Reduced coenzyme NADH oxidase mutant and application thereof

Abstract

The invention discloses a reduced coenzyme NADH oxidase mutant and application thereof. The mutant is obtained by replacing at least one amino acid in the 156th site, the 158th site and the 294th site of an amino acid sequence as shown in SEQ ID No.1; the glycine Gly at the 156 site is mutated into alanine Ala, the isoleucine Ile at the 158 site is mutated into histidine His, and the isoleucine Ile at the 294 site is mutated into phenylalanine Phe. According to the invention, mutation is carried out through active sites of NADH oxidase, and the finally obtained mutant improves the regeneration efficiency of reducing reduced coenzyme NADH into oxidized coenzyme NAD < + >.

Description

Technical Field

[0001] The invention relates to the technical field of enzyme engineering and chemical engineering, and in particular to a reduced coenzyme NADH oxidase mutant and application thereof. Background Art

[0002] NADH oxidase (NOX) is a FAD-dependent oxidoreductase that belongs to the flavoprotein disulfide reductase family. Most of them are homodimers, and the molecular weight of a single subunit is generally 46-56 kDa. In the presence of oxygen, the enzyme can catalyze the oxidation of the reduced coenzyme NADH to the oxidized coenzyme NAD. + At the same time, oxygen is reduced to H via double electron transfer 2 O 2 or reduced to H through four-electron transfer 2 O. NOX is widely present in lactic acid bacteria, such as Lactobacillus, Pediococcus, Leuconostoc, Coccus and other 22 lactic acid strains have NOX activity. The physiological function of NOX is mainly focused on removing oxygen toxicity in cells, maintaining the basic conditions for normal cell growth and metabolism, and regulating cell physiology and metabolism.

[0003] In addition, oxidoreductases are a class of enzymes that are widely present in nature. With the development of industry, oxidoreductases have been increasingly used, such as the oxidation of alcohols and amines, the stereoselective reduction of aldehydes and ketones, and the production of chiral alcohols by deracemization. At the same time, the vast majority of oxidoreductases use nicotinamide adenine dinucleotide (NAD + ) as an electron circulator. However, for industrial applications, NAD + The high cost of NADH oxidase makes it difficult to use it for equimolar redox reactions. Therefore, the development of efficient and economical cofactor regeneration systems is crucial. + , can be used to couple with a variety of enzymes to achieve coenzyme regeneration. However, the activity of natural NADH oxidase is currently low and it is difficult to meet the actual production needs, so the development of NADH oxidase with high enzyme activity is of great significance. Summary of the invention

[0004] Purpose of the invention: The first purpose of the present invention is to solve the problem of low activity of natural NADH oxidase, select key amino acid residues for saturation or semi-saturation mutation, construct a mutant library to achieve effective screening, and obtain a class of NADH oxidase mutants with high enzyme activity; the second purpose of the present invention is to provide the use of the NADH oxidase mutant in the oxidation-reduction coenzyme NADH as an oxidative coenzyme.

[0005] Technical solution: The reduced coenzyme NADH oxidase mutant of the present invention is a mutant in which at least one amino acid is replaced at positions 156, 158 and 294 of the amino acid sequence shown in SEQ ID No. 1; the glycine Gly at position 156 is mutated to alanine Ala, the isoleucine Ile at position 158 is mutated to histidine His, and the isoleucine Ile at position 294 is mutated to phenylalanine Phe.

[0006] Preferably, the mutants include G156A, I158H, I294F, G156A / I158H, G156A / I294F, I158H / I294F or G156A / I158H / I294F.

[0007] The wild-type NADH oxidase is derived from Lactiplantibacillus pentosus, has an amino acid sequence of SEQ ID NO.1, and a gene sequence of SEQ ID NO.2.

[0008] The mutant G156A, that is, the glycine Gly at position 156 is mutated to alanine Ala.

[0009] The mutant I158H, namely, the 158th isoleucine Ile is mutated to histidine His.

[0010] The mutant I294F, namely, the 294th isoleucine Ile is mutated to phenylalanine Phe.

[0011] The mutant G156A / I158H, that is, the glycine Gly at position 156 is mutated to alanine Ala and the isoleucine Ile at position 158 is mutated to histidine His.

