Siniperca chuatsi juvenile fish early-stage domestication method based on artificial intelligence technology

Abstract

The invention belongs to the field of electronic information and aquaculture fry, and particularly relates to a method for early domestication of siniperca chuatsi juveniles based on an artificial intelligence technology and a matched special feed for domestication of the siniperca chuatsi juveniles. When the siniperca chuatsi juveniles grow to 1 cm, domesticating the siniperca chuatsi juveniles with special puffed pellet feed under the assistance of an artificial intelligence technology. The artificial intelligence technology strictly monitors the water quality condition, the feeding behavior and the fry health condition in the domestication stage, the domestication progress of mandarin fish is more accurately controlled, and the special feed for mandarin fish juvenile domestication is complete in formula, good in palatability and higher in nutritive value and metabolism efficiency. According to the method, artificial intelligence is applied to the mandarin fish domestication process for the first time, early domestication of the mandarin fish juveniles is achieved for the first time, the time for starting domestication of the mandarin fish is advanced from 5-7 cm to 1 cm, and the time for receiving artificial feed by the mandarin fish is advanced from 10 cm or above to 2-3 cm. The controllability of baits in the mandarin fish fry breeding period is improved, meanwhile, the bait cost is saved, and technical support is provided for mandarin fish feed controllable breeding.

Description

Technical Field

[0001] The invention belongs to the field of electronic information and aquaculture seedlings, and specifically relates to an early domestication method for juvenile mandarin fish based on artificial intelligence technology. Background Art

[0002] In recent years, artificial intelligence technology has developed rapidly, and the progress of ChatGPT has continuously refreshed people's understanding of artificial intelligence. Artificial intelligence technology has been widely used in customer service, finance, education, medicine and other fields, but it is less used in aquaculture. However, in the context of the fourth industrial revolution, intelligent farming has become an inevitable trend, and the application of artificial intelligence in aquaculture has made certain progress. For example, through visual technology, the physiological state of shrimp can be intelligently detected and targeted prevention and treatment of diseased individuals can be carried out. Underwater cameras can be used to observe the aggregation behavior of fish during feeding to scientifically control the amount of feeding. In addition, robotics technology is also used in seedling breeding, aquatic disease diagnosis, water quality environment testing, etc. The application of artificial intelligence in the breeding, domestication, and environmental testing of the aquaculture industry has important theoretical significance and application value.

[0003] Mandarin fish is a freshwater fish unique to East Asia and an important economic freshwater aquaculture fish in my country. Together with Songjiang perch, Yellow River carp and Xingkai Lake bream, it is known as my country's "Four Famous Fishes". According to authoritative data in 2023, the total output of mandarin fish in my country has reached 370,000 tons, with a total output value of more than 20 billion yuan, which is equivalent to grass carp. At present, mandarin fish has successfully completed the domestication process from live bait fish to artificial feed, but due to the lack of precise control of feeding methods and feeding amounts, and the high sensitivity of mandarin fish to changes in water quality and nutritional environment, the domestication rate and adult fish cultivation rate of feed mandarin fish are still low. In addition, the domestication of mandarin fish feed generally starts from 5-7 cm, and can be completed at 10-12 cm, with a domestication survival rate of 50-70%. However, before 5 cm, mandarin fish still cannot get rid of its dependence on live bait fish, which to a certain extent limits the development of mandarin fish seed industry and subsequent adult fish feed breeding industry. In addition, organisms are more receptive to interventions in food nutrition changes in their early stages, and may also have a favorable effect on nutritional metabolism in adulthood through epigenetics. Therefore, early domestication technology is awaiting research and breakthroughs, which will be beneficial to the development of the mandarin fish seed industry and the improvement of the survival rate of feed farming. The feed domestication of mandarin fish is a process of changing its original feeding behavior through gradual changes in the environment, physiology, and nutrition, and then changing its feeding habits through a period of stability. Artificial intelligence technology can be used to monitor changes in the behavior, body color, and water environment of mandarin fish during the domestication stage, and then the optimal domestication instructions can be given through database comparison analysis and calculation. The application of artificial intelligence technology in the early domestication process of mandarin fish fry is conducive to the development of controllable, intelligent, and healthy farming of mandarin fish, and is an important breakthrough in the mandarin fish feed farming industry. Summary of the invention

[0004] The purpose of the present invention is to provide a method for early domestication of mandarin fish fry based on artificial intelligence technology, aiming at the problem of difficulty in supplying bait during the juvenile period of mandarin fish and low survival rate of feed culture during the juvenile period, and realizing early domestication of mandarin fish fry, solving the problem of difficulty in supplying live bait during the juvenile to juvenile stage, and domestication at the juvenile stage with stronger plasticity is more conducive to the acceptance of mandarin fish to artificial feed, which can improve the survival rate of feed culture in the later adult stage and reduce the risk of feed culture of mandarin fish. Another purpose of the present invention is to disclose a formula of special feed for early domestication of mandarin fish, which improves the feeding rate of mandarin fish to artificial feed by using attractants, is conducive to digestion, absorption and metabolism of mandarin fish fry by using metabolic promoting substances, is conducive to the survival rate of early feed domestication of mandarin fish by using the best nutrient source ratio, and achieves higher economic benefits.

