Application of colored potato miR828 gene in anthocyanin accumulation

Abstract

The invention relates to an application of a colored potato miR828 gene in anthocyanin accumulation. The colored potato miR828 gene comprises a nucleotide sequence as shown in SEQ ID NO: 1. The research of the invention finds that the content of anthocyanin can be obviously increased by overexpressing the miR828 gene in the potato. By utilizing the miR828 gene, the cultivation of new plant varieties is facilitated, and plants with higher anthocyanin content are obtained.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to application of colored potato miR828 gene in anthocyanin accumulation. Background Art

[0002] Colored potatoes (Solanum tuberosum) have colorful skin or flesh, contain anthocyanins, and have high nutritional value. Anthocyanins are flavonoid compounds, formed by different anthocyanins, and have anti-tumor, antioxidant, and anti-aging effects. Anthocyanins are a family of compounds that can appear red in flavonoids-a class of substances based on flavonoid nuclei. Anthocyanins can be used to remove free radicals in the body, proliferate lutein, fight tumors, fight cancer, fight inflammation, inhibit lipid peroxidation and platelet aggregation, prevent diabetes, lose weight, protect eyesight, etc. As a natural pigment, anthocyanins are safe, non-toxic, and have many health functions for the human body. They can be widely used in food, health products, cosmetics, medicine and other industries.

[0003] MicroRNAs are considered to be key genetic and epigenetic regulatory factors in organisms, ranging from DNA and histone methylation modifications to the regulation of coding or non-coding RNA abundance. In plants, the main regulatory RNAs are divided into two categories: microRNA (miRNA) and small interfering RNA (siRNA). The former is mainly involved in post-transcriptional regulation, while the latter is involved in transcriptional regulation. MicroRNAs (miRNAs) are a class of endogenous non-coding RNAs with regulatory functions found in eukaryotes, and their length is about 18-25 nucleotides. The miRNA database miRBase (miRBaseV21.0) contains a total of 35,828 mature miRNAs from 223 species, covering 849 miRNAs from 73 plant species. miRNAs have very important functions in plants, and their complementary target mRNAs are mostly some growth regulators that encode development and cell differentiation (such as FveLOM, FveWUS, GRF, AP2, PHB, PHV, etc.). However, there is no report on the use of miR828 for the accumulation of anthocyanins in potatoes. Summary of the invention

[0004] In view of the problems existing in the prior art, the present invention provides the application of the colored potato miR828 gene in anthocyanin accumulation.

[0005] The technical solution of the present invention to solve the above technical problems is as follows:

[0006] The invention provides a colored potato miR828 gene, comprising a nucleotide sequence shown in SEQ ID NO:1.

[0007] The present invention provides a vector, comprising the above-mentioned colored potato miR828 gene. The vector can be a cloning vector or an expression vector.

[0008] The present invention provides application of the colored potato miR828 gene in anthocyanin accumulation.

[0009] The present invention provides the use of the above-mentioned vector in anthocyanin accumulation. The vector can overexpress the miR828 gene.

[0010] The present invention has found that when the miR828 transgene is overexpressed, the anthocyanin content of potatoes increases; when miR828 is silenced, the anthocyanin content of potatoes decreases. Therefore, new plant varieties can be obtained by using the above miR828 gene or a vector containing the miR828 gene.

[0011] The invention provides a method for increasing the anthocyanin content of potatoes, comprising the following steps: overexpressing miR828 gene in potatoes.

[0012] Specifically, the method may include the following steps: constructing a recombinant expression vector containing the miR828 gene, and transferring the recombinant expression vector containing the miR828 gene into potatoes.

[0013] Furthermore, the recombinant expression vector may be pCAMBIA1302-miR828.

[0014] For example, the following steps may be included:

[0015] (4) Construction of pCAMBIA1302-miR828 expression vector;

[0016] (5) preparing Agrobacterium containing the pCAMBIA1302-miR828 expression vector;

[0017] (6) Potatoes were infected with Agrobacterium containing the pCAMBIA1302-miR828 expression vector to prepare potatoes transformed with the miR828 gene.

