Sarcocephalum rubrum protoplast, preparation method, enzymatic hydrolysate and gene efficient transient expression method

Abstract

The invention belongs to the technical field of cell biology, and particularly relates to a kok-saghyz protoplast, a preparation method, enzymatic hydrolysate and a gene efficient transient expression method, and the kok-saghyz protoplast is obtained by optimizing enzymatic hydrolysis conditions, determining optimal enzymatic hydrolysis conditions of kok-saghyz leaf and meat cell protoplast and utilizing a PEG-calcium mediated transfection technology. The activities of different promoters in the kok steppe protoplast are successfully compared, the target protein is efficiently expressed and detected, the subcellular localization of the protein is confirmed in the kok steppe protoplast, and the transcriptional activation of transcription factors and the combination condition of the promoters under physiological conditions are researched. An effective platform is provided for researching the intracellular process of kok-saghyz and illuminating a signal channel.

Description

Technical Field

[0001] The invention belongs to the field of cell biotechnology, and in particular relates to a rubber grassland bioplastid, a preparation method, an enzymatic hydrolysate and a gene efficient transient expression method. Background Art

[0002] Rubber grass (Taraxacum kok-saghyz, TKS), also known as rubber dandelion, is a perennial herb native to China and Kazakhstan. The roots of rubber grass are rich in natural rubber (up to 20% of the root dry weight), and its cis-polyisoprene composition is similar to that of traditional rubber from the Brazilian rubber tree. The roots also contain a large amount of inulin (25-40% of the root dry weight), a major storage sugar with direct value in food and non-food applications (such as fuel ethanol production). Its high rubber content, easy cultivation, strong environmental adaptability and short maturity period make it an ideal substitute for natural rubber and have important strategic significance. Although the genetic transformation of rubber grass is relatively simple, methods for rapid analysis of gene function in natural cellular environments still need to be developed.

[0003] Plant protoplasts are plant cells with enzymatic cell wall degradation, which provide a cell-based system that is ideal for manipulating signaling and metabolic pathways and gene expression in a cellular environment to study gene function and molecular mechanisms. Protoplasts with physiological environments and cell-autonomous responses have been widely used to identify key regulatory factors and intracellular signaling pathways in plant physiology, stress response, immunity, growth and development. Since the first protoplast isolation in plants more than 60 years ago, protoplast isolation and application have been established and optimized in a variety of plants, including Arabidopsis, rice, corn, wheat, soybean, tobacco, carrot, tomato, soybean, tobacco, carrot, potato, lotus root, alfalfa, salvia miltiorrhiza, camellia, apple and grape. However, few methods can isolate sufficient numbers of viable protoplasts from rubber grass. Summary of the invention

[0004] The first aspect of the present invention provides an enzymatic hydrolyzate for preparing protoplasts from rubber grass, which can efficiently and stably separate protoplasts from rubber grass.

[0005] The first aspect of the present invention adopts the following technical solution:

[0006] The invention discloses an enzymatic hydrolysate for preparing protoplasts of mesophyll cells of rubber grass. The enzymatic hydrolysate comprises KCl, CaCl2, MES, D-mannitol, cellulase R-10, macerate R-10 and beta-ME, wherein the concentration of D-mannitol is 0.4M-0.5M, the concentration of cellulase R-10 is 0.8%-1.2% (wt / vol), the concentration of macerate R-10 is 0.4%-0.8%, and the pH value is between 5.6 and 5.8.

[0007] Preferably, the concentration of β-ME is 2mM-8mM.

[0008] More preferably, the concentration of β-ME is 5 mM.

[0009] The second aspect of the present invention provides a method for preparing rubber grassland bioplastids, using the above-mentioned enzymatic hydrolyzate.

[0010] The specific preparation steps of the preparation method are as follows:

[0011] S1. Obtain fully expanded flat leaves from rubber grass plants, remove the main veins, and cut the leaves into small pieces;

[0012] S2. placing the leaf pieces into the above enzymatic hydrolysis solution for enzymatic hydrolysis to obtain a cell suspension;

[0013] S3. Collect protoplasts from the cell suspension.

[0014] Preferably, the enzymatic hydrolysis time is 3h-6h, which can produce sufficient rubber grassland bioplastids.

[0015] Preferably, before using the enzymatic hydrolysis solution, the enzyme solution containing KCl, MES, D-mannitol, cellulase R-10 and macerate R-10 is preheated, and then CaCl2 and β-ME are added to perform enzymatic hydrolysis.

[0016] More preferably, preheating is performed at 55° C. for 10 min.

[0017] The third aspect of the present invention provides rubber grassland bioplastids obtained by the above-mentioned preparation method.

[0018] The fourth aspect of the present invention provides a method for establishing a set of efficient transient gene expression based on rubber grassland bioplastids, comprising the following steps:

[0019] 1. Purify the above-mentioned rubber grassland bioplastids;

[0020] 2. Mix the purified rubber grassland bioplastids with the recombinant plasmid containing the target gene, add PEG-CaCl2 solution, perform transfection under dark conditions, and add W5 solution to terminate the reaction;

[0021] 3. Wash the transfected protoplasts with W5 solution, resuspend them in W5 solution and culture them to obtain the rubber grassland protoplast transient expression system.

