A space-borne Flammulina velutipes strain, AVIC-9, and its application

Abstract

This application is about a space-borne Flammulina velutipes strain, AVIC 9, and its application, which belongs to the field of strain selection and breeding technology. The space-borne Flammulina velutipes strain, AVIC 9, in this application was deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration on August 29, 2024, with a deposit number of CGMCC No.41446, and was classified and named as shiitake mushroom ( Flammulina filiformis ), the deposit address is No. 3, No. 1, Beichen West Road, Chaoyang District, Beijing. Compared with the strains not carried by spaceflight, the mycelium of the AVIC No. 9 strain is vermicelli, the center of the cap is light yellow to yellow, the edge is light pink to pink, the flesh is thick, the yield is high, the texture is crisp, and the commercial properties are good, which is suitable for factory cultivation.

Description

Technical Field

[0001] The present application relates to the technical field of strain breeding, and in particular to a space-borne Flammulina velutipes strain, AVIC-9, and its application. Background Art

[0002] Flammulina velutipes is a type of winter mushroom ( Enoki mushroom ) is a trade name for a mushroom of the order Agaricaceae ( Agaricales ) Physalacriaceae ) Flammulina ), also known as winter mushroom, hairy money mushroom, etc. Flammulina velutipes is delicious and nutritious. It is rich in essential amino acids, vitamins, unsaturated fatty acids, fungal polysaccharides, flavonoids, terpenes, glycosides and phenolic compounds, etc. It has certain therapeutic effects in lowering blood pressure, anti-oxidation and delaying aging.

[0003] Breeding Flammulina velutipes with different colors, tastes and commercial traits has always been pursued by technicians in this field and has great application value. Summary of the invention

[0004] The present application provides a Flammulina velutipes strain, AVIC 9, which has the characteristics of vermicelli mycelium, light yellow to yellow in the center of the cap, light pink to pink at the edge, thick flesh, high yield, crisp texture, good commercial properties and suitability for factory cultivation.

[0005] The Flammulina velutipes strain Zhonghang 9 in this application was deposited in the General Microbiological Center of China Microbiological Culture Collection Administration on August 29, 2024, with the deposit number CGMCC No.41446, and the classification name is Shiitake mushroom ( Flammulina filiformis ), the storage address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0006] Specifically, the new strain of Flammulina velutipes, Zhonghang 9, in the present application is obtained by the following breeding method:

[0007] First, we collected wild Flammulina velutipes fruiting bodies in Longling, Yunnan on August 21, 2014, and obtained a pure strain (Liu 682) through tissue separation and purification. The Liu 682 strain was amplified and identified using universal fungal ITS primers (ITS4 / ITS5). The identification result was Flammulina velutipes ( Enoki mushroom The Liu 682 strain was selected through the general primary screening, secondary screening, regional test and production test of edible fungi to produce a strain for space travel (number S14-1).

[0008] On June 17, 2021, the Flammulina velutipes strain numbered S14-1 was carried into space by the Shenzhou XII manned spacecraft, and returned to the ground on September 17, 2021 with the Shenzhou XII manned spacecraft; the S14-1 strain was activated, the activated mycelium was ground, the single root fragments were separated and cultured to obtain S14.101~S14.1300; further screening was carried out according to the conventional breeding methods for edible fungi, and the excellent strain with vermicelli mycelium, light yellow to yellow center of the cap, light pink to pink edges, thick flesh, high yield, crisp texture, good commercial traits, suitable for factory cultivation was obtained, and was numbered AVIC No. 9.

[0009] The present application also provides an application of the above-mentioned Flammulina velutipes strain Zhonghang 9 in the commercial production of Flammulina velutipes. The Flammulina velutipes strain Zhonghang 9 provided in the present application is applied to the factory production of Flammulina velutipes, which has good commercial properties, crisp texture and high yield, and has broad application prospects.

[0010] The beneficial effects of this application are:

[0011] Compared with the strain S14-1 that was not cultivated on space flight, the mycelium of the AVIC No. 9 strain is vermicelli, the center of the cap is light yellow to yellow, the edge is light pink to pink, the flesh is thick, the yield is high, the texture is crisp, and the commercial properties are good. It has great application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] The above and other objects, features and advantages of the present application will become more apparent through a more detailed description of exemplary embodiments of the present application in conjunction with the accompanying drawings, wherein the same reference numerals generally represent the same components in the exemplary embodiments of the present application.