[0018] The beneficial effects of the present invention include: adopting the method can significantly increase the content of anthocyanin in potatoes. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 It is the gel electrophoresis diagram of purple potato miR828, wherein M is D2000 Marker (Tiangen, MD114), and 1 and 2 are miR828 genes.

[0020] Figure 2It is the electrophoresis diagram of the expression vector pCAMIA1302, wherein M1 is D15000 Marker (Tian Gen, MD110), M2 is D2000 Marker (Tian Gen, MD114), and 1-3 are vector pCAMIA1302.

[0021] Figure 3 The results of double enzyme digestion gel electrophoresis detection of the expression vector pCAMIA1302 plasmid, wherein M1 is D15000 Marker (Tian Gen, MD110), M2 is D2000 Marker (Tian Gen, MD114), 1 is vector pCAMIA1302, and 2-5 are enzyme digestion products of vector pCAMIA1302.

[0022] Figure 4 The results of colony PCR gel electrophoresis detection are shown in Figure 1, where M is D2000 Marker (Tian Gen, MD114), and 1-4 are pCAMBIA1302-miR828 colony PCR.

[0023] Figure 5 This is the pCAMBIA1302-miR828 vector map.

[0024] Figure 6 This is the result of PCR verification of pBWA(V)KS-miR828 vector.

[0025] Figure 7 This is the map of the pBWA(V)KS-miR828 vector.

[0026] Figure 8 The following are photos of the obtained miR828 transgenic tobacco.

[0027] Fig. 9 Results of gene expression analysis of miR828 transgenic tobacco.

[0028] Fig.10 This is the result of detecting anthocyanin content in transgenic tobacco.

[0029] Fig.11 The results of the expression of miR828 gene in transgenic potato pBWA(V)KS-miR828.

[0030] Fig.12 This is a photo of transgenic pBWA(V)KS-miR828 potato tubers.

[0031] Fig.13 The results show the anthocyanin content in transgenic pBWA(V)KS-miR828 potato tubers.

[0032] Fig.14The results of miR828 gene expression in potato leaves overexpressing miR828.

[0033] Fig.15 The results of miR828 gene expression in potato tubers overexpressing miR828.

[0034] Fig.16 The results of anthocyanin content in potato leaves overexpressing miR828.

[0035] Fig.17 Photographs of potato tubers overexpressing miR828.

[0036] Fig.18 The results of anthocyanin content in potato tubers overexpressing miR828. DETAILED DESCRIPTION

[0037] The principles and features of the present invention are described below in conjunction with the accompanying drawings. The examples given are only used to explain the present invention and are not used to limit the scope of the present invention.

[0038] In the embodiments, the experimental methods used are conventional methods in the art unless otherwise specified; the materials, reagents, methods and instruments used are conventional materials, reagents, methods and instruments in the art unless otherwise specified, and can be obtained through commercial channels or prepared by conventional methods by those skilled in the art.

[0039] Unless otherwise specified, the solutions involved in the present invention are prepared using water as the solvent.

[0040] In the embodiment, the sequences of primers for miR828 cloning and functional verification are shown in Table 1. All primers in Table 1 except miR828-qR were synthesized by Shanghai Bioengineering Co., Ltd. miR828-qR was provided by miRcute Enhanced miRNA Fluorescence Quantification Detection Kit (SYBRGreen) (Tiangen, FP411), which is an Oligo (dT) sequence, a nucleotide chain composed of thymine.

[0041] Table 1 Primer sequences for miR828 cloning and functional verification

[0042]

[0043]

[0044] LB liquid culture medium includes: tryptone 10 g / L, yeast extract 5 g / L, and NaCl 10 g / L.

[0045] LB solid medium includes: tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, agar 15 g / L.

[0046] The formula of MS liquid culture medium includes: MS dry powder 4.74g / L, sucrose 30g / L, prepared with water.

