencing results after correction is greater than 99%. In addition, PacBio sequencing errors are random, and the base accuracy is greater than 99.9% after correction through sequencing depth. Therefore, gene mutations within the primer detection range can be accurately read.

[0063] (6) Flexible detection time. The Nanopore platform can generate data within minutes, and data analysis can be started within minutes or hours depending on the actual data volume. When the detection timeliness requirements are relatively high, the Nanopore platform has a time advantage. BRIEF DESCRIPTION OF THE DRAWINGS

[0064] Figure 1 :Shows representative long-read sequencing results. (A) Representative sample full-length sequencing depth of each fragment. (B) BCL11A, KLF1, HBS1L-MYB, HBBP1, DNMT1 and CHD4-3 fragment sequencing results are shown in the IGV graph. The reference genome is hg38, and the vertical lines represent SNPs. The SNPs of the two chromosomes may have one (such as BCL11A and HBBP1) or two haplotypes (such as KLF1, HBS1L-MYB, DNMT2 and CHD4-3) in the amplified region.

[0065] Figure 2 : Recombination of HBG1 and HBG2 gene regions is shown. Representative samples are shown in the IGV diagram showing normal (HBG1-HBG2), duplication (HBG1-HBG2 / 1-HBG2) and deletion (HBG1 / 2).

[0066] Figure 3: Representative modified gene variants are shown in the IGV diagram. (A) rs7606173 site of BCL11A gene. (B) rs201642811 site of HBG1 gene. (C) rs41294862 site of HBS1L-MYB intergenic region. (D) rs10128556 site of HBBP1 gene.

[0067] Figure 4 : The IGV diagram shows that eight variant sites, including rs1427407, rs7599488, rs1896294, rs766432, rs4671393, rs6729815, rs1896295 and rs1896296 on the BCL11A gene in representative samples, are located in the same haplotype, i.e., cis arrangement. DETAILED DESCRIPTION

[0068] Although the present invention can be implemented in many different forms, what is disclosed here is its specific illustrative embodiment that verifies the principle of the present invention.It should be emphasized that the present invention is not limited to the specific embodiment illustrated.In addition, any section heading used herein is only for organizational purposes and is not to be interpreted as limiting the subject matter described.

[0069] Unless otherwise defined herein, scientific and technical terms used in conjunction with the present invention will have the meanings commonly understood by those of ordinary skill in the art. In addition, unless the context otherwise requires, terms in the singular should include plural forms, and terms in the plural should include singular forms. More specifically, as used in this specification and the appended claims, unless the context otherwise clearly indicates, the singular forms "a", "an" and "the" include plural indicators. In this application, unless otherwise stated, the use of "or" means "and / or". In addition, the use of the term "comprising" and other forms (such as "including" and "containing") is not restrictive. In addition, the ranges provided in the specification and the appended claims include endpoints and all values ​​between the endpoints.

[0070] Sequence Listing Overview

[0071] This application is accompanied by a sequence listing containing a number of nucleic acid and amino acid sequences. Table 1 below provides an overview of the sequences contained.

[0072] Table 1

[0073]

[0074]

[0075] Point mutation information overview

[0076] The point mutations and structural variations at the gene loci described in this application can be queried in LOVD, ClinVar and references; see Table 2 for detailed mutation information.

[0077] Table 2:

[0078]

[0079]

[0080]

[0081]

[0082]

[0083] Example 1: Amplification of β-thalassemia modified gene fragments by long-fragment multiplex PCR using the method of the present invention and sequencing

[0084] Step 1: Long-range multiplex PCR amplification

[0085] Prepare the reaction system according to Table 3 below to amplify the genomic DNA sample:

[0086] Table 3:

[0087]

[0088]

[0089] On the PCR instrument, pre-amplification was performed according to the conditions shown in Table 4 below:

[0090] Table 4:

[0091]

[0092] After amplification, the amplified product was placed in a centrifuge at 10,000 rpm for 20 minutes. After centrifugation, the product was placed horizontally and 4 μL of the supernatant was added to a new tube.