[0022] Preferably, the recombinant plasmid containing the target gene uses p2×35S promoter as the promoter of the target gene.

[0023] By implementing the above technical solution, compared with the prior art, the present invention has the following advantages:

[0024] First, by optimizing the enzymatic hydrolysate, protoplasts can be separated from rubber grass more easily and efficiently. Then, based on the enzymatic hydrolysate, the separation conditions are optimized, so that the efficiently separated protoplasts have higher vitality and better quality. And based on the separated protoplasts, a set of methods for efficient transient gene expression was established. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 To optimize the enzymatic conditions for protoplast isolation from rubber grass. (AG) Preparation and evaluation of protoplasts: (A) Morphology of rubber grass seedlings and leaves, scale bar = 2 cm. (B) Leaves cut into small pieces in enzyme solution, scale bar = 1 cm. (C) Residual plant tissue after enzymatic hydrolysis was removed using a 70 μm cell sieve, scale bar = 1 cm. (D) Protoplasts were collected by centrifugation in a 50 mL round-bottom tube, scale bar = 1 cm. (E) Protoplast morphology was observed under a microscope using differential interference contrast (DIC), scale bar = 50 μm. (F) Bright field images captured under a microscope, scale bar = 50 μm. (G) Protoplast viability was evaluated by FDA staining, scale bar = 50 μm. (HL) Optimization of protoplast isolation conditions: (H) D-mannitol concentration, (I) enzyme composition, (J) enzyme solution pH, (K) addition of β-mercaptoethanol, and (L) enzymatic hydrolysis time. Data are presented as the mean ± standard deviation (SD) of nine replicates. Different letters (ae) indicate statistically significant differences (p < 0.05) as determined by one-way ANOVA.

[0026] Figure 2 To achieve efficient expression of target genes in rubber grassland bioplastids using the p2×35S promoter. (A) Schematic diagram of the dual luciferase reporter system. The standard p35S promoter drives Rluc as an internal reference, and the promoter to be tested drives the expression of Fluc. (B) The relative luminescence intensity was calculated by the ratio of Fluc to Rluc signals. The data are presented as the mean ± standard deviation (SD) of three biological replicates. Each data point represents a replicate, and different letters (ad) indicate statistically significant differences (p<0.05) as determined by one-way ANOVA. (C) Western blotting was used to detect the expression of GFP and Cas9 in rubber grassland bioplastids. GFP and Cas9 antibodies were used to detect the target proteins, and Ponceau red staining was used to show the total protein amount. (D) Western blotting was used to detect the expression of AtSTOP1-Flag and TkSTOP1-Flag in rubber grassland bioplastids. Flag antibodies were used to detect the target proteins, and Ponceau red staining was used to confirm that the protein loading was equal.

[0027] Figure 3To perform efficient subcellular localization detection using rubber plant bioplastids. (A) GFP as a general expression control. (B) Nuclear localization marker NLS-CFP-NLS. (C) AtPIP2A-CFP, plasma membrane localization marker. (D) AtTIP1;1-mRFP, tonoplast localization marker. (E) Man49-mRFP, cis-Golgi localization marker. Scale bar = 10 μm.

[0028] Figure 4 To test the transcriptional activity of rubber grassland bioplastids. (A) Schematic diagram of transcriptional regulatory elements fused with GAL4-BD for transcriptional activity detection of pUAS-luc reporter gene. (B) Transcriptional regulatory effects of different transcriptional activation domains and transcriptional repression groups in rubber grassland bioplastids. (C) Schematic diagram of co-expression of plant transcription factors with pALMT1-luc reporter gene for transcriptional activity detection. (D) Transcriptional activation of ALMT1 promoter by AtSTOP1 and TkSTOP1 and inhibition of this transcriptional activation by RAE1. Data are presented as mean ± standard deviation (SD) of three biological replicates. Each data point represents a replicate, and different letters (ad) indicate statistically significant differences (p < 0.05) obtained by multiple t-tests (comparing each sample with other samples).

[0029] Figure 5 Protoplast activity test. The prepared protoplasts were cultured overnight and stained with the live cell dye FDA. (A) Protoplasts prepared after optimizing the D-mannitol concentration. (B) Protoplasts prepared after optimizing the D-mannitol concentration, the ratio of cellulase R-10 and macerate R-10. (C) Protoplasts prepared after optimizing the D-mannitol concentration, the ratio of cellulase R-10 and macerate R-10, and the pH of the enzymatic solution. (D) Protoplasts prepared after optimizing the D-mannitol concentration, the ratio of cellulase R-10 and macerate R-10, the pH of the enzymatic solution, and β-ME.