[0005] To achieve the above object, the present invention provides the following technical solutions: a method for early domestication of juvenile mandarin fish based on artificial intelligence technology, wherein when the juvenile mandarin fish is 1 cm long, the juvenile mandarin fish is domesticated in a factory greenhouse under the background of artificial intelligence technology using ice-fresh bait fish and extruded feed specially for juvenile mandarin fish, and the feed domestication is completed when the juvenile mandarin fish is 2-3 cm long; The process of bait conversion is dead bait fish splash, ice-fresh bait fish splash, and puffed feed for juvenile fish. The ice-fresh bait fish used is bream splash that has been out of the membrane for 10 days; Furthermore, the domestication was carried out in a factory-scale circulating water temperature shed, with a PE barrel of 2 meters in diameter and 1.5 meters in depth. The base color of the barrel was white, and a nylon net cage was hung inside the barrel for domestication. The specification was 1*1*1 meters, and the domestication density of mandarin fish was 10,000 per cubic meter of water. Furthermore, the bait fish is bream fish that has been out of the film for 10 days, and the storage condition of the fresh fish is below -20 degrees Celsius; the packaging method is to package each 100ml of bait fish with a PE tube; the thawing method is to thaw it in water at room temperature 1 hour in advance; Furthermore, the feed is an expanded slow-sinking feed with a diameter of 0.5 mm and a length of 0.6-0.8 cm. The feeding method is to feed slowly at a fixed location so that the mandarin fish always stay in a state of rushing for food. After the mandarin fish are full, the clustering effect will be automatically reduced. Furthermore, before feeding, the extruded feed is mixed with 10% of attractant liquid to allow it to fully absorb the liquid, which softens the feed and increases its attractant effect. Furthermore, the attractant is composed of: 4 parts of fish slurry, 2 parts of fruit acid, 2 parts of cuttlefish paste, 2 parts of betaine, and some water. After the attractant is mixed in proportion, it is stirred into a homogenous slurry and frozen in a -20°C refrigerator. When used, it is thawed, diluted with some water, and then fully mixed with the feed so that the attractant is completely absorbed by the feed. Furthermore, the specific mixing ratio of chilled bait fish and puffed feed in different acclimation stages is as follows: in the first stage, all fresh dead bait fish are used; in the second stage, all chilled bait fish are used; in the third stage, chilled bait fish and puffed feed are mixed in a ratio of 2:1; in the fourth stage, chilled bait fish and puffed feed are mixed in a ratio of 1:2; in the fifth stage, all puffed feed is used; Furthermore, based on the monitoring results of artificial intelligence technologies such as water quality monitoring technology, behavior monitoring technology, and immune monitoring technology, the feeding amount, domestication process, and water quality are adjusted.

[0006] An artificial intelligence technology that uses water quality detection technology to detect water quality parameters in real time and dynamically adjust the amount of feed fed; uses visual recognition technology to analyze feeding behavior, determine the feeding status and domestication degree of mandarin fish, and thus control the progress of domestication; uses visual recognition technology to analyze mandarin fish characteristics, determine the metabolic status and immune status of mandarin fish, and thus control the progress of domestication; It also includes feeding behavior monitoring technology and immune status monitoring technology; (1) Feeding behavior monitoring technology: Videos are taken by cameras and pictures are generated, which are uploaded to computers for behavioral analysis. By analyzing the clustering situation and feeding activity of mandarin fish, the feeding status of mandarin fish is determined to adjust the domestication steps.

[0007] After taking photos at a fixed angle of view, the photos are divided into small blocks of unit area and compared with the BGR standard black (0,0,0), the relative area of ​​black in the photo is calculated, and the aggregation effect of fish and the situation of competing for food are determined.

[0008] The fish aggregation effect is determined by taking photos from a plane perspective and calculating with the following formula: Assume that the unit area is 1, divided into n color blocks, the contrast value with the standard color block is v, and the relative area of ​​black is S= , when the standard clustering degree is set according to the sample data, the relative area of ​​black is S 0 , we get the clustering rate of mandarin fish G = S / S 0 , the clustering rate peak exceeded 80%, indicating that domestication could enter the next stage.

[0009] The method for judging the food snatching situation is to calculate the relative aggregation volume after processing two photos from a plane perspective and a vertical perspective in the above manner. Suppose the relative black area of ​​the plane perspective photo is S. P , the relative black area of ​​the vertical viewing angle photo is SV, and the relative aggregation volume is V=S P ×S V , according to the sample data, the relative aggregation volume is set to V when the standard predation degree is set 0 , the feeding activity of mandarin fish is obtained as H=V / V 0 , the feeding activity peak exceeds 80%, indicating that domestication can enter the next stage; (2) Immune status monitoring technology: Video is shot by a camera and pictures are generated, which are uploaded to a computer for comparative analysis of body color. By evaluating the degree of deepening of the mandarin fish's body color, the metabolic and immune status of the mandarin fish can be judged to adjust the domestication progress and feeding amount.

[0010] After taking photos at a fixed angle, the position of the mandarin fish is identified and the picture is captured, which is then compared with the body color of a healthy mandarin fish to determine its health status through the comparison value.

[0011] The specific calculation method is as follows: According to the sample data, the body color value of healthy mandarin fish is I0, and when the body color contrast value of the target fry is I / I 0 When the color contrast value is less than or equal to 1.25, normal feed intake should be adopted; when the color contrast value I / I 0 When the body color contrast value is greater than 1.25 and less than 1.5, the feeding amount is halved and metabolism-promoting and immune-enhancing drugs are used in combination; when the body color contrast value is I / I 0 When the value is greater than or equal to 1.5, stop eating and use metabolism-promoting and immune-enhancing drugs; (3) Water environment monitoring technology: The water quality indicators are set as follows: dissolved oxygen is A, ammonia nitrogen is B, nitrite is C, and water temperature is D. The standard range of water quality indicators is as follows: A is between 7 and 10, B is between 0 and 0.1, C is between 0 and 0.2, and D is between 24-26℃.

[0012] Furthermore, when any water quality indicator exceeds the standard range, the water quality monitoring technology will automatically alarm and the indicator light under the corresponding index will turn red. At this time, it is necessary to change the water to improve the water quality, adjust the oxygen supply to ensure the dissolved oxygen demand, or adjust the water source heat pump to balance the water temperature.