[0093] Step 2: PacBio sequencing library construction

[0094] Prepare the PacBio library reaction system according to Table 5 below:

[0095] Table 5:

[0096]

[0097]

[0098] On a PCR instrument, the reaction was carried out under the following conditions: 37°C for 20 min; 25°C for 15 min; 65°C for 10 min. After the reaction was completed, 0.5 μL Exonuclease III (NEB, Cat#M0206L) and 0.5 μL Exonuclease VII (NEB, Cat#M0379L) were added and the reaction was continued at 37°C for 1 hour. The DNA was purified twice with 0.6x Ampure PB magnetic beads (PacBio, Cat#100-265-900) according to the manufacturer's instructions, and finally eluted with 10uL Elution Buffer. The resulting DNA eluate is the target DNA PacBio sequencing library. The DNA concentration was determined on a Qubit3 Fluoromter (ThermoFisher, Cat#Q33216) using Qubit dsDNA HS reagent (ThermoFisher, Cat#Q32851). When there are multiple sample PacBio sequencing libraries, equal amounts of the libraries can be mixed together to prepare a mixed library.

[0099] Step 3: PacBio sequencing and analysis

[0100] According to the total concentration and molar concentration of the library, an appropriate volume of the library was reacted with the binding reagent (PacBio, Cat#101-820-200) and sequencing primer (PacBio, Cat#100-970-100) to prepare the final library that can be used in the machine. Representative sequencing results are shown in Figure 1 As shown, all 13 sequencing fragments obtained effective long fragment read coverage exceeding 30X depth ( Figure 1 A). Representative fragment sequencing results are displayed in Integrative Genomics Viewer (IGV) ( Figure 1 B).

[0101] Example 2: Detection of samples from β-thalassemia patients

[0102] Genomic DNA samples from 900 patients diagnosed with β-thalassemia by genetic testing from Southern Medical University were collected, and 10 modified gene regions were simultaneously detected using the method (and kit) of the present invention. 155 and 162 SNPs were detected in the BCL11A and HBS1L-MYB regions, respectively. The test results are shown in Tables 6 and 7.

[0103] Table 6: BCL11A gene SNP detection results

[0104]

[0105]

[0106]

[0107]

[0108]

[0109] Table 7: HBS1L-MYB intergenic region SNP detection results

[0110]

[0111]

[0112]

[0113]

[0114]

[0115]

[0116] The method of this aspect can detect large fragment deletions and duplications caused by HBG1 and HBG2 gene recombination ( Figure 2 ), point mutations within each fragment ( Figure 3 AD), and can also determine the cis-trans relationship between multiple point mutations in the same fragment, such as BCL11A ( Figure 4 ).

[0117] It should be noted that although the above implementation cases have demonstrated a series of features of the present invention, researchers and technicians in this field can use the ideas of the present invention to adjust and change the reaction reagents, reaction conditions, etc. involved in the construction of multiple + long fragment PCR reactions and single molecule long read sequencing libraries according to specific needs. Therefore, for those skilled in the art, several simple substitutions can be made without departing from the concept and principle of the present invention, which should be included in the protection scope of the present invention.

[0118] References

[0119] [1]Modell B, Darlison M. Global epidemiology of haemoglobin disorders and derived service indicators. Bull World Health Organ. 2008Jun; 86(6):480-7.doi:10.2471 / blt.06.036673.

[0120] [2] Chui DH. Alpha-thalassaemia and population health in SoutheastAsia. Ann Hum Biol. 2005Mar-Apr; 32(2):123-30.doi:10.1080 / 03014460500075084.

[0121] [3]Xu Xiangmin, Zhang Xinhua, Chen Lili. Guidelines for the prevention and control of thalassemia. People’s Military Medical Publishing House, 2011.