[0013] Figure 1 This is a schematic diagram of the morphology of the strain Zhonghang 9 obtained in Example 1 of the present invention;

[0014] Figure 2 It is a schematic diagram of the morphology of wild Flammulina velutipes HKAS 85822 in Example 1 of the present invention. DETAILED DESCRIPTION

[0015] The embodiments of the present application will be described in more detail below with reference to examples. Although the embodiments of the present application are shown in the examples, it should be understood that the present application can be implemented in various forms and should not be limited by the embodiments set forth herein. On the contrary, these embodiments are provided to make the present application more thorough and complete, and the scope of the present application can be fully communicated to those skilled in the art.

[0016] Example 1

[0017] This example illustrates the breeding process of Flammulina velutipes strain Zhonghang 9, and the specific steps are as follows:

[0018] (1) Wild Flammulina velutipes fruiting bodies were collected in Longling, Yunnan on August 21, 2014. The specimen is HKAS85822. Figure 2 As shown, a pure strain (Liu 682) was obtained through tissue separation and purification. The strain was amplified and identified using universal fungal ITS primers (ITS4 / ITS5), and the identification result was Flammulina velutipes ( Enoki mushroom ).

[0019] (2) The Liu 682 strain was selected through general primary screening, secondary screening, regional testing and production testing for edible fungi to produce a strain suitable for space travel (number S14-1).

[0020] (3) The S14-1 Flammulina velutipes strain was carried into space on the Shenzhou XII spacecraft on June 17, 2021. It returned to the ground in the Shenzhou XII manned spacecraft on September 17, 2021. After notarization, it was brought back to the Culture Collection Center of the Kunming Institute of Botany, Chinese Academy of Sciences for relevant research.

[0021] (4) The space-borne strain S14-1 was activated, the activated mycelium was ground, and the single root fragments were separated and cultured to obtain S14.101~S14.1300.

[0022] (5) With reference to GB / T 21125-2007 Technical Specifications for Breeding of Edible Fungi, further screening was carried out according to conventional breeding methods for edible fungi, and an excellent strain with vermicelli mycelium, light yellow to yellow in the center of the cap, light pink to pink on the edge, thick flesh, high yield, crisp texture and good commercial properties was obtained, which was numbered as Zhonghang No. 9. The strain was preserved in the Kunming Institute of Botany, Chinese Academy of Sciences (KUNCC) using the 10% glycerol + distilled water preservation method.

[0023] (6) Flammulina velutipes strain Zhonghang 9 was deposited in the General Microbiology Center of China Microbiological Culture Collection Administration on August 29, 2024, with the deposit number: CGMCC No.41446, and the classification name is Agaricus velutipes ( Flammulina filiformis ), the storage address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0024] The characteristics of the Flammulina velutipes strain Zhonghang 9 in this embodiment are as follows:

[0025] 1. Morphological characteristics

[0026] The fruiting body is medium-sized. The cap is 2 to 4 cm in diameter, convex to flat; the surface is smooth, shiny, greasy, light yellow to yellow in the center, light pink to pink at the edge, thick light yellow to flesh-colored, highly absorbent, semi-sticky to sticky when wet, with raw, dense, light pink, and uniform edges; the petiole is medium-born, 5 to 15 × 0.2 to 0.6 cm, nearly cylindrical, nearly equal in width, slightly narrowed upward, pink near the tip, gradually turning white downward, densely covered with white velvety hairs. Figure 1 shown.

[0027] 2. Cultivation and cultivation conditions

[0028] 1) Mycelium culture: After inoculation, the cultivation bag is sealed with conventional edible mushroom tape and cultured in a dark environment at an air temperature of 25°C and an air humidity of 65% for 7 to 10 days to prepare for fruiting.

[0029] 2) Management of mushroom production: After 7-10 days of mycelium cultivation, remove the sealing glue, maintain the temperature of the mushroom house at 16-21°C, the relative humidity of the air at 90-92%, the carbon dioxide concentration at 450-550ppm, the light intensity at 250lx, the light at 20min / h, and harvest in time when the fruiting body diameter reaches 5-15cm.