[0030] Figure 6 STOP1 homologous genes in rubber grass. (A) Evolutionary distance of STOP1 homologous proteins in rubber grass was analyzed using the MEGA11 neighbor-joining method. Branch lengths were drawn to scale to show the relationship between AtSTOP1 (AT1G34370), AtSTOP2 (AT5G22890), TkSTOP1 (evm.TU.utg6350.14), TkSTOP2a (evm.TU.utg6821.3), TkSTOP2b (evm.TU.utg23611.1), and TkSTOP2c (evm.TU.utg3497.3). (B) Domain analysis of STOP1-like proteins using SMART software. (C) Coding sequence of TkSTOP1 used in this study.

[0031] Figure 7 The construction of nuclear localization markers is shown. (A) The nuclear localization marker of rubber grassland bioplastids was constructed by fusing two nuclear localization signals (NLS) with CFP (Cerulean). (BC) DNA sequence (B) and protein sequence (C) of NLS-CFP-NLS used in this article.

[0032] Figure 8 The construction of plasma membrane, vacuole and cis-Golgi localization markers is shown. (A) Transmembrane structure analysis of AtPIP2A (AT3G53420). (B) Transmembrane structure analysis of AtTIP1;1 (AT2G36830). (C) Fusion protein of AtPIP2A N terminus with CFP is used to construct a plasma membrane localization marker. (D) AtTIP1;1 protein is expressed by fusion with the N terminus of RFP to construct a chromoplast localization marker. (E) The domain structure of GmMan1 protein is predicted using SMART. (F) The 49 amino acids at the N terminus of GmMan1 protein are fused with the N terminus of RFP to construct a cis-Golgi localization marker. DETAILED DESCRIPTION

[0033] The present invention is further described below in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0034] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0035] Example 1

[0036] Plant material and growth conditions

[0037] Rubber grass seeds were sown in soil and transplanted into individual pots one week later, one plant per pot. Rubber grass seedlings were cultured at 24°C and 55-65% relative humidity with a 16-hour light and 18-hour dark cycle. A constant environment was maintained to prevent drought or extreme temperatures. Four weeks after transplanting, fully expanded flat leaves were harvested for protoplast isolation.

[0038] Isolation of protoplasts

[0039] Fully expanded flat leaves were harvested from four-week-old transplanted plants, and the main veins were removed with a sharp double-sided blade. The leaves were cut into small pieces and added to an enzymatic solution containing KCl, CaCl2, MES, D-mannitol, cellulase R-10, macerate R-10, and β-ME, wherein β-ME was selectively added or not added according to different experiments; the addition method was: the enzyme solution containing KCl, MES, D-mannitol, cellulase R-10, and macerate R-10 was first preheated at 55°C for 10 minutes, and then CaCl2 and β-ME were added for enzymatic hydrolysis.

[0040] Enzymatic hydrolysis conditions: Enzymatic hydrolysis was performed at 40 rpm for 5 h at 28 °C in the dark.

[0041] The enzymatically hydrolyzed material was filtered through a 70 μm nylon mesh, and the filtrate was diluted with an equal volume of W5 solution (2 mM MES, pH 5.7, 154 mM NaCl, 125 mM CaCl2 and 5 mM KCl) and centrifuged at 100 × g for 5 minutes in a 50 mL round-bottom tube. The supernatant was discarded and the protoplasts were gently resuspended in the W5 solution. Cell morphology was evaluated using a fluorescence microscope and cell counting was performed using a hemocytometer. Cell viability was assessed using fluorescein diacetate (FDA) staining at a staining concentration of 0.01% (weight / volume) for 3 minutes, followed by centrifugation and washing with W5 solution. Viability was assessed using a fluorescence microscope at a wavelength of Ex / Em=490 / 520 nanometers.

[0042] In order to study the effects of different preparation conditions on protoplast separation, this example conducted a comparative experiment of multiple conditions, as follows.

[0043] 1. Effects of different concentrations of D-mannitol on protoplast isolation

[0044] The composition of the enzymatic hydrolysis solution is: 20 mM KCl, 20 mM MES (pH 5.6), gradient concentration of D-mannitol (0.2-0.7 M), cellulase R-10 (1.0% wt / vol) and macerate R-10 (0.3% wt / vol), 20 mM CaCl2. The pH of the enzymatic hydrolysis solution is 5.6.

[0045] Results, see Figure 1 It was found that the osmotic pressure of the enzyme solution had a significant effect on the protoplast yield, and the yield was highest when the D-mannitol concentration was 0.4-0.5M (5.8×10 6 / g FW). Subsequent optimization was performed at 0.5 M D-mannitol concentration.

[0046] 2. Effects of different cellulase and macerate concentration combinations on bioplastid separation in rubber grassland

[0047] To determine the ideal concentrations of cellulase and cleavage enzymes for bioplastid isolation in rubber grasslands, a gradient combination of the two enzymes was tested.