[0012] The mutant G156A / I294F, that is, the glycine Gly at position 156 is mutated to alanine Ala and the isoleucine Ile at position 294 is mutated to phenylalanine Phe.

[0013] The mutant I158H / I294F, that is, the isoleucine Ile at position 158 is mutated to histidine His and the isoleucine Ile at position 294 is mutated to phenylalanine Phe.

[0014] The mutant G156A / I158H / I294F, that is, the glycine Gly at position 156 is mutated to alanine Ala, the isoleucine Ile at position 158 is mutated to histidine His, and the isoleucine Ile at position 294 is mutated to phenylalanine Phe.

[0015] The gene described in the present invention is: a gene encoding the NADH oxidase mutant protein described in the rights.

[0016] The recombinant plasmid described in the present invention is: a recombinant plasmid containing the gene.

[0017] Preferably, the expression vector of the recombinant plasmid is a PET series expression vector.

[0018] The recombinant bacteria described in the present invention are recombinant bacteria carrying the gene of the mutant or the recombinant plasmid.

[0019] The method for constructing the recombinant bacteria comprises the following steps:

[0020] (1) Construction of recombinant plasmid pET22b-LpNOX: NADH oxidase gene was connected with the digested plasmid pET22b to obtain the recombinant expression vector pET22b-LpNOX;

[0021] (2) Construction of recombinant E. coli BL21(DE3) / pET22b-LpNOX: The constructed recombinant expression vector pET22b-LpNOX was thermally transferred into competent E. coli BL21(DE3), and the recombinant E. coli BL21(DE3) / pET22b-LpNOX was obtained by culture and screening.

[0022] Preferably, the hosts are all Escherichia coli.

[0023] The NADH oxidase mutant, the recombinant plasmid or the recombinant bacterium of the present invention is a oxidized coenzyme NAD + Application in.

[0024] The application comprises the following steps: using reduced coenzyme NADH as substrate to efficiently catalyze the generation of oxidized coenzyme NAD + , to achieve efficient circulation of coenzymes. The catalytic process is as follows:

[0025]

[0026] Preferably, the catalytic reaction temperature is 30-45° C. and the pH is 7.5-8.5.

[0027] Invention mechanism:

[0028] In the present invention, the sequence and structural information of NADH oxidase reported in the public are used to screen out some potential enzyme genes by performing non-redundant searches in databases such as NCBI based on the principles of protein structure similarity, conservative site analysis, and host source diversity. These genes are functionally expressed in an E. coli expression system and then purified to obtain pure enzymes. The preferred NADH oxidase is derived from Lactiplantibacillus pentosus, which has a certain catalytic activity and can catalyze the oxidation of the coenzyme NAD + regeneration.

[0029] The present invention amplifies the NADH oxidase gene from Lactiplantibacillus pentosus and uses rational design to perform directed evolution to transform it, and finally obtains a NADH oxidase mutant with significantly improved catalytic efficiency, thereby realizing the oxidation of the coenzyme NAD + Highly efficient regeneration cycle.

[0030] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: (1) By mutating the active site of NADH oxidase, the mutant finally obtained improves the reduction of reduced coenzyme NADH to oxidized coenzyme NAD + regeneration efficiency; (2) the catalytic efficiency of the mutant G156A / I158H / I294F is 1.6 times that of the wild-type NADH oxidase. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 The NADH oxidase mutants of Examples 1 to 7 catalyze the oxidation of reduced coenzyme NADH to oxidized coenzyme NAD + Relative activity comparison chart of

[0032] Figure 2 The mutant of NADH oxidase (G156A / I158H / I294F) catalyzes the oxidation of reduced coenzyme NADH to oxidized coenzyme NAD at different temperatures. + Relative activity comparison chart of

[0033] Figure 3 The mutant NADH oxidase (G156A / I158H / I294F) catalyzes the oxidation of reduced coenzyme NADH to oxidized coenzyme NAD at different pH values. + Comparison of relative activities. DETAILED DESCRIPTION

[0034] The technical solution of the present invention is further described below in conjunction with embodiments.