[0122] [4] Zhang Qianqian, Shang Xuan, Lin Wanying, Xu Xiangmin. Genetic modifiers affecting β-thalassemia phenotype. Hereditas (Beijing) 2019 Aug; 41(8): 669-676. [5] Sollaino MC, Paglietti ME, Perseu L, Giagu N, Loi D, Galanello R. Association of αglobin gene quadruplication and heterozygous βthalassemia in patients with thalassemia intermedia. Haematologica. 2009 Oct; 94(10): 1445-8. doi: 10.3324 / haematol.2009.005728.

[0123] [6]Forget BG. Molecular basis of hereditary persistence of fetal hemoglobin. Ann NY Acad Sci.1998Jun 30;850:38-44.doi:10.1111 / j.1749-6632.1998.tb10460.x.

[0124] [7] Sripichai O, Fucharoen S. Fetal hemoglobin regulation in β-thalassemia: heterogeneity, modifiers and therapeutic approaches. Expert RevHematol.2016Dec; 9(12):1129-1137.doi:10.1080 / 17474086.2016.1255142.

[0125] [8]Bauer DE,Kamran SC,Lessard S,Xu J,Fujiwara Y,Lin C et al.Anerythroid enhancer of BCL11A subject to genetic variation determines fetalhemoglobin level.Science.2013Oct11;342(6155):253-7.doi:10.1126 / science.1242088.

[0126] [9]Masuda T,Wang X,Maeda M,Canver MC,Sher F,Funnel APWetal.Transcription factors LRF and BCL11A independently repress expression offetal hemoglobin.Science.2016Jan 15;351(6270):285-9.doi:10.1126 / science.aad3312.

[0127]

[10] Zhou D,Liu K,Sun CW,Pawlik KM,Townes TM.KLF1 regulates BCL11Aexpression andγ-toβ-globin gene switching.Nat Genet.2010Sep;42(9):742-4.doi:10.1038 / ng.637.

[0128]

[11] Thein SL,Menzel S,Peng X,Best S,Jiang J,Close J et al.Intergenicvariants of HBS1L-MYB are responsible for a majorquantitative trait locus onchromosome 6q23 influencing fetalhemoglobin levels in adults.Proc Natl AcadSci U S A.2007 Jul3;104(27):11346-51.doi:10.1073 / pnas.0611393104.

[0129]

[12] Gutierrez L, Caballero N, Fernandez-Calleja L, Karkoulia E, Strouboulis J. Regulation of GATA1 levels in erythropoiesis.

[0130]

[13] Guo XQ.Progress on genes related to fetal hemoglobinquantitativetrait.Hereditas(Beijing).2010,32(4):295–300.

[0131]

[14] Weber L,Frati G,Felix T,Hardouin G,Casini A,WollenschlaegerC etal.Sci Adv 126(7):eaay9392.doi:10.1126 / sciadv.aay9392.

[0132]

[15] Nuinoon M,Makarasara W,Mushiroda T,Setianingsih I,Wahidiyat PA,Sripichai O et al.A genome-wide association identifiedthe common geneticvariants influence disease severity inbeta0-thalassemia / hemoglobin E.HumGenet.2010 Mar127(3):303-14.doi:10.1007 / s00439-009-0770-2.

[0133]

[16] Liang Y,Zhang X,Liu Y,Wang L,Ye Y,Tan X et al.GATA zincfingerdomain-containing protein 2A(GATAD2A)deficiencyreactivates fetal hemoglobin patients withβ-thalassaemia throughimpaired formation of methyl-binding domain protein 2(MBD2) and nuclear remodeling deacetylation(NuRD)complex.Br J Haematol.2021 Jun;193(6):1220-1227.doi:10.1111 / bjh.17511.

[0134]

[17] Gong Y,Zhang X,Zhang Q,Zhang Y,Ye Y,Yu W et al.Anatural DNMT1mutation elevates the fetal hemoglobin level viaepigenetic derepression oftheγ-globin gene inβ-thalassemia.Blood.2021 Mar 25:137(12):1652-1657.doi:10.1182 / blood.2020006425.