[0048] The composition of the enzymatic hydrolysis solution is: 20 mM KCl, 20 mM MES (pH 5.6), 0.5 M D-mannitol, cellulase R-10 and macerate R-10, 20 mM CaCl2. The pH of the enzymatic hydrolysis solution is 5.6.

[0049] Combination of Cellulase R-10 and Measuring Enzyme R-10 Figure 1 I in.

[0050] Results, see Figure 1 It was found that the protoplast yield could be increased by increasing the enzyme dosage appropriately. The best enzyme combination was 1.0% cellulase R-10 and 0.6% macerate R-10, which resulted in the highest protoplast yield (8.4×10 6 / g FW)( Figure 1 I), but when the enzyme dosage in the system exceeded the optimal level, the protoplast yield decreased.

[0051] 3. Effect of different pH values ​​on bioplastid separation in rubber grassland

[0052] The composition of the enzymatic hydrolysate is: 20 mM KCl, 20 mM MES (pH 5.2-6.2), 0.5 M D-mannitol, 1.0% cellulase R-10 and 0.6% macerate R-10, 20 mM CaCl2. pH = 5.2, 5.4, 5.6, 5.8, 6.0, 6.2.

[0053] Results, see Figure 1 J found that pH 5.6 to 5.8 was the most effective range.

[0054] 4. Effects of different concentrations of β-mercaptoethanol (β-ME) on bioplastid separation in rubber grassland

[0055] The composition of the enzymatic solution is: 20 mM KCl, 20 mM MES (pH 5.8), 0.5 M D-mannitol, 1.0% cellulase R-10 and 0.6% methanase R-10, 20 mM CaCl2 and β-ME (0-8 mM). The pH of the enzymatic solution is 5.8.

[0056] The optimization results showed that adding 5 μM of the reducing agent β-mercaptoethanol (β-ME) to the enzymatic hydrolysis system was sufficient to maintain a high protoplast yield (1.7×10 7 / g FW)( Figure 1 in K).

[0057] 5. Effects of different enzymatic hydrolysis times on bioplastid separation in rubber grassland

[0058] The composition of the enzymatic hydrolysis solution is: 20 mM KCl, 20 mM MES (pH 5.8), 0.5 M D-mannitol, 1.0% cellulase R-10 and 0.6% macerate R-10, 20 mM CaCl2 and 5 mM β-ME. The pH of the enzymatic hydrolysis solution is 5.8.

[0059] Results Figure 1 In the case of L, insufficient enzymatic hydrolysis would result in incomplete protoplast release, but after 5 h, the leaves were almost completely dissociated and the protoplast yield was high enough. Considering the preparation efficiency and preventing long-term incubation from affecting the activity of protoplasts, 5 h was selected as the optimal time for enzymatic protoplast hydrolysis.

[0060] In summary, the optimal conditions for bioplastid isolation from rubber grasslands were finally determined to be 1% cellulase R-10, 0.6% macerate R-10, 0.5 M D-mannitol, 20 mM KCl, 20 mM CaCl2, 20 mM MES and 5 mM β-ME, with a pH value of 5.6-5.8.

[0061] The activity of protoplasts after overnight culture is an important indicator for determining the transient expression effect of protoplasts. This example further studies the effect of different preparation conditions on protoplast activity. In the above condition comparison experiment, the rubber grassland protoplasts prepared after each condition optimization were collected, cultured overnight in the dark at 28°C, and the protoplast cells cultured overnight were collected after 12 hours and stained with the living cell dye FDA. The results are shown in Figure 5 , protoplasts prepared under the optimal protoplast isolation conditions also had the highest activity after overnight culture.

[0062] Therefore, the rubber grassland bioplastosome preparation scheme determined in the present embodiment can not only effectively separate the rubber grassland bioplastosome, obtain a sufficient number of protoplast cells, but also ensure the quality of the protoplastosome, ensure that most cells still have high activity after overnight culture, and ensure the effect of subsequent transient expression. This optimization scheme provides an effective platform for studying intracellular processes and clarifying signaling pathways.

[0063] Example 2

[0064] Construction of transient expression system

[0065] For PEG-calcium mediated transfection, the protoplasts isolated under the optimal conditions determined in Example 1 were resuspended in W5 solution and kept on ice for 15 minutes. After the protoplasts were precipitated, the supernatant was carefully removed and the protoplasts were diluted to 10 6 The density of pcs / ml is set aside.

[0066] 1. Promoter selection

[0067] To improve the efficiency of transient expression of target genes in bioplastids of rubber grassland, we used dual luciferase assay to evaluate the activities of several promoters (different versions of p35S promoter, Arabidopsis pAtUBQ10 promoter and rubber grass endogenous promoter pTkEF1α) in bioplastids of rubber grassland.