[0035] Example 1

[0036] 1. Construction of NADH oxidase mutant plasmid

[0037] (1) Obtaining pET22b-LpNOX

[0038] The wild-type gene of NADH oxidase was synthesized by Jinweizhi (Suzhou) Co., Ltd. and constructed on the pET22b vector (the pET22b vector was provided by Jinweizhi Co., Ltd.), and the vector was transformed into the E. coli DH5α strain (purchased from Sangon Biotech (Shanghai) Co., Ltd.), and the recombinant bacteria E. coli DH5α / pET22b-LpNOX was inoculated into a 5mL test tube containing the culture medium and cultured at 37°C and 220rpm for 12h. After the culture, the bacteria were centrifuged at 12,000rpm for 1min and the cells were collected. The plasmid was extracted from E. coli DH5α / pET22b-LpNOX using a high-purity plasmid mini-extraction kit as a template for iterative mutation, and the plasmid pET22b-LpNOX mutant was constructed.

[0039] (2) Construction of recombinant E. coli BL21(DE3) / pET22b-LpNOX mutant

[0040] The gene mutation was carried out by whole plasmid PCR method to obtain the target mutant gene. The required primers were specifically designed using I294F as an example. Other mutants were designed using this principle and single-point iterative mutation was performed.

[0041] I294F upstream primer: GACGCGTACTTTCCACTAGCGAC

[0042] I294F downstream primer: GTCGCTAGTGGAAAGTACGCGTC system is shown in Table 1.

[0043] Table 1 PCR reaction system

[0044]

[0045] The PCR reaction conditions are shown in Table 2.

[0046] Table 2 PCR reaction conditions

[0047]

[0048] After the PCR amplification was completed, the amplified product was detected by 0.9% agarose gel electrophoresis, and the result showed that the amplified product was a single band with a size of about 6000 bp. The amplified product was purified and recovered using a DNA recovery and purification kit.

[0049] The purified gene fragment was digested with DpnI to remove the template and then recombined with recombinase. The recombinant product was transformed into E.coliDH5α competent cells, spread on the surface of LB solid culture medium containing 100μg / mL ampicillin, cultured at 37℃ for 12h, picked a single colony to LB liquid culture, identified the successfully constructed positive transformant by PCR, and verified the correctness of the mutation site by sequencing. After verification, a part of it was added with sterile glycerol at a final concentration of 25%, numbered, and stored at -80℃ for use, and a part of the bacteria was extracted with a plasmid extraction kit, and the recombinant plasmid was stored in a -20℃ refrigerator.

[0050] The recombinant expression plasmid pET22b that was successfully sequenced was transferred into E. coli BL21 (DE3) (Escherichia coli, purchased from Sangon Biotech (Shanghai) Co., Ltd.) as the expression host to construct the recombinant mutant expression strain E. coli BL21 (DE3) / pET22b-LpNOX.

[0051] 2. Cultivation of NADH oxidase mutants and preparation of crude enzyme solution

[0052] The successfully constructed recombinant mutant expression strain E. coli BL21 (DE3) / pET22b-LpNOX was spread on a plate containing ampicillin at a final concentration of 100 μg / mL. A single colony was picked and inoculated into 5 mL of LB medium containing resistance and cultured at 37 ° C and 200 rpm / min overnight. 1% of the inoculum was transferred to 500 mL of LB medium containing resistance. At OD 600 When the concentration reaches about 0.6, add IPTG with a final concentration of 0.5 mM and induce at 18°C ​​for about 14 hours.

[0053] After obtaining the bacterial cells by centrifugation, resuspend them in buffer, disrupt the cells by ultrasonication in an ice bath (working for 2 seconds, interval for 5 seconds, working time for 30 minutes), and centrifuge at 12,000 rpm / min for 20 minutes at 4°C. After collecting the supernatant, filter it through a 0.22μm water filter to obtain the crude enzyme solution.

[0054] Example 2

[0055] The G156A mutant was prepared based on Example 1. In step (2), the primers were changed, and the other conditions remained unchanged. The primers were as follows:

[0056] G156A upstream primer: GTTATTGGCGGTGCCTACATTGGTACCG

[0057] G156A downstream primer: CGGTACCAATGTAGGCACCGCCAATAAC.