[0047] MS dry powder was purchased from Solebow Biotechnology Co., Ltd.; sucrose, tryptone, yeast extract, and agar were all purchased from White Shark Biotechnology Co., Ltd.

[0048] 2×Tap PCR miX was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd. (Cat. No. KT205). 6-Benzylaminoadenine (6-BA), 2,4-dichlorophenoxyacetic acid (2,4-D) and Gibberella (GA3) were purchased from Vander (Beijing) Biotechnology Co., Ltd. Acetosyringone (AS) and Timentin (TMT) were purchased from Solebao Biotechnology Co., Ltd. Biorun Pfu PCR Mix, 10×Buffer, BsaI, Eco31I, T4_ligase, and pBWA(V)KS-ccDB were all purchased from Wuhan Boyuan Biotechnology Co., Ltd.

[0049] SR1 tobacco leaves were grown in the Breeding Laboratory of the College of Agriculture of Inner Mongolia Agricultural University and are available to the public for non-commercial purposes only to repeat the experiments described in the examples of the present invention.

[0050] The following is an introduction through specific embodiments.

[0051] Example 1 miR828 gene cloning and expression vector construction

[0052] (1) Extraction and reverse transcription of total RNA from colored potatoes

[0053] TRNzol Universal total RNA extraction reagent (TianGen, DP424) was used to extract total RNA from the tissue culture seedlings of "Huasong No. 66" potato (provided by Huasong Seed Technology Co., Ltd.). The RNA concentration and purity were detected using NanoDrop One, and detected by 1% (mass percentage) agarose gel electrophoresis, and stored at -80°C for future use. The potato total RNA was reverse transcribed into cDNA using TianGen's FastQuant cDNA First Strand Synthesis Kit (KR106), and the obtained potato cDNA can be used for subsequent experiments or stored at -20°C for future use.

[0054] (2) Cloning the full-length miR828 gene

[0055] Primer Premier 6.0 software was used to design specific primers for amplifying the full length of the miR828 precursor.

[0056] The full-length sequence of the miR828 amplification precursor is: CTCAAATGAGTATTCCAAAAAGGGTTCTCTGTCGACACTCCCAATTCATTTCTCTCGGAACAATT TTCATTAACTGGATTAAGTATACCTCTTTCCTTTTTGGATGA (SEQ ID NO: 1).

[0057] Protective bases were added to both ends of the primers, the restriction site Nco I was added to the 3' end, and the restriction site Spe I was added to the 5' end. The specific primers were miR828-F and miR828-R in Table 1. Using potato cDNA as a template, PCR was performed to amplify the full-length sequence of miR828 precursor. The amplification reaction system was shown in Table 2, and the amplification reaction procedure was shown in Table 3.

[0058] Table 2 Reaction system for full-length gene amplification

[0059]

[0060] Table 3 Reaction procedure for full-length gene amplification

[0061]

[0062] The miR828 precursor sequence was successfully amplified by PCR ( Figure 1 ), located between 100bp and 250bp, consistent with the expected band size, and the sequencing result was correct, with inserted restriction sites at both ends of the fragment, indicating that the miR828 gene was successfully cloned.

[0063] (3) Recovery and sequencing of miR828 gene

[0064] The target fragment was cut out under UV gel excision instrument, and the target fragment was recovered using agarose gel DNA / PCR product small amount recovery kit (DC3511, BioVoice). The concentration and purity of the recovered product were tested using NanoDrop One. After the test was qualified, it was stored at -20℃ for future use. Simple Cloning Vector cloning vector was connected and transformed into T1 competent cells (Beijing Quanshijin Biotechnology Co., Ltd.). The positive monoclonal bacterial solution corresponding to the band at the correct position was entrusted to BGI for sequencing, and the sequencing results were compared with the original sequence using DNAMAN software. At the same time, the positive clone with the correct alignment was named pEASY-miR828.