[0068] The nucleotide sequence of the pmini35S promoter (as shown in SED ID NO.1) is:

[0069]

[0070] The nucleotide sequence of the p1×35S promoter (as shown in SED ID NO.2) is:

[0071]

[0072]

[0073] The nucleotide sequence of the p2×35S promoter (as shown in SED ID NO.3) is:

[0074]

[0075] The nucleotide sequence of the pAtUBQ10 promoter (as shown in SED ID NO.4) is:

[0076]

[0077]

[0078] The nucleotide sequence of the pTkEF1α promoter (as shown in SED ID NO.5) is:

[0079]

[0080]

[0081]

[0082] The construction process of recombinant plasmids with different promoters.

[0083] When constructing different promoter recombinant plasmids, the vector pSAT6-Dual LUC was double-digested with restriction endonucleases BamHI and SbfI at 37°C, the vector backbone after digestion was recovered, and the promoter sequence to be tested was constructed into the vector using the recombinase ClonExpress IIOneStep Cloning Kit at 50°C.

[0084] When constructing the pmini35S promoter, primers pminiF and p35SR were used for PCR, and pSAT6-RFP was used as a template to amplify the pmini35S promoter (SED ID NO.1).

[0085] pminiF: ​​GACTCACTATAGGGCGAATCTCCACTGACGTAAGGGATGAC;

[0086] p35SR:TTTATGTTTTTGGCGTCTTCCATGGCTATCGTTCGTAAATG.

[0087] When constructing the p1×35S promoter, primers p1×F and p35SR were used for PCR, and pSAT6-RFP was used as a template to amplify the p1×35S promoter (SED ID NO. 2).

[0088] p1×F: GACTCACTATAGGGCGAATGTGATAACATGGTGGAGCACGACA;

[0089] p35SR:TTTATGTTTTTGGCGTCTTCCATGGCTATCGTTCGTAAATG.

[0090] When constructing the p2×35S promoter, primers p2×F and p35SR were used for PCR, and pSAT6-RFP was used as a template to amplify the p2×35S promoter (SED ID NO. 3).

[0091] P2×F: CTCACTATAGGGCGAATTGGACCGGTCAACATGTGGAGC;

[0092] p35SR:TTTATGTTTTTGGCGTCTTCCATGGCTATCGTTCGTAAATG.

[0093] When constructing the pAtUBQ10 promoter, primers pAUF and pAUR were used for PCR, and Arabidopsis genomic DNA was used as a template to amplify the pAtUBQ10 promoter (SED ID NO. 4).

[0094] pAUF: GACTCACTATAGGGCGAATTTTACCACAGCTCTTGCACCTAACC; pAUR: ATGTTTTTGGCGTCTTCCATTGTTAATCAGAAAAACTCAGA.

[0095] When constructing the pTkEF1α promoter, primers pTEF and pTER were used for PCR, and the rubber grass genomic DNA was used as a template to amplify the pTkEF1α promoter (SED ID NO.5).

[0096] pTEF: ACGACTCACTATAGGGCGAATTAAGGTAGGTGCTCCAAGTC;

[0097] pTEF: ATGTTTTTGGCGTCTCTCCATCCTGATAAATTAAAACAAAATG.

[0098] Gently mix 100 μL of protoplast suspension with 10 μL of recombinant plasmid at a concentration of 1 μg / μL. Add an equal volume (110 μL) of PEG-CaCl2 solution (40% PEG4000, 0.2M D-mannitol, 100mM CaCl2), mix the mixture gently immediately, and then incubate in the dark at 28°C for 15 minutes. Add 500 μL of W5 solution and centrifuge at 100 × g for 5 minutes to stop transfection. Wash the transfected protoplasts with W5 solution, resuspend in 500 μL of W5 solution, and harvest by culturing for 12-18 hours as needed. Use an ELISA reader to detect the reporter gene luciferase activity, which reflects the intensity of different promoters driving the expression of the target protein in rubber grassland bioplastids.

[0099] Results Figure 2 Figure B shows that the pmini35S promoter can only induce very low expression levels in the bioplastids of rubber grassland. In contrast, the activity of the p1×35S promoter is 12.8 times that of the pmini35S promoter. The activity of the p2×35S promoter is the highest, 49.1 times that of the pmini35S promoter, which is comparable to the activity of the pAtUBQ10 promoter. The activity of the endogenous promoter pTkEF1α is 2 times higher than that of the p1×35S promoter, but only half of the activity of the p2×35S promoter.

[0100] Cas9 protein is an RNA-guided endonuclease with an HNH nuclease domain and a RuvC-like domain, each of which can cut a double-stranded DNA chain. It has been widely used in plant genome editing. Green fluorescent protein (GFP) comes from the Victoria jellyfish, and its variants are widely used to mark other target proteins to observe and track the temporal and spatial changes of target proteins. Similar results were also obtained when GFP was expressed in the bioplastids of rubber grasslands.