[0013] A special expanded feed for juvenile mandarin fish, the proportions of the ingredients are as follows: 40 parts of imported white fish meal, 20 parts of shrimp meal, 20 parts of hydrolyzed fish protein, 3 parts of microcrystalline cellulose, 3 parts of attractant, 3 parts of adhesive, 5 parts of fish oil, 3 parts of soybean oil, 1 part of soybean lecithin, 1 part of vitamin premix, and 1 part of mineral premix; The vitamin premix is ​​prepared from the following raw materials in parts by weight: vitamin premix: 120 parts of choline, 50 parts of inositol, 25 parts of niacin, 25 parts of vitamin E, 25 parts of vitamin C, 20 parts of bile acid, 5 parts of vitamin D, 5 parts of pantothenic acid, 5 parts of vitamin A, 3 parts of vitamin B6, 2.5 parts of riboflavin, 1.5 parts of thiamine, 1.2 parts of vitamin K, 1 part of folic acid, 0.5 parts of biotin, and 0.3 parts of vitamin B12; Further, the mineral premix is ​​prepared from the following raw materials in parts by weight: 180 parts of compound amino acid iron, 85 parts of compound amino acid zinc, 35 parts of compound amino acid manganese, 20 parts of calcium hydrogen phosphate, 12 parts of compound amino acid copper, 2 parts of compound amino acid potassium, 0.5 parts of compound amino acid selenium, 1 part of compound amino acid magnesium, 5 parts of compound amino acid iodine, 0.5 parts of compound amino acid cobalt, and 1 part of sodium chloride; The carrier of the vitamin premix is ​​defatted rice flour, and the carrier of the mineral premix is ​​zeolite powder; The adhesive is composed of the following ingredients in the following proportions: 60 parts of modified starch, 30 parts of sodium carboxymethyl cellulose, and 10 parts of guar gum; Furthermore, the processing steps of the juvenile fish puffed feed are as follows: all solid feed raw materials are ultrafinely crushed, and the crushed particle size can pass through a 300-mesh sieve; all raw materials are uniformly mixed (except fish oil); after mixing, the tempering is carried out, the tempering material has a moisture content of 25%, the tempering temperature is 85°C, and the tempering time is 1 hour; the feed is puffed by a twin-screw extruder at a puffing temperature of 130°C; the feed is dried after being processed and formed, the drying temperature is 110°C, the time is 20 minutes, and the moisture content is controlled between 7-8%; after the feed is dried, the fish oil is sprayed on the feed using a drum sprayer.

[0014] The material type of the juvenile fish puffed feed is a slow-sinking puffed feed with a particle size of 0.5 mm, a length of 0.8 mm, a puffing coefficient of 1.3, a settling speed of 7.5 cm / s, and the feed is stored at room temperature in a cool, ventilated, and dry environment. Compared with the prior art, the present invention has the following beneficial effects: The present invention is the first to achieve the early domestication of mandarin fish fry. Mandarin fish can be domesticated to eat artificial feed at 2-3 cm, while traditional mandarin fish domestication often starts from the juvenile stage (5-7 cm) and is domesticated to about 10 cm. The present invention solves the problem of the difficulty in supplying live bait during the mandarin fish fry breeding stage, making mandarin fish breeding at the fry stage safer and more controllable. Secondly, early feed intervention can affect the feed utilization of mandarin fish in the adult stage through epigenetics, improve the survival rate of mandarin fish feed breeding, and is conducive to the development of the mandarin fish feed breeding industry; The present invention combines artificial intelligence technology with a method for domesticating mandarin fish feed for the first time, and can more accurately control the water quality, immune status and feeding conditions of mandarin fish fry during domestication. The domestication process and domestication measures can be adjusted in a timely manner through a visualized and quantifiable method, which greatly improves the survival rate and domestication rate of mandarin fish fry in their early stages of domestication. Most of the existing expanded feeds for mandarin fish are used in the juvenile stage of mandarin fish, and their formulas do not meet the nutritional and physical property requirements of mandarin fish fry. The present invention is a groundbreaking invention of a special feed for mandarin fish fry, which has a perfect formula, good palatability, higher nutritional value and metabolic efficiency, a more balanced ratio of premixes, and higher absorption efficiency. For example, the mineral trace elements in the form of complex amino acids in the feed are the trace element form with the highest absorption efficiency at present, higher than organic trace elements and inorganic trace elements; the modified starch used in the feed is conducive to alleviating the sugar metabolism pressure of the mandarin fish liver, and the bile acid and five-yellow powder health factor added to the feed are more conducive to protecting the liver and gallbladder health of mandarin fish fry. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 It is a special domestication feed for young mandarin fish; Figure 2 Instruments for water quality testing systems; Figure 3 Camera systems for behavioral analysis; Figure 4 Camera monitors for behavioral analysis; Figure 5 A barrel for acclimating young mandarin fish; Figure 6 The graphs of appetite gene expression of juvenile mandarin fish in Example 2 and Comparative Example 2 are shown. DETAILED DESCRIPTION

[0016] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention. Example

[0017] The impact of artificial intelligence technology on the domestication rate of early domestication of juvenile fish: (1) Cultivation of centimeter-sized mandarin fish seedlings: 3 days after the mandarin fish fry emerged from the membrane, they were fed with bream water that had just broken the membrane. On the first day after they emerged from the membrane, the amount of bream water fed was twice the number of mandarin fish; on the second day after they emerged from the membrane, they continued to be fed with bream water that had just broken the membrane, and the amount fed was three times the number of mandarin fish; on the third day after they emerged from the membrane, they were fed with bream water that had emerged from the membrane for 2 days, and the amount fed was three times the number of mandarin fish; on the fourth day after they emerged from the membrane, they were fed with bream water that had emerged from the membrane for 3 days, and the amount fed was three times the number of mandarin fish; on the fifth day after they emerged from the membrane, they were fed with bream water that had emerged from the membrane for 4 days. The amount of water fed is 3 times that of mandarin fish; on the 6th day after opening, the amount of water fed to the bream that have emerged from the fibroids for 5 days and have already started feeding is 3 times that of mandarin fish; on the 7th day after opening, the amount of water fed to the bream that have emerged from the fibroids for 6 days and have already started feeding is 3 times that of mandarin fish; on the 8th day after opening, the amount of water fed to the bream that have emerged from the fibroids for 7 days and have already started feeding is 3 times that of mandarin fish; on the 9th day after opening, the amount of water fed to the bream that have emerged from the fibroids for 8 days and have already started feeding is 3 times that of mandarin fish; at this time, the mandarin fish fry grows to about 1 cm.

[0018] (2) Hanging and boxing of mandarin fish fry: The centimeter-long mandarin fish fry cultivated in the hatching ring are collected with a drag net and transferred to a hanging flower box with water. 2g of vitamin C is added to each cubic meter of water to resist stress. The fish are hung in the hanging flower box for 2 hours. The box needs to be crossed. First, all the mandarin fish are driven to one end of the cage, and then the vigorous and swimming mandarin fish fry are driven to the other end of the cage and gathered together, and transferred to the acclimation box with water.