[0065] (4) Construction of pCAMBIA1302-miR828 expression vector

[0066] The pCAMIA1302 plasmid (purchased from Changsha Aibiwei Biotechnology Co., Ltd., which contains the mGFP5 structural sequence) was detected by 1% gel electrophoresis. The results showed that the bands were clear, bright and complete, without any mixed bands or tailing ( Figure 2 ).

[0067] The vector plasmid pCAMBIA1302 was double-digested with Nco I restriction endonuclease (Takara, Code No.1160A) and Spe I restriction endonuclease (Takara, Code No.1086A). The target fragment pEASY-miR828 was double-digested with Nco I restriction endonuclease (Takara, Code No.1160A) and Spe I restriction endonuclease (Takara, Code No.1086A). The results of 1% gel electrophoresis showed that the linearized vector plasmid band was smooth, clear, bright and stable, which met the requirements of the subsequent vector connection test ( Figure 3 ).

[0068] The double digestion recovery product (119 bp) of the target fragment was ligated with the double digestion recovery product (10531 bp) of the vector fragment using T4 ligase (Takara, Code No. 2011A). The ligation system is shown in Table 4. The ligation reaction temperature was 25°C and the reaction time was 16 h to obtain a T4 ligation product.

[0069] Table 4 T4 enzyme ligation system

[0070]

[0071] The competent cells of E. coli Top10 (purchased from Shanghai Weidi Biotechnology Co., Ltd.) were quickly placed on ice to melt. When the competent cells were slightly melted, 10uL of T4 ligation product was added and flicked to mix; immediately placed on ice for 25min; 42℃ water bath for 45s, then quickly placed on ice for 2min; after standing, 700μL of liquid LB without antibiotics was added, and placed in a 37℃ constant temperature incubator with shaking at 200rpm for 60min. After the culture was completed, centrifuged at 8000rpm for 1min, 100μL of supernatant was retained and mixed with the precipitate, which was spread on an LB plate containing Kan resistance (kanamycin concentration of 50mg / L), and the plate was placed in a 37℃ constant temperature incubator for overnight culture.

[0072] PCR detection of miR828 bacterial solution: white positive single clones were selected as cDNA templates, miR828-yF and miR828-yR were used as primers, and PCR detection was performed. The PCR system was referred to Table 2, and the PCR program was referred to Table 3.

[0073] The positive PCR product was detected by 1% gel electrophoresis, and the results showed that the target band size was 468 bp, located below 500 bp, and the band was bright ( Figure 4 ), extract the positive colony plasmid, which is the recombinant plasmid pCAMBIA1302-miR828. The plasmid map is shown in Figure 5 As shown, the outermost red part, i.e., the part between NcoI and SpeI, represents miR828.

[0074] Take out 100μL LBA4404 Agrobacterium competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.) from the -80℃ refrigerator and place them on ice to melt; add the plant recombinant expression vector (≤1ug) when the competent cells are slightly thawed, flick to mix, and place on ice for 5min; liquid nitrogen for 5min; 37℃ water bath for 5min, and on ice for 5min. Add 700μL of liquid LB medium without antibiotics, and shake at 200rpm for 2-3h in a 28℃ constant temperature incubator. Centrifuge at 8000rpm for 1min to collect the bacteria, keep 100μL of the supernatant and mix the bacteria, and evenly apply it on the LB plate containing Kan (50mg / L) and rifampicin Rif (20mg / L) resistance. After the bacterial solution is completely absorbed, invert and culture overnight in a 28℃ incubator.

[0075] Detection of miR828 bacterial solution: white positive single clones were selected as cDNA templates, miR828-yF and miR828-yR were used as primers, and PCR detection was performed. The PCR system was referred to Table 2, and the PCR program was referred to Table 3. The PCR results showed that the target band size was 468 bp, indicating that the recombinant plasmid pCAMBIA1302-miR828 was successfully transferred into LBA4404 competent cells.