[0101] In the present embodiment, the transient expression of rubber grassland bioplastids is carried out with pSAT6 plasmid as the skeleton, and the vector pSAT6-2×35S is double-digested at 37°C using restriction endonucleases PstI and NcoI, and the recombinase ClonExpressIIOne Step Cloning Kit is used to construct the Cas9 coding sequence nucleotide and the GFP coding sequence nucleotide into the vector at 50°C to obtain Cas9 and GFP expression vectors respectively. 2mL protoplast suspension is gently mixed with 200μL recombinant plasmids having a concentration of 1 microgram / microliter. An equal volume (2.2mL) of PEG-CaCl2 solution (40% PEG4000, 0.2M D-mannitol, 100mM CaCl2) is added, the mixture is gently mixed, and then cultured in the dark at 28°C for 15 minutes. 5mL W5 solution is added and centrifuged at 100×g for 5 minutes to stop transfection. The transfected protoplasts were washed with W5 solution, resuspended in 5 mL of W5 solution, and cultured for 12-18 hours as needed.

[0102] Protein extracts were prepared using a buffer containing 5% glycerol, 300mM NaCl, 40mM Tris-HCl (pH 7.5), 5mM MgCl2, 4mM DTT, 2mM EDTA (pH 8.0) and 1% (volume / volume) Triton X-100. Total protein was extracted and denatured at 95°C for 5 minutes. Immunoblotting was performed using the following primary antibodies: mouse anti-FLAG antibody (Sangon Biotech, D191041), mouse anti-GFP antibody (TransGen Biotech, HT801) or mouse anti-SpCas9 antibody (Genscript, A01885). Horseradish peroxidase (HRP)-coupled secondary antibodies, goat anti-mouse (SangonBiotech, D111024) were used for detection. The reaction signal was developed using an enhanced chemiluminescent solution (Millipore, WBKLS0500).

[0103] The results showed that when driven by the pTkEF1α promoter, the expression level of Cas9 protein was extremely low and almost undetectable by Western blotting. However, when the p2×35S or pAtUBQ10 promoter was used, clear and specific Cas9 signals were detected ( Figure 2 Similarly, the GFP signal detected by Western blotting was stronger when the gene was driven by the p2×35S or pAtUBQ10 promoter, and much weaker when the pTkEF1α promoter was used ( Figure 2 C).

[0104] This example also attempts to express plant-derived proteins in rubber grassland bioplastids.

[0105] STOP1 is a key transcription factor for acid soil resistance syndrome. Based on the genome and annotation of rubber grass, we identified four STOP1-like proteins. Phylogenetic analysis showed that TkSTOP1 is an ortholog of Arabidopsis AtSTOP1, while TkSTOP2a, TkSTOP2b and TkSTOP2c are more closely related to Arabidopsis AtSTOP2 ( Figure 6 A in Figure 1). We used SMART software to predict the functional domains of these proteins and found that all STOP1-like proteins contain four C2H2 zinc finger domains. However, unlike STOP1, STOP2 proteins and their homologous proteins lack an extended C-terminal region ( Figure 6 In B). We detected AtSTOP1 and TkSTOP1 ( Figure 6 C), and found that the expression level driven by the pTkEF1α promoter was significantly lower than that driven by the p2×35S promoter ( Figure 2 This finding is consistent with the lower expression levels of exogenous proteins such as Cas9 and GFP ( Figure 2 C). Our study showed that the p2×35S promoter is a strong promoter for high-intensity and stable expression of target genes in the bioplastids of rubber grassland.

[0106] 2. Subcellular localization detection

[0107] In this example, two different nuclear localization signals (NLS) were fused to the N-terminus and C-terminus of CFP (cyan fluorescent protein), a variant of GFP, using the pSAT6 backbone, thereby constructing a recombinant plasmid for nuclear localization labeling. The N-terminal SV40 NLS is derived from simian virus 40 (SV40) and is "APKKRKVGIHGVPAA", which is characterized by a core motif "PKKKRKV" rich in lysine and arginine. The C-terminal nucleoplasmin NLS is "KRPAATKKAGQAKKKK", which is used to enhance nuclear targeting ( Figure 7 ). The DNA sequence and protein sequence of NLS-CFP-NLS are shown in SED ID NO.5 and SED ID NO.6, respectively.

[0108] The nucleotide sequence of NLS-CFP-NLS (as shown in SED ID NO.5) is:

[0109]

[0110] The protein sequence of NLS-CFP-NLS (as shown in SED ID NO.6) is:

[0111]

[0112] Gently mix 100 μL of protoplast suspension with 10 μL of recombinant plasmid at a concentration of 1 μg / μL. Add an equal volume (110 μL) of PEG-CaCl2 solution (40% PEG4000, 0.2M D-mannitol, 100mM CaCl2), mix the mixture gently immediately, and then incubate in the dark at 28°C for 15 minutes. Add 500 μL of W5 solution to stop transfection and centrifuge at 100 × g for 5 minutes. Wash the transfected protoplasts with W5 solution, resuspend in 500 μL of W5 solution, and harvest the protoplasts after incubation for 12 hours. Use a ZEISS LSM980 laser confocal microscope to detect fluorescent protein signals and capture images. Use 445nm excitation light to detect CFP, and collect emission light signals of 470-500nm; use 488nm excitation light to detect GFP, and collect emission light signals of 500-530nm; use 514nm excitation light to detect YFP, and collect emission light signals of 525-555nm; use 543nm excitation light to detect RFP, and collect emission light signals of 580-630nm; for chloroplast autofluorescence, do not add excitation light separately, and collect emission light signals of 680-750nm.