[0019] (3) Disinfection and sterilization After being transferred, the mandarin fish fry need to be disinfected with 1.5ppm glutaraldehyde benzalkonium bromide solution to prevent bacterial diseases caused by abrasions during the transfer process.

[0020] (4) Feed domestication First, feed the juvenile mandarin fish, which are about 1 cm in length, with dead bait fish splashes. When feeding the dead fish, a nano oxygenation disk is set at the bottom of the feeding point to increase oxygen, so that the dead fish are constantly blown up by air, imitating the movement of live fish. After the mandarin fish successfully eat the dead fish, they are fed with ice-fresh bait fish instead. After the mandarin fish gather in groups to eat the ice-fresh fish, the ice-fresh fish is mixed with the extruded feed of the mandarin fish and then the proportion of live bait fish is gradually reduced until the extruded feed is completely eaten.

[0021] Furthermore, the domestication is carried out in a factory-style greenhouse. The device is a PE barrel with a diameter of 2 meters and a depth of 1.5 meters. The base color of the barrel is white. Nylon net cages are hung in the barrel for domestication. The specifications are 1*1*1 meter. The domestication density of mandarin fish is 10,000 per cubic meter of water.

[0022] Furthermore, the bait fish are breams that have opened their mouths to eat for more than 5 days after emerging from the membrane. Before feeding, the bait fish are first fed with artificial feed. After half an hour of feeding, the bait fish are collected with a dense scoop net and dehydrated to death with 10% salt water, which can also have a sterilizing effect.

[0023] Furthermore, the feed is puffed slow-sinking feed with a diameter of 0.5 mm and a length of 0.6-0.8 cm. The feeding method is to feed slowly at a fixed location so that the mandarin fish always stay in a state of competing for food. After the mandarin fish is full, the clustering effect will be automatically reduced.

[0024] Furthermore, the attractant is composed of: 4 parts of fish slurry, 2 parts of fruit acid, 2 parts of cuttlefish paste, 2 parts of betaine, and some water. After the attractant is mixed in proportion, it is stirred into a homogenous slurry and frozen in a -20°C refrigerator. When used, it is thawed, diluted with some water, and then fully mixed with the feed so that the attractant is completely absorbed by the feed.

[0025] Furthermore, the specific mixing ratios of chilled bait fish and puffed feed according to the acclimation stage are: in the first stage, all fresh dead bait fish are used; in the second stage, all chilled bait fish are used; in the third stage, chilled bait fish and puffed feed are mixed in a ratio of 2:1; in the fourth stage, chilled bait fish and puffed feed are mixed in a ratio of 1:2; in the fifth stage, all puffed feed is used.

[0026] Furthermore, based on the monitoring results of artificial intelligence technologies such as water quality monitoring technology, behavior monitoring technology, and immune monitoring technology, the feeding amount, domestication process, and water quality are adjusted.

[0027] (5) The domestication process and results are as follows: On the first day, 1 cm long mandarin fish fry were fed with fresh dead bait fish water. A nano oxygenation plate was set at the bottom of the feeding point to increase oxygen, so that the bait was constantly blown up by air, imitating the movement of live fish. The immune constant before feeding was 0.92, the clustering rate during feeding was 85%, the feeding activity was 0.62, and all water quality indicators were normal. The next day, they were fed with fresh ice bait fish; On the second day, the fish were fed with fresh dead bait, and the pre-feeding immune constant was 0.93, the clustering rate during feeding was 90%, the feeding activity was 0.91, and all water quality indicators were normal. The next day, the fish were fed with fresh frozen bait; On the third day, the fish were fed with fresh ice bait. The immune constant before feeding was 0.93, the clustering rate during feeding was 92%, the feeding activity was 0.85, and the water quality indicators were normal. The next day, the fish were fed with fresh ice bait and puffed feed in a ratio of 3:1.

[0028] On the fourth day, fresh ice bait fish and extruded feed were fed at a ratio of 2:1. The immune constant before feeding was 0.91, the clustering rate during feeding was 91%, the feeding activity was 0.52, and all water quality indicators were normal.

[0029] On the fifth day, fresh ice bait fish and puffed feed were fed at a ratio of 2:1. The immune constant before feeding was 0.88, the clustering rate during feeding was 94%, the feeding activity was 0.68, and all water quality indicators were normal.

[0030] On the sixth day, the ratio of fresh ice bait fish to puffed feed was 2:1. The immune constant before feeding was 0.89, the clustering rate during feeding was 97%, the feeding activity was 0.88, and all water quality indicators were normal. The next day, the ratio of fresh ice bait fish to puffed feed was changed to 1:2.

[0031] On the seventh day, fresh ice bait fish and puffed feed were fed at a ratio of 1:2. The immune constant before feeding was 0.86, the clustering rate during feeding was 98%, the feeding activity was 0.71, and all water quality indicators were normal.

[0032] On the eighth day, the fish were fed with ice-fresh bait fish and puffed feed at a ratio of 1:2. The immune constant before feeding was 0.84, the clustering rate during feeding was 98%, the feeding activity was 0.86, and all water quality indicators were normal. The next day, the fish were fed with puffed feed exclusively.

[0033] On the ninth day, the extruded feed was fed. Before feeding, the immune constant was 0.84, the clustering rate was 98%, and the feeding activity during feeding was 0.55. The dissolved oxygen in the water body dropped to 5.5 mg / L after 1 hour of feeding. The pure oxygen supply rate was increased in time to restore the dissolved oxygen. The nitrite in the water body reached 0.28 mg / L after 9 hours of feeding. The water quality was restored by completely changing the water first, and the daily water change volume was increased from 20% to 30%.

[0034] On the tenth day, the fish were fed with extruded feed. The immune constant before feeding was 0.72. The feeding amount was halved and immune recovery drugs were used. Specifically, five yellow powder was mixed with 5g / kg feed and multivitamins were sprinkled with 10g / m3 water. The clustering rate during feeding was 98%, the feeding activity was 0.75, and all water quality indicators were normal. On the eleventh day, the fish were fed with extruded feed. The immune constant before feeding was 0.89, the clustering rate during feeding was 98%, the feeding activity was 0.86, and all water quality indicators were normal. At this time, the domestication work had been completed. The mandarin fish could cluster to the water surface to eat the extruded feed, and their immune status was good. The domestication rate reached 75.2%.