[0076] Example 2

[0077] (1) Based on the mature sequence of miR828, a simulated target sequence was designed, that is, 3 bases were inserted at the 10th or 11th base of the microRNA complementary sequence to ensure that the "simulated target-microRNA" structure could be formed without being degraded. The structure of P35s-TM1-spacer (48 bp)-TM2-T35s was constructed on the gene vector, spacer: gttgttgttgttatggtctaatttaaatatggtctaaagaagaagaat (SEQ ID NO: 14).

[0078] (2) Using STTM-miR828 specific primers (i.e., STTM-miR828-F and STTM-miR828-R in Table 1), the cDNA of Example 1 (1) is used as a template to amplify the target fragment. The amplification reaction system is shown in Table 5, and the amplification reaction procedure is shown in Table 6. After the reaction is completed, 1% agarose gel electrophoresis is used for detection, and the target electrophoresis fragment (i.e., miR828) is cut out under ultraviolet light and recovered. After the detection is correct, it is used for subsequent vector construction.

[0079] Table 5 Amplification reaction system

[0080]

[0081] Table 6 Amplification reaction program

[0082]

[0083] (3) Vector construction

[0084] Homologous recombination and golden gate seamless cloning methods were used to construct the pBWA(V)KS-miR828 vector. The restriction enzyme ligation system is shown in Table 7 and the reaction procedure is shown in Table 8.

[0085] Table 7 Enzyme Digestion and Ligation System

[0086]

[0087]

[0088] Note: In Table 7, miR828 was prepared in step (2) of Example 2.

[0089] Table 8 Reaction procedures for restriction endonuclease ligation

[0090]

[0091] After the enzyme digestion and ligation reaction, 5-10 μL of the ligation product was used to transform TOP10 Escherichia coli competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.). After overnight culture at 37°C, single clones were picked and PCR detection was performed using the STTM-miR828-JF and STTM-miR828-JR primers in Table 1. The PCR reaction system is shown in Table 2, and the PCR reaction procedure is shown in Table 3. To ensure the accuracy of the recombinant plasmid, the recombinant plasmid was digested with EcoRV endonuclease to verify whether the actual fragment size of the recombinant plasmid was consistent with the theoretical value. The recombinant positive plasmid obtained by the above method was pBWA(V)KS-miR828. The recombinant positive plasmid pBWA(V)KS-miR828 was transformed into GV3101 Agrobacterium competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.), cultured on LB plates containing Kan (50 mg / L) and Rif (20 mg / L) resistance, and cultured at 28°C overnight. When single colonies appeared, PCR detection was performed using STTM-miR828-JF primers and STTM-miR828-JR primers. The PCR reaction system is shown in Table 2, and the PCR reaction procedure is shown in Table 3.

[0092] The positive PCR product was detected by 1% gel electrophoresis, and the results showed that the target band size was 238 bp, located below 250 bp, and the band was bright ( Figure 6 ) That is, the recombinant plasmid pBWA(V)KS-miR828 was successfully transferred into GV3101 competent cells. The pBWA(V)KS-miR828 vector map is shown in Figure 7 As shown, the outermost red part is miR828.