[0058] Example 3

[0059] The I158H mutant was prepared based on Example 1. In step (2), the primers were changed, and the other conditions remained unchanged. The primers were as follows:

[0060] I158H upstream primer: GCGGTGGCTACCATGGTACCGAACTGG

[0061] I158H downstream primer: CCAGTTCGGTACCATGGTAGCCACCGC.

[0062] Example 4

[0063] The G156A / I158H mutant was prepared based on Example 1. In step (2), the primers were changed, and the other conditions remained unchanged. The primers were as follows:

[0064] G156A / I158H upstream primer: GTTATTGGCGGTGCCTACCATGGTACCGAACTGG

[0065] G156A / I158H downstream primer: CCAGTTCGGTACCATGGTAGGCACCGCCAATAAC.

[0066] Example 5

[0067] G156A / I294F mutant Based on Example 1, the plasmid obtained in Example 2 was used as the DNA template in step (2), the primers were changed, and the other conditions remained unchanged. The primers are as follows:

[0068] G156A / I294F upstream primer: GACGCGTACTTTCCACTAGCGAC

[0069] G156A / I294F downstream primer: GTCGCTAGTGGAAAGTACGCGTC.

[0070] Example 6

[0071] The I158H / I294F mutant was prepared based on Example 1, using the plasmid obtained in Example 3 as the DNA template in step (2), changing the primers and keeping the other conditions unchanged. The primers are as follows:

[0072] I158H / I294F upstream primer: GACGCGTACTTTCCACTAGCGAC

[0073] I158H / I294F downstream primer: GTCGCTAGTGGAAAGTACGCGTC.

[0074] Example 7

[0075] G156A / I158H / I294F mutant Based on Example 1, the plasmid obtained in Example 4 was used as the DNA template in step (2), the primers were changed, and the other conditions remained unchanged. The primers are as follows:

[0076] G156A / I158H / I294F upstream primer: GACGCGTACTTTCCACTAGCGAC

[0077] G156A / I158H / I294F downstream primer: GTCGCTAGTGGAAAGTACGCGTC.

[0078] Performance Testing

[0079] 1. NADH oxidase and its mutants catalyze the oxidation of reduced coenzyme NADH to oxidized coenzyme NAD +

[0080] The corresponding engineered bacteria expressing NADH oxidase and their mutants were cultured according to the construction of Examples 1 to 7 and the obtained crude enzyme solution was used as a catalyst.

[0081] The reaction system is: OD 600 =20 crude enzyme solution, 1 mM reduced coenzyme NADH, the reaction buffer solution is 200 mM potassium phosphate buffer (pH = 7.5), and the absorbance change at 340 nm within 5 minutes is measured in a 1 mL quartz cuvette to compare the relative activity.

[0082] The test results are shown in Table 3 and Figure 1 .

[0083] Table 3 NADH oxidase reduction to generate reduced coenzyme NADH

[0084]

[0085]

[0086] Depend on Figure 1 It can be seen that the catalytic conversion rates of all mutants are higher than that of wild-type NADH oxidase, especially the catalytic efficiency of mutant G156A / I158H / I294F is 1.6 times that of wild-type NADH oxidase.

[0087] 2. NADH oxidase mutant (G156A / I158H / I294F) catalyzes the oxidation of reduced coenzyme NADH to oxidized coenzyme NAD + The optimum temperature

[0088] The corresponding engineered bacteria expressing NADH oxidase and its mutants were cultured according to the construction of Example 7 and the obtained crude enzyme solution was used as a catalyst.

[0089] The reaction system is: OD 600 = 20 crude enzyme solution, 1mM reduced coenzyme NADH, reaction buffer solution is 200mM potassium phosphate buffer (pH = 7.5). The reaction temperature is controlled at 20°C, 25°C, 30°C, 35°C, 40°C, 45°C, 50°C by water bath, the reaction is carried out for 5 minutes, and the change of the absorbance value of the reaction system within 5 minutes at a wavelength of 340nm is recorded in a 1mL quartz cuvette to compare the relative activity. The test results are shown in Figure 2 .

[0090] Depend on Figure 2 It can be seen that the best catalytic effect was observed at 35°C, and the enzyme activity was good in the range of 30-45°C.