[0035] The early domestication of juvenile mandarin fish without artificial intelligence technology includes the following steps: (4) Cultivation of centimeter-sized mandarin fish seedlings: 3 days after the mandarin fish fry emerged from the membrane, they were fed with bream water that had just broken the membrane. On the first day after they emerged from the membrane, the amount of bream water fed was twice the number of mandarin fish; on the second day after they emerged from the membrane, they continued to be fed with bream water that had just broken the membrane, and the amount fed was three times the number of mandarin fish; on the third day after they emerged from the membrane, they were fed with bream water that had emerged from the membrane for 2 days, and the amount fed was three times the number of mandarin fish; on the fourth day after they emerged from the membrane, they were fed with bream water that had emerged from the membrane for 3 days, and the amount fed was three times the number of mandarin fish; on the fifth day after they emerged from the membrane, they were fed with bream water that had emerged from the membrane for 4 days. The amount of water fed is 3 times that of mandarin fish; on the 6th day after opening, the amount of water fed to the bream that have emerged from the fibroids for 5 days and have already started feeding is 3 times that of mandarin fish; on the 7th day after opening, the amount of water fed to the bream that have emerged from the fibroids for 6 days and have already started feeding is 3 times that of mandarin fish; on the 8th day after opening, the amount of water fed to the bream that have emerged from the fibroids for 7 days and have already started feeding is 3 times that of mandarin fish; on the 9th day after opening, the amount of water fed to the bream that have emerged from the fibroids for 8 days and have already started feeding is 3 times that of mandarin fish; at this time, the mandarin fish fry grows to about 1 cm.

[0036] (5) Mandarin fish fry hanging and boxing: The centimeter-long mandarin fish fry cultivated in the hatching ring are collected with a drag net and transferred to a hanging flower box with water. 2g of vitamin C is added to each cubic meter of water to resist stress. The fish are hung in the hanging flower box for 2 hours. The box needs to be crossed. First, all the mandarin fish are driven to one end of the cage, and then the vigorous and swimming mandarin fish fry are driven to the other end of the cage and gathered together, and transferred to the acclimation box with water.

[0037] (6) Disinfection and sterilization After being transferred, the mandarin fish fry need to be disinfected with 1.5ppm glutaraldehyde benzalkonium bromide solution to prevent bacterial diseases caused by abrasions during the transfer process.

[0038] (4) Feed domestication First, feed the juvenile mandarin fish, which are about 1 cm in length, with dead bait fish splashes. When feeding the dead fish, a nano oxygenation disk is set at the bottom of the feeding point to increase oxygen, so that the dead fish are constantly blown up by air, imitating the movement of live fish. After the mandarin fish successfully eat the dead fish, they are fed with ice-fresh bait fish instead. After the mandarin fish gather in groups to eat the ice-fresh fish, the ice-fresh fish is mixed with the extruded feed of the mandarin fish and then the proportion of live bait fish is gradually reduced until the extruded feed is completely eaten.

[0039] Furthermore, the domestication is carried out in a factory-style greenhouse. The device is a PE barrel with a diameter of 2 meters and a depth of 1.5 meters. The base color of the barrel is white. Nylon net cages are hung in the barrel for domestication. The specifications are 1*1*1 meter. The domestication density of mandarin fish is 10,000 per cubic meter of water.

[0040] Furthermore, the bait fish fed are bream that have opened their mouths to eat for more than 10 days after emerging from the membrane. Before feeding, the bait fish are first fed with artificial feed. After half an hour of feeding, the bait fish are collected with a dense scoop net and dehydrated to death with 10% salt water, which can also have a sterilizing effect.

[0041] Furthermore, the feed is puffed slow-sinking feed with a diameter of 0.5 mm and a length of 0.6-0.8 cm. The feeding method is to feed slowly at a fixed location so that the mandarin fish always stay in a state of competing for food. After the mandarin fish is full, the clustering effect will be automatically reduced.

[0042] Furthermore, the attractant is composed of: 4 parts of fish slurry, 2 parts of fruit acid, 2 parts of cuttlefish paste, 2 parts of betaine, and some water. After the attractant is mixed in proportion, it is stirred into a homogenous slurry and frozen in a -20°C refrigerator. When used, it is thawed, diluted with some water, and then fully mixed with the feed so that the attractant is completely absorbed by the feed.

[0043] Furthermore, the specific mixing ratios of chilled bait fish and puffed feed according to the acclimation stage are: in the first stage, all fresh dead bait fish are used; in the second stage, all chilled bait fish are used; in the third stage, chilled bait fish and puffed feed are mixed in a ratio of 2:1; in the fourth stage, chilled bait fish and puffed feed are mixed in a ratio of 1:2; in the fifth stage, all puffed feed is used.

[0044] (5) The domestication process and results are as follows: On the first day, 1 cm long mandarin fish fry were fed with fresh dead bait fish splashes, and a nano oxygenation disk was set at the bottom of the feeding point to increase oxygen, so that the bait was constantly blown up by air, imitating the movement of live fish; On the second day, fresh dead bait fish are fed, and the bait fish can reach a higher proportion of satiation, so they are switched to feeding iced bait fish.

[0045] On the third day, fresh bait fish were fed and some juvenile mandarin fish were observed to be able to eat. On the fourth day, the fish were fed with fresh bait fish. It was observed that most of the fish were full, so the next stage was to feed fresh bait fish + puffed feed. On the fifth day, the fish were fed with fresh ice bait fish + puffed feed at a feeding ratio of 2:1. Very few mandarin fish were observed to eat the puffed feed. On the sixth day, the fish were fed with fresh ice bait fish + puffed feed at a feeding ratio of 2:1. Some mandarin fish were observed to eat the puffed feed. On the seventh day, the fish were fed with fresh ice bait fish + puffed feed at a feeding ratio of 2:1. It was observed that some mandarin fish ate puffed feed, but they all reached a state of satiation, so they were transferred to the next stage; On the eighth day, the fish were fed with fresh ice bait fish + puffed feed at a feeding ratio of 1:2. Some mandarin fish were observed to eat the puffed feed. On the ninth day, the fish were fed with fresh ice bait fish and puffed feed at a feeding ratio of 1:2. It was observed that most of the mandarin fish ate the puffed feed and reached satiation, and then entered the next stage. On the tenth day, the fish were fed with extruded feed. It was observed that most of the fish ingested the extruded feed, but a few of them were full. On the eleventh day, the extruded feed was fed and it was observed that most of the mandarin fish ingested the extruded feed and some of them reached satiation. On the twelfth day, the fish were fed with extruded feed. It was observed that most of the fish had eaten the extruded feed, some of them were full, and some of them swam to the edge or floated to the surface. On the thirteenth day, the fish were fed with extruded feed. It was observed that the feeding activity of the mandarin fish was poor. Only a few of them ate the extruded feed, and the number of deaths increased significantly. The fish were stopped from feeding for one day and soaked in health-care drugs, specifically 5g / kg of five-yellow powder mixed with feed and fed, and 10g / m3 of multivitamin in water, which was dissolved in water and sprayed.