[0030] 3. Genetic characteristics

[0031] The genomic DNA of Flammulina velutipes strain Zhonghang 9 was first amplified and sequenced using the universal primers ITS4 / ITS5 for fungi to obtain the following molecular fragments. The DNA sequence bases are shown in SEQ ID NO.3, specifically:

[0032] ATGAACTTTGAACTGCTTGTGGCTCTTTAGGCTGTTGCTGACGAGGACCTTCACGGGTTCTTCGTACGTGCACGTCTGGGGTTGCAGCTTTCTTCGTCCACCTGTGCACACTCTGTAGGTCTGGATACCCCATTGGAAGGGTGCGCTTTTTGCGCTCCCCTTTGCCTTCCAGGCCTATGTCTTATAA ACACTATAGTATGTAACGAATGTCATTGATTATTGGACTTCACTGTCCTTAAACTAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGT ACTCCGAAGGGCATGCCTGTTTGAGTGTCAGTAACTTCTCAACCTCCCTCACTTTGTTGTGAGCTGGCGGATTGGACTGGGGGCTTGCTGGACCCTTATCTTTGGGTTCAGCTCCCCTGAAATGCATTAGCAGAAACCGTTACCTTTTGGCGCGCTGCAGCTGTGATAATTATCTACGGCTATGG CTGGGCTGACTGTGTTGTAGCGCTCGTCTCGTCTCTGAAGTGGTTTCGCCTTAGCTGGTGCTTCCCTTTGCCTTCTCTCACGAGAGATACCTGTGACGCGAGTGCGCGGGCTATTCCGCTTCTAACCGTCCCCTTGTGGGACAACTATTGACCATTTGACCTCAAATCAGGTAGGACTACCCGT

[0033] The fragment was sequenced through GenBank, and the result was 100% homologous to the Flammulina velutipes in the database, gene accession number (MN606263). The Flammulina velutipes strain Zhonghang 9 was identified as Flammulina velutipes ( Enoki mushroom ).

[0034] Subsequently, the genome of the Flammulina velutipes strain Zhonghang 9 was sequenced using a universal fungal genome sequencing method, and shallow genome sequencing (Shallow Whole Genome Sequencing) and primer design were performed with reference to existing technologies to obtain the following specific primers:

[0035] Primer_ZH9_1L :5'- CTCCATACGCCAAACAACAG-3'

[0036] Primer_ZH9_1R: 5'-TTCATGGGAATTTACTGCCG-3'

[0037] Primer_ZH9_2L :5'-ACGCTCAAGTTTGCTATTGT-3'

[0038] Primer_ZH9_2R: 5'- GGACGAGACGCCGACAAC-3'

[0039] Specific gene detection was performed on the strain Zhonghang 9 selected after the space flight of the Shenzhou XII-IV manned spacecraft, the strain not carried on board, and the common Flammulina velutipes in the market. During amplification, primers Primer_ZH9_1L / Primer_ZH9_1R or Primer_ZH9_2L / Primer_ZH9_2R were added to the corresponding amplification system, and the reaction was detected by 2% agarose gel electrophoresis after the reaction was completed.

[0040] The amplification system included: PCR Buffer 1×, MgCl2 1.50 mM, dNTPs Mix 0.25 mM, primers 1.00 mM each, rTaq Polymerase 1.5 U, and template DNA 50 ng; the reaction conditions were: pre-denaturation at 95°C for 3 min, followed by 95°C for 60 s, 52°C for 40 s, and 72°C for 30 s, for 35 cycles; and finally extension at 72°C for 10 min.

[0041] The sequencing of the PCR amplification reaction products was sent to Beijing Biotech Biotechnology Co., Ltd., Shanghai Shenggong Bioengineering Technology Service Co., Ltd. and Yingjun Biotechnology Co., Ltd. The sequencer used for sequencing was ABI3730 DNA sequencer, and the sequencing primers were the same as the PCR amplification primers.

[0042] Specifically, during PCR amplification, specific DNA fragments of approximately 205 bp and 213 bp in size were obtained, and their DNA sequence bases were shown in SEQ ID NO.1 and SEQ ID NO.2, respectively.