[0113] Our results showed that CFP fused to these NLS sequences exhibited typical nuclear localization in the bioplastids of rubber grasslands ( Figure 3 B).

[0114] In this example, the plasma membrane localization water channel protein AtPIP2A of Arabidopsis thaliana was fused to the N-terminus of CFP using the pSAT6 backbone to construct a plasma membrane localization marker ( Figure 8 A and C in Figure 1). The fusion protein AtPIP2A-CFP was expressed and localized on the plasma membrane, and was clearly encapsulated in the chloroplasts ( Figure 3 In addition, we also fused the Arabidopsis tonoplast-localized γ-TIP water channel protein AtTIP1;1 to the N-terminus of mRFP to generate a tonoplast-localized marker ( Figure 8 B and D in the figure). After expression, the AtTIP1;1-mRFP fusion protein is localized to the vacuole membrane, and the chloroplast is located at its periphery ( Figure 3 D in ). In addition, we used the pSAT6 backbone to express a fragment of soybean α-1,2-mannosidase I (GmMan1) fused to the N-terminus of mRFP to construct a cis-Golgi localization marker. The fragment includes the first 49 amino acids of GmMan1, including a 29-amino acid cytoplasmic tail, which has an 11-amino acid LCR domain, a 16-amino acid transmembrane domain, and a 4-amino acid helical region ( Figure 8 The resulting Man49-mRFP fusion protein (DNA sequence and protein sequence are shown in SEDID NO.7 and SEDID NO.8, respectively) showed a characteristic localization pattern of the cis-Golgi apparatus ( Figure 3 E).

[0115] Among them, the nucleotide sequence of Man49-mRFP (as shown in SED ID NO.7) is:

[0116]

[0117]

[0118] The protein sequence of Man49-mRFP (as shown in SED ID NO.8) is:

[0119]

[0120] Based on the above results, we developed a transient transformation system for rubber grassland bioplastids to verify the subcellular localization of proteins. At the same time, we evaluated several commonly used subcellular localization markers and confirmed their characteristic localization patterns in rubber grassland bioplastids, thus verifying their practicality in the subcellular localization study of related proteins.

[0121] In this specific embodiment, in this study, we developed an efficient method to isolate sufficient numbers of viable rubber grassland bioplastids, allowing researchers to quickly perform gene function analysis in a natural cell environment. The results showed that rubber grassland bioplastids can be used to compare the strength of different promoters, express exogenous and endogenous proteins, detect the transcriptional activity or promoter binding of transcription factors, and track the subcellular localization of proteins.

[0122] Considering that rubber grass is rich in rubber (a cis-polyisoprene component), enzymatic hydrolysis may be affected when the leaves are cut. It is important to select young leaves that are expanded and remove the veins to ensure the activity of the isolated protoplasts and prevent the high accumulation of rubber from affecting the osmotic pressure of the enzyme system. We optimized the key factors of enzymatic hydrolysis, including D-mannitol concentration, enzyme composition, antioxidant β-ME, pH value, and determined the optimal enzymatic hydrolysis time. The addition of β-ME can significantly increase the yield of protoplasts, which may be due to its protective effect against damage caused by peroxides released from broken protoplasts. β-ME is both an antioxidant and an anti-apoptotic factor, which can improve cell survival by protecting cells from oxidative stress. It has been reported that the preparation of fungal protoplasts with β-ME or dithiothreitol (DTT) can make the cell wall more susceptible to enzyme treatment, thereby increasing the yield of fungal protoplasts. Therefore, the optimal conditions for isolating protoplasts from 4-week-old rubber grass transplant seedlings were determined to be: 1% cellulase R-10, 0.6% macerate R-10, 0.5 M D-mannitol, 20 mM KCl, 20 mM CaCl2, 20 mM 2-morpholineethanesulfonic acid (MES), 5 mM β-ME, and pH 5.6-5.8.

[0123] The selection of efficient and stable promoters is very important for the expression of target genes in rubber grassland bioplastids. Consistent with previous studies, tandem duplication of the upstream 250bp promoter can significantly increase gene expression. Our results showed that the expression level of the p2×35S promoter was nearly 50 times higher than that of the pmini35S promoter and nearly 4 times higher than that of the standard p35S promoter. In apple protoplasts, the Arabidopsis pAtUBQ10 promoter was significantly better than the p35S promoter in expressing the target gene. Similarly, in rubber grassland bioplastids, the expression level driven by the pAtUBQ10 promoter was almost 4 times that of the standard p35S promoter and was comparable to that of the p2×35S promoter ( Figure 2B). The efficiency of genome editing using the tomato pSlEF1α promoter in Salvia miltiorrhiza protoplasts was slightly higher than that of the p2×35S promoter. Our expression analysis using the pTkEF1α promoter in rubber grassland bioplasts showed that the expression of the pTkEF1α promoter was significantly improved compared with the standard p35S promoter. However, the expression level was not as high as that of the pAtUBQ10 and p2×35S promoters. Overall, the efficiency of protein expression by the pTkEF1α promoter was significantly lower than that of the pAtUBQ10 and p2×35S promoters, which may be due to the difference in plant species or the difference in the intrinsic strength of the pSlEF1α and pTkEF1α promoters. Therefore, we selected the p2×35S promoter as a candidate promoter for efficient gene expression and localization detection in rubber grassland bioplasts.