[0046] On the fourteenth day, stop eating and take 10g / m3 of multivitamin B, dissolve it in water and sprinkle it on the water.

[0047] On the fifteenth day, the fish were fed with extruded feeds, and it was observed that the feeding activity of the fish recovered. Most of the fish ate the extruded feeds, and some of them reached satiation. On the sixteenth day, the fish were fed with puffed feed. It was observed that most of the fish could consume the puffed feed and most of them reached satiation. At this time, the domestication work was completed and the domestication rate was 33.2%. Example

[0048] Effects of extruded feed for juvenile fish on acclimation rate, growth, digestion and antioxidant capacity: (1) Cultivation of centimeter-sized mandarin fish seedlings: 3 days after the mandarin fish fry emerged from the membrane, they were fed with bream water that had just broken the membrane. On the first day after they emerged from the membrane, the amount of bream water fed was twice the number of mandarin fish; on the second day after they emerged from the membrane, they continued to be fed with bream water that had just broken the membrane, and the amount fed was three times the number of mandarin fish; on the third day after they emerged from the membrane, they were fed with bream water that had emerged from the membrane for 2 days, and the amount fed was three times the number of mandarin fish; on the fourth day after they emerged from the membrane, they were fed with bream water that had emerged from the membrane for 3 days, and the amount fed was three times the number of mandarin fish; on the fifth day after they emerged from the membrane, they were fed with bream water that had emerged from the membrane for 4 days. The amount of water fed is 3 times that of mandarin fish; on the 6th day after opening, the amount of water fed to the bream that have emerged from the fibroids for 5 days and have already started feeding is 3 times that of mandarin fish; on the 7th day after opening, the amount of water fed to the bream that have emerged from the fibroids for 6 days and have already started feeding is 3 times that of mandarin fish; on the 8th day after opening, the amount of water fed to the bream that have emerged from the fibroids for 7 days and have already started feeding is 3 times that of mandarin fish; on the 9th day after opening, the amount of water fed to the bream that have emerged from the fibroids for 8 days and have already started feeding is 3 times that of mandarin fish; at this time, the mandarin fish fry grows to about 1 cm.

[0049] (2) Hanging and boxing of mandarin fish fry: The centimeter-long mandarin fish fry cultivated in the hatching ring are collected with a drag net and transferred to a hanging flower box with water. 2g of vitamin C is added to each cubic meter of water to resist stress. The fish are hung in the hanging flower box for 2 hours. The box needs to be crossed. First, all the mandarin fish are driven to one end of the cage, and then the vigorous and swimming mandarin fish fry are driven to the other end of the cage and gathered together, and transferred to the acclimation box with water.

[0050] (3) Disinfection and sterilization After being transferred, the mandarin fish fry need to be disinfected with 0.5ppm glutaraldehyde benzalkonium bromide solution to prevent bacterial diseases caused by abrasions during the transfer process.

[0051] (4) Domestication of juvenile fish The same domestication method as in Example 1 was adopted, using a special expanded feed for juvenile fish, and the domestication rate was 72.6% at the end of the domestication.

[0052] (5) Sampling and testing After acclimation, the fish were starved for 8 hours, and 20 fish were randomly selected and anesthetized with MS-222 to measure their body length and weight. 18 fish were randomly selected and frozen with liquid nitrogen and divided into 6 parallel groups, with 3 fish in each group, for the detection of digestive enzyme and antioxidant enzyme activities. The digestive enzyme and antioxidant enzyme detection kits were from Nanjing Jiancheng. 18 fish were randomly selected and frozen with liquid nitrogen and divided into 6 parallel groups, with 3 fish in each group, for the detection of growth, metabolism and antioxidant related genes.

[0053] Comparative Example 2 Effects of commercial extruded feed on domestication rate, growth, digestion and antioxidant capacity: (1) Cultivation of centimeter-sized mandarin fish seedlings: 3 days after the mandarin fish fry emerged from the membrane, they were fed with bream water that had just broken the membrane. On the first day after they emerged from the membrane, the amount of bream water fed was twice the number of mandarin fish; on the second day after they emerged from the membrane, they continued to be fed with bream water that had just broken the membrane, and the amount fed was three times the number of mandarin fish; on the third day after they emerged from the membrane, they were fed with bream water that had emerged from the membrane for 2 days, and the amount fed was three times the number of mandarin fish; on the fourth day after they emerged from the membrane, they were fed with bream water that had emerged from the membrane for 3 days, and the amount fed was three times the number of mandarin fish; on the fifth day after they emerged from the membrane, they were fed with bream water that had emerged from the membrane for 4 days. The amount of water fed is 3 times that of mandarin fish; on the 6th day after opening, the amount of water fed to the bream that have emerged from the fibroids for 5 days and have already started feeding is 3 times that of mandarin fish; on the 7th day after opening, the amount of water fed to the bream that have emerged from the fibroids for 6 days and have already started feeding is 3 times that of mandarin fish; on the 8th day after opening, the amount of water fed to the bream that have emerged from the fibroids for 7 days and have already started feeding is 3 times that of mandarin fish; on the 9th day after opening, the amount of water fed to the bream that have emerged from the fibroids for 8 days and have already started feeding is 3 times that of mandarin fish; at this time, the mandarin fish fry grows to about 1 cm.