[0093] Example 3 Detection and analysis of transgenic miR828 tobacco plants

[0094] (1) Positive detection of transgenic miR828 tobacco

[0095] The Agrobacterium culture solution containing the recombinant plasmid pCAMBIA1302-miR828 (prepared by the method of Example 2) was cultured overnight at 220 rpm and 28°C until the OD 600=0.6. Centrifuge at 8000rpm for 10min to collect the bacteria. Resuspend the bacteria in an equal volume of 1 / 2MS liquid culture medium (the concentration of the components in the MS liquid culture medium is halved) and use it to infect sterile SR1 tobacco leaves. Remove the leaf margins and main veins of the leaves, cut them into 0.5cm×0.5cm leaf discs and place them in the resuspended Agrobacterium bacterial solution. Oscillate in a constant temperature oscillating box at 28℃ and 200rpm for 8min. Use sterile filter paper to absorb the bacterial solution on the surface of the leaves, and place them in tobacco co-cultivation medium (add 6-BA with a final concentration of 1mg / L and AS with a final concentration of 100umol / L on the basis of MS liquid culture medium), and culture them in the dark at 28℃ for 2d. After the co-cultivation, move them to bud induction differentiation medium (add 6-BA with a final concentration of 1mg / L, TMT with a final concentration of 300mg / L, and Kan with a final concentration of 50mg / L on the basis of MS liquid culture medium). During this process, the culture medium is replaced every two weeks. When the resistant buds grew to 2 cm, they were cut off and transferred to the rooting medium to induce rooting and form complete plants. The formula of the rooting medium includes: adding indole-3-acetic acid (IAA) with a final concentration of 0.5 mg / L, TMT with a final concentration of 300 mg / L, and Kan with a final concentration of 50 mg / L to the MS liquid medium. Take some leaves and use the plant genomic DNA extraction kit (Tiangen, DP305) to extract DNA, using the plasmid pCAMBIA1302-miR828 Agrobacterium bacterial solution as a positive control, ddH 2 O was the blank control, SR1 tobacco was the negative control, and transgenic miR828 tobacco DNA was used as a template. The miR828-yF and miR828-yR specific primers were used to determine whether the plant was positive by PCR detection. The PCR reaction system is shown in Table 2, and the PCR reaction procedure is shown in Table 3. After the PCR reaction, 5 μL of the product was taken for agarose gel electrophoresis detection. Figure 8 As shown, Figure 8 In the figure, WT is wild-type tobacco, and OE-miR828 is transgenic tobacco with miR828 gene, indicating that miR828 transgenic tobacco has been successfully obtained.

[0096] (2) Expression analysis of transgenic miR828 tobacco

[0097] Total RNA from miR828 transgenic tobacco and wild-type tobacco (CK) was extracted using TRNzol Universal Total RNA Extraction Reagent (TianGen, DP424). Total RNA was reverse transcribed into cDNA (i.e., miRNA Firs t-Strand cDNA) using miRcute Enhanced miRNA cDNA First-Strand Synthesis Kit (TianGen, KR211). Mir-X miRNA qRT-PCR was performed using miR828-qF and miR828-qR as specific primers and u6 as the internal reference gene (the internal reference gene primers were U6-F and U6-R). Kit (Takara, Cat. No. 638314) was used for qRT-PCR validation, with four technical replicates and 2 -ΔΔCt The relative expression level of miR828 transgenic tobacco was calculated by the qRT-PCR method. The qRT-PCR reaction system is shown in Table 9, and the qRT-PCR reaction procedure is shown in Table 10.

[0098] Table 9 qRT-PCR reaction system

[0099]

[0100] Table 10 qRT-PCR reaction procedure

[0101]

[0102] The experimental results are as follows Fig. 9 As shown, in the transgenic miR828 tobacco, the expression of miR828 was significantly increased, and the expression level of miR828 was higher in the strain OE-miR828-2; the expression level of miR828 in the strain OE-miR828-1 was not significantly different from that in CK (wild type, i.e., tobacco without miR828 gene transfection), but was slightly higher than CK; the difference in the results between OE-miR828-1 and OE-miR828-2 may be due to the difference in gene expression in each plant.

[0103] (3) Determination of anthocyanin content in transgenic miR828 tobacco

[0104] The anthocyanin content was determined by the pH differential method. The anthocyanin content in the leaves of wild-type tobacco and transgenic miR828 tobacco was detected using a plant anthocyanin content detection kit (Solabo, BC1385).

[0105] Sample treatment: weigh about 0.1g sample (leaf), add 1mL extract, transfer to EP tube after full homogenization, dilute to 1mL, cover tightly, extract at 60℃ for 30min, shake several times during the period. Centrifuge at 12000rpm, room temperature for 10min, take the supernatant for testing.