[0135]

[18] Yu X,Azzo A,Bilinovich S,Li X,Dozmorov M,Kurita R etal.Disruption of the MBD2-NuRD complex but not MBD3-NuRD induceshigh levelHbF expression in human adult erythroid cells.Haematologica.2019 Dec;104(12):2361-2371.doi:10.3324 / haematol.2018.210963.

[0136]

[19] Wu Y,Zeng J,Roscoe BP,Liu P,Yao Q,Lazzarotto CR et al.Highlyefficient therapeutic gene editing of human hematopoietic stemcells.NatMed.2019 May;25(5):776-783.doi:10.1038 / s41591-019-0401-y.

Claims

1. A primer set for simultaneous long-fragment multiplex PCR amplification of multiple variants in β-thalassemia-modifying gene-related fragments, covering the following genes or intergenic regions: BCL11A, ZBTB7A, KLF1, HBS1L-MYB, GATA1, HBG1 / 2, HBBP1, GATAD2A, DNMT1 and CHD4; The primer set comprises 26 primers and 13 pairs of primers as follows: BCL11A-F&BCL11A-R, ZBTB7A-F&ZBTB7A-R, KLF1-F&KLF1-R, HBS1L-MYB-F&HBS1L-MYB-R, GATA1-F&GATA1-R, HBG1 / 2-F&HBG1 / 2-R, HBBP1-F&HBBP1-R, GATAD2A-F&GATAD2A-R, DNMT1-F&DNMT1-R, CHD4E40-F&CHD4E38-R, CHD4E37-F&CHD4E26-R, CHD4E25-F&CHD4E13-R and CHD4E12-F&CHD4E2-R, and the primers are selected from SEQ ID NO: 1-26, can detect large deletions and duplications caused by HBG1 and HBG2 gene recombination, as well as at least 109 point mutations as shown in Table 2.

2. The primer according to claim 1, wherein the primer can add 5-50nt DNA of different sequences at the 5' end, i.e., DNA barcode, for distinguishing different samples.

3. The primer according to claim 1, wherein the primer can be used to detect whether different mutations within the amplified product fragment are linked.

4. A kit for detecting primers for multiple mutations of multiple thalassemia modifying genes, comprising the following reagents: (1) Reagents for long-fragment multiplex PCR amplification; (2) Reagents used to construct single-molecule long-read sequencing libraries.

5. The kit according to claim 4, characterized in that Multiple variations of multiple β-thalassemia modifying genes can be detected, and the mutations include at least: large fragment deletions and duplications caused by recombination of HBG1 and HBG2 genes, and at least 109 point mutations as shown in Table 2. The kit according to claim 4 , wherein the kit is used to detect whether different mutations in the same amplified fragment are linked.

7. The kit according to claim 4, wherein the reagents for long-fragment PCR amplification include DNA polymerase, reaction buffer and primers. The kit according to claim 4 , wherein the primer is the primer according to claim 1 .

9. The kit according to claim 4, wherein the reagents for constructing a single-molecule long-read sequencing library include adapters, end-repair enzymes, ligases, DNA purification magnetic beads, reaction buffers, and exonucleases.

10. The kit according to claim 4, wherein the single-molecule long-read sequencing is selected from single-molecule real-time sequencing (SMRT) and nanopore technology platforms.

11. A method for detecting multiple variations of multiple β-thalassemia modifying genes, comprising the following steps: (1) Collection module: obtaining and preparing subject samples; (2) Amplification module: long-fragment multiplex PCR amplification of BCL11A, ZBTB7A, KLF1, HBS1L-MYB, GATA1, HBG1 / 2, HBBP1, GATAD2A, DNMT1 and CHD4 in the sample; (3) Library construction module: construction of single-molecule long-read sequencing library; (4) Sequencing module: sequence and analyze gene mutation types. 12 . The method according to claim 11 , wherein the primers used for long-fragment multiplex PCR amplification are the primers according to claim 1 .

13. The method according to claim 11, wherein the single-molecule long-read sequencing is selected from single-molecule real-time sequencing (SMRT) and nanopore technology platforms.

Images