[0054] (2) Hanging and boxing of mandarin fish fry: The centimeter-long mandarin fish fry cultivated in the hatching ring are collected with a drag net and transferred to a hanging flower box with water. 2g of vitamin C is added to each cubic meter of water to resist stress. The fish are hung in the hanging flower box for 2 hours. The box needs to be crossed. First, all the mandarin fish are driven to one end of the cage, and then the vigorous and swimming mandarin fish fry are driven to the other end of the cage and gathered together, and transferred to the acclimation box with water.

[0055] (3) Disinfection and sterilization After being transferred, the mandarin fish fry need to be disinfected with 0.5ppm glutaraldehyde benzalkonium bromide solution to prevent bacterial diseases caused by abrasions during the transfer process.

[0056] (4) Domestication of juvenile fish The same domestication method as in Example 1 was adopted, using common commercial mandarin fish puffed feed, and the domestication rate was 51.5% at the end of the domestication.

[0057] (5) Sampling and testing After acclimation, the fish were starved for 8 hours, and 18 fish were randomly selected, with 3 fish in each parallel group. They were anesthetized with MS-222, and their body length and weight were measured. 36 fish were randomly selected and frozen with liquid nitrogen, with 6 fish in each parallel group, for the detection of digestive enzyme and antioxidant enzyme activities. The digestive enzyme and antioxidant enzyme detection kits were all from Nanjing Jiancheng.

[0058] 1. Data and analysis The data recorded in the above Example 2 and Comparative Example 2 are calculated according to the following calculation method: (1) Growth performance Before sampling, the mandarin fish were starved for 24 h and anesthetized with MS-222 (50 mg L -1 ), measure body weight and length. Calculate weight gain rate, specific growth rate and feed conversion rate.

[0059] Weight gain rate (WGR) (%) = (W2-W1) / W1 × 100, W1: initial weight, W2: final weight; Specific growth rate (SGR) (%) = 100 × (lnW2 - lnW1) / time (days); W1: initial weight, W2: final weight; Feed conversion ratio (FCR) (%) = 100 × food intake / weight gain; (2) Enzyme activity detection The activities of amylase, protease, lipase, superoxide dismutase, catalase, and malondialdehyde were detected using commercial kits from Nanjing Jiancheng.

[0060] (3) Fluorescence quantitative PCR Total RNA was extracted from tissues using Trizol reagent (TaKaRa, Tokyo, Japan). The RNA content and quality were tested on an Eppendorf Biophotometer Plus instrument to ensure that the A260 / A280 value of RNA was above 2.0. RNA was reverse transcribed using PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa, Tokyo, Japan). 1 μg of RNA was incubated at 37°C for 15 min and 85°C for 5 sec to obtain cDNA in a final volume of 20 μL.

[0061] Real-time quantitative PCR reactions were performed on a quantitative thermal cycler (CFX Connect Real-Time System, BIO-RAD, Hercules, CA, USA). This experiment detected the mRNA levels of protein catabolism-related genes gdh, ast, alt, sugar metabolism-related genes g6p, gk, lipid metabolism-related genes srebp1, acc1, fas, pparα, cpt-1, hsl, lpl, and the quantitative primer sequences of the key genes gh and igf-1 of the GH / IGF axis are shown in Table 2-3. The reaction system was: 10μL AcEQ® qPCR SYBR® Green Master Mix (Nanjing Novogene Biotechnology Co., Ltd., Nanjing, China), 1μL cDNA and 0.2 μM upstream and downstream primers, with a total volume of 20 μL. PCR reaction parameters were as follows: 94 °C pre-denaturation for 5 min; 94 °C denaturation for 10 sec, annealing at an appropriate temperature for 30 sec, two cycles for 40 times; melting curve (decreasing from 95 °C to 65 °C at a rate of 0.5 °C / s, collecting data signals every 6 sec). PCR primer amplification efficiency ranged from 95% to 105.0%.

[0062] Table 2-3 Fluorescence quantitative PCR primer information

[0063] Gene Name Primers Sequence 5′-3′ Annealing temperature Tm (°C) rpl13a-F CACCCTATGACAAGAGGAAGC 59 rpl13a-R TGTGCCAGACGCCCAAG GDH-F GACGACGACCCCAACTTCT 57 GDH-R GACCCGCTTCCTCTTCTGC GH-R GGTCTCCACCTTGTGCATGTCTT IGF-F TTCAAGAGTGCGATGTGCT 60 IGF-R TTGCCGTCGGAGTCAGG The gene expression level was relative to the internal reference gene expression level using 2 -ΔΔCt The method was used for calculation (Livak and Schmittgen 2001). Each cDNA sample was amplified three times. The data were calculated using CFX ManagerTMsoftware (Version 1.0). The ΔCt value of each sample was subtracted from the calibration value to obtain the ΔΔCt. The gene expression level was calculated using 2 -ΔΔCtThe values ​​were expressed as multiples relative to the set control group value. Gene expression was expressed as multiples relative to the calibration value, and the calibration value unit was 1 arbitrary unit.

[0064] The above recorded data are analyzed according to the following calculation method: The experimental data were analyzed using one-way analysis of variance (SPSS25.0). The data were expressed as mean ± standard deviation. The Duncan method was used for multiple comparisons between groups, and the significance level was set at 0.05.

[0065] 1. Experimental results (1) The growth performance and acclimation rate of mandarin fish in Example 2 and Comparative Example 2 are shown in Table 1. The final weight, weight gain rate and acclimation rate of mandarin fish fry under the conditions of Example 2 were significantly higher than those of mandarin fish fry under the conditions of Comparative Example 2. There was no significant difference in the initial weight, specific growth rate and feed coefficient between the two.

[0066] Table 1 Comparison of growth performance of Example 2 and Comparative Example 2 project Example 2 Comparative Example 2 Initial body weight / mg 43.28±1.45 42.76±1.13 Final body weight / mg <![CDATA[515.74±14.36 a ]]> <![CDATA[431.74±11.15 b ]]> Weight gain rate / % <![CDATA[1197.68±24.12 a ]]> <![CDATA[1012.91±27.95 b ]]> Specific growth rate / % 2.49±0.02 2.30±0.03 Feed coefficient 2.88±0.15 3.39±0.19 Domestication rate / % <![CDATA[72.6±2.37 a ]]> <![CDATA[51.5±2.05 b ]]> (2) The digestive enzyme activities of the juvenile mandarin fish of Example 2 and Comparative Example 2 are shown in Table 1. The intestinal lipase and trypsin activities of the juvenile mandarin fish under the conditions of Example 2 were significantly higher than those of the juvenile mandarin fish under the conditions of Comparative Example 2.