[0043] Specifically, SEQ ID NO.1 is specifically:

[0044] TGGTCTTTTGACAGCTTCGGTTCGTCCATATGCGTCCATTAGGTCCGCCAGCAAACACTCCATACGCCAAACAACAGGACTGCGACCATAATTATCGCTGCGAAAGGGATCGCTACCGCATATAAGTATCCTAAAA ACGGACAGTCGCCTATGAGTGCAAGATGCTACAGCAGCCAGGGAGACGCACCATCCAGCGAGTATCCTCCATTCAATGCTCCCTTCGAACAGAATTCCATAGCGAGCGGCAGTAAATTCCCATGAAACTTTGAGGAC

[0045] SEQ ID NO.2, specifically:

[0046] ATGCCTGGATGATATGCACCCTGGTGTTTGGACTTAGAATCGATCACGCTCAAGTTTGCTATTGTGTTCATCTTGGCATGCCACTACTGCTACGGTTCATTCAAGAGTCAGGTCGACTAGGCAGGACTG GGAAGCCCTCGTATTCGGTGGTTCTGCAGTACAAATGATCCACTCATCCGCCAAACGTAGAGGACGTCCATATCGCTCGGACGGAAGCGTTGGCATACGTATCGACAAAAGGTTGTCGGCGTCTCGTCCT

[0047] Only the Zhonghang No. 9 strain can obtain the above DNA sequence bases. The uninfected strains or the common Flammulina velutipes in the market cannot amplify the above DNA sequence bases.

[0048] Example 2 Cultivation Comparative Test

[0049] In this example, the Flammulina velutipes strain AVIC 9 was cultivated and compared with the strain S14-1 that was not carried on space flight, and the mycelial growth rate, growth cycle and yield per unit area of ​​the original strain and the cultivated strain of the test strain were examined.

[0050] The mother culture formula used in this embodiment is PDA culture medium commonly used for edible fungi.

[0051] The stock formula used in this embodiment is a common stock culture medium for wood-decaying fungi: 78% wheat grains, 10% sawdust, 10% wheat bran, 1% light calcium carbonate, 1% gypsum, 60% water content, pH 7 after sterilization;

[0052] The cultivation formula used in this embodiment is a common culture medium for wood-rotting fungi: 69% cottonseed hulls, 20% rice bran, 10% bran, 1% lime, 60% water content, pH 6. Each cultivation bag contains 1000g of cultivation medium.

[0053] Furthermore, the cultivation method of the Zhonghang No. 9 strain in this embodiment comprises the following steps:

[0054] 1) Preparation of mother species, original species and cultivated species: According to the general preparation method of wood-decaying fungi, the above formula is prepared into corresponding mother species, original species and cultivated species for later use.

[0055] 2) Mycelium culture: After inoculation of the mother culture, original culture and cultivated culture, culture them in a dark place at an air temperature of 25°C and an air humidity of 65% for 7 to 25 days.

[0056] 3) Mushroom management: After 18 days of mycelium cultivation, the spawn shall be managed according to the conventional Flammulina velutipes cultivation and management methods, that is, the temperature of the mushroom room shall be maintained at 15-18°C, the relative humidity of the air shall be maintained at 90-95%, the carbon dioxide concentration shall be maintained at 4000-6000ppm, the light intensity shall be maintained at 250lx, the light intensity shall be maintained at 20min / h, and the fruiting bodies shall be harvested in time when the diameter reaches 5-15cm.

[0057] It should be noted that in Example 2, when comparing the cultivation of Zhonghang No. 9 and S14-1, the only difference was the strain itself, and the other cultivation conditions were the same.

[0058] The cultivation results are shown in the following table:

[0059]

[0060] It can be seen from the above table that compared with the cultivation of strain S14-1 that was not carried by space, the mycelium growth rate of the original and cultivated strains of the AVIC No. 9 strain was fast, and the conversion rate and yield were significantly improved.

[0061] The embodiments of the present application have been described above, and the above description is exemplary, not exhaustive, and is not limited to the disclosed embodiments. Many modifications and changes will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the described embodiments. The selection of terms used herein is intended to best explain the principles of the embodiments, practical applications, or improvements to the technology in the market, or to enable other persons of ordinary skill in the art to understand the embodiments disclosed herein.

Claims

1. A space-borne Flammulina velutipes strain, AVIC No. 9, characterized in that: It was deposited in the General Microbiological Center of China Microbiological Culture Collection Administration on August 29, 2024, with the deposit number CGMCC No.41446, and the classification name was Shiitake Mushroom ( Flammulina filiformis ), the storage address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

2. An application of the strain Zhonghang 9 described in claim 1 in the production of Flammulina velutipes.

Images