[0124] Transcriptional regulation is an important process in plant signal transduction and is crucial for early responses to environmental stimuli and stress resistance. We used a dual-luciferase reporter system to evaluate the activities of several well-characterized transcriptional activators and inhibitors. The results showed that the yeast-derived GAL4-AD transcriptional activation domain (Ma and Ptashne, 1987) and the herpes simplex virus type 1-derived VP16 activator (Triezenberg et al., 1988) can effectively activate transcription. Plant-derived transcriptional repressors, including SRDX and DLN144 (Mahfouz et al., 2012; Xu et al., 2023), can effectively inhibit gene expression ( Figure 4 B in the figure). These regulatory elements have broad applications in plant synthetic biology and gene expression regulation, for example, they are integrated with cleavage-inactivated Cas9 (dCas9) for CRISPR-mediated transcriptional activation (CRISPRa) or CRISPR interference (CRISPRi) systems (Konermann et al., 2015; Larson et al., 2013). In addition, we also validated the activity of plant endogenous transcription factors on target genes. This validation not only confirms the binding of transcription factors to DNA sequences, but also helps to study plant signaling pathways and gain insight into the role of gene-gene interactions.

Claims

1. An enzymatic hydrolysate for preparing protoplasts of rubber grass leaf flesh cells, the enzymatic hydrolysate comprising: KCl, CaCl2, MES, D-mannitol, cellulase R-10, macerate R-10 and β-mercaptoethanol (β-ME), characterized in that the concentration of D-mannitol is 0.4M-0.5M, the concentration of cellulase R-10 is 0.8%-1.2% (wt / vol), the concentration of macerate R-10 is 0.4%-0.8% (wt / vol), and the pH is between 5.6-5.

8.

2. The enzymatic hydrolysate according to claim 1, characterized in that The concentration of β-ME is 2mM-8mM.

3. The enzymatic hydrolysate according to claim 1, characterized in that The concentration of β-ME was 5 mM.

4. The enzymatic hydrolysate according to claim 1, characterized in that The concentration of cellulase R-10 is 1.0% (wt / vol), and the concentration of cleavage enzyme R-10 was 0.6% (wt / vol).

5. A method for preparing protoplasts of rubber grass mesophyll cells, characterized in that: Use the enzymatic hydrolysate according to any one of claims 1 to 4.

6. The method for preparing protoplasts of mesophyll cells of rubber grass according to claim 5, characterized in that: The specific preparation steps are as follows: S1. Obtain fully expanded flat leaves from rubber grass plants, remove the main veins, and cut the leaves into small pieces; S2. placing the leaf pieces into the enzymatic hydrolysis solution for enzymatic hydrolysis to obtain a cell suspension; S3. Collecting protoplasts from the cell suspension.

7. The method for preparing protoplasts of mesophyll cells of rubber grass according to claim 6, characterized in that: The enzymolysis time is 3h-6h.

8. The method for preparing protoplasts of mesophyll cells of rubber grass according to claim 6, characterized in that: Before using the enzymatic hydrolysis solution, the enzyme solution containing KCl, MES, D-mannitol, cellulase R-10 and macerate R-10 is preheated, and then CaCl2 and β-ME are added to perform enzymatic hydrolysis.

9. A rubber grassland bioplast, characterized in that: Obtained by the preparation method according to any one of claims 5 to 8.

10. A method for efficient transient gene expression based on rubber grassland bioplastids, characterized in that: The rubber grassland bioplast is the rubber grassland bioplast according to claim 9.

11. The method for efficient transient gene expression based on rubber grassland bioplastids according to claim 10, characterized in that: The steps include: (1) purifying the above-mentioned rubber grassland bioplastids; (2) The purified rubber grassland bioplastids were mixed with the recombinant plasmid containing the target gene, PEG-CaCl2 solution was added, transfection was performed under dark conditions, and W5 solution was added to terminate the reaction; (3) Wash the transfected protoplasts with W5 solution, resuspend them in W5 solution and culture them to obtain the rubber grassland protoplast transient expression system.

12. The method for efficient transient gene expression based on rubber grassland bioplastids according to claim 11, characterized in that: The recombinant plasmid containing the target gene uses the p2×35S promoter as the promoter of the target gene.

Images