[0067] Table 2 Comparison of digestive enzyme activity between Example 2 and Comparative Example 2 project Example 2 Comparative Example 2 Amylase 0.04±0.00 0.04±0.01 Lipase <![CDATA[0.21±0.01 a ]]> <![CDATA[0.12±0.01 b ]]> Trypsin <![CDATA[0.83±0.02 a ]]> <![CDATA[0.67±0.03 b ]]> (3) The antioxidant enzyme activities of the juvenile mandarin fish of Example 2 and Comparative Example 2 are shown in Table 1. The catalase activity of the juvenile mandarin fish under the conditions of Example 2 was significantly higher than that of the juvenile mandarin fish under the conditions of Comparative Example 2, and the malondialdehyde activity was significantly lower than that of the juvenile mandarin fish under the conditions of Comparative Example 2.

[0068] Table 3 Comparison of antioxidant enzyme activity between Example 2 and Comparative Example 2 project Example 2 Comparative Example 2 SOD 18.36±2.37 15.81±3.11 CAT <![CDATA[7.37±0.24 a ]]> <![CDATA[5.11±0.16 b ]]> MDA <![CDATA[2.24±0.05 a ]]> <![CDATA[3.66±0.07 b ]]> (4) The expression of appetite genes in juvenile mandarin fish of Example 2 and Comparative Example 2 is as follows Figure 6 As shown. The expression levels of npy and agrp genes in juvenile mandarin fish under the conditions of Example 2 were significantly higher than those in juvenile mandarin fish under the conditions of Comparative Example 2. 3. Experimental conclusion The above experimental results show that: The use of the puffed feed for fry acclimation of mandarin fish in the present invention can significantly improve the growth performance of fry fry, promote the secretion of intestinal digestive enzymes, and effectively improve the antioxidant capacity of fry fry. In addition, the attractant in the puffed feed for fry fry of mandarin fish in the present invention can significantly promote the expression of central appetite genes npy and agrp, and ultimately lead to a significant improvement in the acclimation rate.

[0069] In the description of this specification, the description with reference to the term "specific embodiment" or the like means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representation of the above terms does not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art may combine and combine the different embodiments or examples described in this specification and the features of the different embodiments or examples, without contradiction.

Claims

1. A method for early domestication of juvenile mandarin fish based on artificial intelligence technology, characterized in that: When the juvenile mandarin fish is 1 cm long, it is domesticated in a factory greenhouse with fresh ice bait fish and extruded feed specially for mandarin fish under the background of artificial intelligence technology. When the juvenile mandarin fish is 2-3 cm long, feed domestication is completed; The bait conversion process is dead bait fish splash, ice-fresh bait fish splash, and special puffed feed for juvenile fish. The ice-fresh bait fish used is bream splash that has been out of the membrane for 10 days.

2. The method for early domestication of juvenile mandarin fish based on artificial intelligence technology according to claim 1, characterized in that: The domestication is carried out in a factory-scale circulating water temperature shed. The device is a PE barrel with a diameter of 2 meters and a depth of 1.5 meters. The bottom color of the barrel is white. A nylon net cage is hung inside the barrel for domestication. The specification is 1*1*1 meter. The domestication density of mandarin fish is 10,000 per cubic meter of water. The bait fish is bream fish that has been out of the film for 10 days. The storage condition of the fresh fish is below -20 degrees Celsius. The packaging method is to package each 100ml of bait fish with a PE tube. The thawing method is to melt it in water at room temperature 1 hour in advance. The feed is puffed slow-sinking feed with a diameter of 0.5 mm and a length of 0.6-0.8 cm. The feeding method is to feed slowly at a fixed location so that the mandarin fish always stay in a state of rushing for food. After the mandarin fish are full, they will automatically reduce the clustering effect. Before feeding the extruded feed, mix it with 10% attractant liquid to allow it to fully absorb the liquid, which will soften it and increase its attractant effect.

3. The artificial intelligence technology according to claim 1, characterized in that: Water quality detection technology is used to detect water quality parameters in real time and dynamically adjust the feed amount; visual recognition technology is used to analyze feeding behavior, determine the feeding status and domestication degree of mandarin fish, and thus control the progress of domestication; visual recognition technology is used to analyze mandarin fish characteristics, determine the metabolic status and immune status of mandarin fish, and thus control the progress of domestication; It also includes feeding behavior monitoring technology, immune status monitoring technology and water environment monitoring technology.

4. The special expanded feed for juvenile mandarin fish according to claim 1, characterized in that: The proportions of each ingredient are as follows: 40 parts of imported white fish meal, 20 parts of shrimp meal, 20 parts of hydrolyzed fish protein, 3 parts of microcrystalline cellulose, 3 parts of attractant, 3 parts of adhesive, 5 parts of fish oil, 3 parts of soybean oil, 1 part of soybean lecithin, 1 part of vitamin premix, and 1 part of mineral premix.

5. The appetite attractant according to claim 4, characterized in that The proportions of the ingredients are as follows: 4 parts of fish paste, 2 parts of fruit acid, 2 parts of cuttlefish paste, and 2 parts of betaine.

6. The special expanded feed for juvenile mandarin fish according to claim 4, characterized in that: The mineral premix is ​​prepared from the following raw materials in parts by weight: 180 parts of complex amino acid iron, 85 parts of complex amino acid zinc, 35 parts of complex amino acid manganese, 20 parts of calcium hydrogen phosphate, 12 parts of complex amino acid copper, 2 parts of complex amino acid potassium, 0.5 parts of complex amino acid selenium, 1 part of complex amino acid magnesium, 5 parts of complex amino acid iodine, 0.5 parts of complex amino acid cobalt, and 1 part of sodium chloride.

7. The extruded feed for juvenile mandarin fish according to claim 4, characterized in that: The adhesive is composed of the following ingredients in the following proportions: 60 parts of modified starch, 30 parts of sodium carboxymethyl cellulose, and 10 parts of guar gum.

Images