[0091] 3. NADH oxidase mutant (G156A / I158H / I294F) catalyzes the oxidation of reduced coenzyme NADH to oxidized coenzyme NAD + Optimum pH

[0092] The corresponding engineered bacteria expressing NADH oxidase and its mutants were cultured according to the construction of Example 7 and the obtained crude enzyme solution was used as a catalyst.

[0093] The reaction system is: OD 600 =20 crude enzyme solution, 1mM reduced coenzyme NADH. 50mM sodium phosphate buffer at pH 6.5, 50mM dipotassium hydrogen phosphate-dipotassium hydrogen phosphate buffer at pH 7.5, 50mM dipotassium hydrogen phosphate-potassium hydrogen phosphate second buffer at pH 8, 50mM dipotassium hydrogen phosphate-potassium hydrogen phosphate second buffer at pH 8.5, 50mM Tris-HCl buffer at pH 9, 50mM Gly-NaOH buffer at pH 10.28. Record the change in the absorbance value of the reaction system within 5 minutes at a wavelength of 340nm in a 1mL quartz cuvette to compare the relative activity. The test results are shown in Figure 3 .

[0094] Depend on Figure 3 It can be seen that different pH has a significant effect on the catalytic effect of NADH oxidase. The best catalytic effect was observed at pH 8.0. In addition, the enzyme catalytic activity was relatively high when the pH was in the range of 7.5 to 8.5.

[0095] 4. NADH oxidase and its mutants (G156A / I158H / I294F) catalyze the oxidation of reduced coenzyme NADH to oxidized coenzyme NAD + Kinetic parameters

[0096] The kinetic parameters of NADH oxidase and its mutants were determined using hydrogen peroxide at different concentrations as substrate. The experiment was carried out at pH = 7.5, enzyme concentration of 0.005 mM, reaction time of 5 min, first-order reaction velocity as ordinate, substrate concentration as abscissa, and nonlinear fitting to obtain V max and K m Parameter value, then find K cat , the income

[0097] The results are shown in Table 4:

[0098] Table 4 Kinetic parameters of wild-type NADH oxidase and its mutants

[0099]

[0100] As shown in Table 4, the Michaelis-Menten kinetic parameters of the NADH oxidase mutant (G156A / I158H / I294F) are Km=0.357mM, Kcat=1422min -1 Compared with the wild-type NADH oxidase, the oxidation ability of the reduced coenzyme NADH is significantly improved.

Claims

1. A reduced coenzyme NADH oxidase mutant, characterized in that: The mutant is a mutant in which at least one amino acid is replaced in the three positions 156, 158 and 294 of the amino acid sequence shown in SEQ ID No.1; the glycine Gly at position 156 is mutated to alanine Ala, the isoleucine Ile at position 158 is mutated to histidine His, and the isoleucine Ile at position 294 is mutated to phenylalanine Phe.

2. The NADH oxidase mutant according to claim 1, characterized in that The mutants include G156A, I158H, I294F, G156A / I158H, G156A / I294F, I158H / I294F or G156A / I158H / I294F.

3. A gene encoding the NADH oxidase mutant protein according to any one of claims 1 to 2.

4. A recombinant plasmid containing the gene according to claim 3.

5. The recombinant plasmid according to claim 4, characterized in that: The expression vector of the recombinant plasmid is a PET series expression vector.

6. A recombinant bacterium carrying the gene of the mutant according to claim 3 or the recombinant plasmid according to claim 4.

7. The recombinant bacterium according to claim 6, characterized in that: The host is Escherichia coli.

8. A NADH oxidase mutant according to claim 1 or 2, or a recombinant plasmid according to claim 4, or a recombinant bacterium according to claim 6, wherein the oxidized coenzyme NADH is converted to the oxidized coenzyme NAD + Application in.

9. The use according to claim 8, characterized in that: The application comprises the following steps: using reduced coenzyme NADH as substrate to efficiently catalyze the generation of oxidized coenzyme NAD + , to achieve efficient circulation of coenzymes.

10. The use according to claim 9, characterized in that: The catalytic reaction temperature is 30-45°C, and the pH is 7.5-8.5.

Images