[0106] Assay steps: Preheat the microplate reader for 30 minutes. Add the following reagents into a 96-well plate.

[0107]

[0108] After thorough mixing, the absorbances of the assay tube 1 and the assay tube 2 at 530 nm and 700 nm were measured respectively. The absorbance values ​​of the assay tube 1 at 530 nm and 700 nm were recorded as A1 and A1', respectively, and the absorbance values ​​of the assay tube 2 at 530 nm and 700 nm were recorded as A2 and A2', respectively.

[0109] Anthocyanin content (μmol / g mass) = [ΔA÷(ε×d)×10 3 ×F]×V 提取 ÷W=0.062×ΔA×F÷W; where ΔA=(A1-A1')-(A2-A2'); F is the dilution factor, which is 10 in this reaction system; d is the optical path of the 96-well plate, which is 0.6 cm; W is the sample mass (g); ε is the molar extinction coefficient of anthocyanins, 2.69×10 4 mL / mmol / cm; V 提取 is the total volume of the extract, 1 mL; 10 3 is the unit conversion factor, 1mmol=10 3 μmol.

[0110] Compared with the wild type (CK), the anthocyanin content in the leaves of transgenic tobacco was increased ( Fig.10 ), OE-miR828-1 was 0.71μmol / g, OE-miR828-2 was 1.03μmol / g, and the wild type was 0.67μmol / g. OE-miR828-2 was significantly higher than the wild type.

[0111] Example 4

[0112] (1) Expression of potato miR828 gene by pBWA(V)KS-miR828

[0113] The recombinant plasmid pBWA(V)KS-miR828 Agrobacterium was cultured overnight at 220 rpm and 28°C until OD 600=0.5. Centrifuge at 8000rpm for 10min to collect the bacteria. Resuspend the bacteria with an equal volume of 1 / 2MS liquid culture medium (i.e., the concentration of the components in the MS liquid culture medium is halved) and use it to infect potatoes. Place the 'Huasong 66' potato stem segments without axillary buds in the pre-culture medium. The pre-culture medium formula includes: adding 6-benzylaminoadenine (6-BA) with a final concentration of 1mg / L and 2,4-D with a final concentration of 0.1mg / L on the basis of the MS liquid culture medium. Pre-culture for 2 days at 25°C with a photoperiod of 16h light / 8h dark. Place the pre-cultured stem segments in the resuspended Agrobacterium bacterial solution, shake in a constant temperature shaking box at 28°C and 200rpm for 10min, use sterile filter paper to absorb the bacterial solution on the surface of the stem segments, and spread them flat on the potato co-culture medium. The formula of potato co-cultivation medium includes: on the basis of MS liquid medium, add 6-BA with a final concentration of 1 mg / L, 2,4-D with a final concentration of 0.1 mg / L, and AS with a final concentration of 100umol / L. Culture in the dark at 28℃ for 2 days. After the co-cultivation, move it to potato callus differentiation medium. The formula of potato callus differentiation medium includes: on the basis of MS liquid medium, add 6-BA with a final concentration of 2 mg / L, 2,4-D with a final concentration of 1 mg / L, TMT with a final concentration of 300 mg / L, and Kan with a final concentration of 50 mg / L. When callus tissue grows at both ends of the stem segment, transfer it to potato differentiation medium. The potato differentiation medium formula includes: adding 6-BA with a final concentration of 4 mg / L, NAA with a final concentration of 0.1 mg / L, GA3 with a final concentration of 1 mg / L, TMT with a final concentration of 300 mg / L, and Kan with a final concentration of 50 mg / L to the MS liquid medium. After the buds with leaves are differentiated, the differentiated seedlings are transferred to the MS liquid medium containing 300 mg / L (final concentration) TMT and 50 mg / L (final concentration) Kan to induce rooting and form complete plants. The screened positive plants and non-transgenic potato (CK) tissue culture seedlings are transplanted into flower pots (length 20 cm × width 20 cm) filled with moist nutrient soil: vermiculite = 3:1 (mass ratio) and placed in an artificial climate chamber for culture, 16h light / 8h dark, temperature of 25°C, relative humidity of 60%. After four months, the leaves of the potted potatoes wilted and turned yellow, and the transgenic potato tubers were harvested. Using transgenic potatoes and CK (wild type, i.e., potatoes without miR828 gene) as cDNA templates, miR828-qF and miR828-qR as specific primers, and u6 as the internal reference gene, qRT-PCR verification was performed using the miRcute enhanced miRNA fluorescence quantitative detection kit (SYBR Green) (Tiangen, FP411). The qRT-PCR reaction system is shown in Table 9, and the qRT-PCR reaction procedure is shown in Table 10. Four technical replicates were used, with 2-ΔΔCt The relative expression level of miR828 in pBWA(V)KS-miR828 transgenic potato was calculated by this method.

[0114] Silencing miR828 in purple potatoes, the expression of miR828 in pBWA(V)KS-miR828 transgenic potatoes was significantly reduced compared with CK ( Fig.11 ).

[0115] (2) Determination of anthocyanin content in pBWA(V)KS-miR828 transgenic potato tubers

[0116] The anthocyanin content was determined by the pH differential method. The anthocyanin content of wild-type potato tubers and transgenic potato tubers was detected using a plant anthocyanin content detection kit. The detection method is referred to Example 3.

[0117] Compared with wild-type (CK) potatoes, the anthocyanin content of potato tubers was significantly reduced after silencing miR828, with S828-2 at 0.35 μmol / g and S828-5 at 0.4 μmol / g, while that of the wild type was 0.69 μmol / g, which was significantly lower than that of the wild type ( Fig.12 and Fig.13 ).

[0118] Example 5 Positive detection and gene expression analysis of potatoes overexpressing miR828

[0119] (1) Gene expression in potato leaves and tubers overexpressing miR828

[0120] The Agrobacterium culture containing the recombinant plasmid pCAMBIA1302-miR828 was cultured overnight at 220 rpm and 28°C until the OD 600=0.5. Centrifuge at 8000rpm for 10min to collect the bacteria. Resuspend the bacteria with an equal volume of 1 / 2MS liquid culture medium (i.e., the concentration of the components in the MS liquid culture medium is halved) and use it to infect potatoes. Place the 'Huasong 66' potato stem segments without axillary buds in the pre-culture medium. The formula of the pre-culture medium includes: adding 6-BA with a final concentration of 1mg / L and 2,4-D with a final concentration of 0.1mg / L to the MS liquid culture medium. Pre-culture for 2 days at 25°C with a photoperiod of 16h light / 8h dark. Place the pre-cultured stem segments in the resuspended Agrobacterium bacterial solution, shake in a constant temperature shaking box at 28°C and 200rpm for 10min, use sterile filter paper to absorb the bacterial solution on the surface of the stem segments, and spread them flat on the potato co-culture medium. The formula of potato co-cultivation medium includes: adding 6-BA with a final concentration of 1 mg / L, 2,4-D with a final concentration of 0.1 mg / L, and AS with a final concentration of 100umol / L to the MS liquid medium. Culture in the dark at 28°C for 2 days. After the co-cultivation, move it to the potato callus differentiation medium. The formula of potato callus differentiation medium includes: adding 6-BA with a final concentration of 2 mg / L, 2,4-D with a final concentration of 1 mg / L, TMT with a final concentration of 300 mg / L, and Kan with a final concentration of 50 mg / L to the MS liquid medium. When callus tissue grows at both ends of the stem segment, transfer it to the potato differentiation medium. The potato differentiation medium formula includes: adding 6-BA with a final concentration of 4 mg / L, naphthaleneacetic acid (NAA) with a final concentration of 0.1 mg / L, GA3 with a final concentration of 1 mg / L, TMT with a final concentration of 300 mg / L, and Kan with a final concentration of 50 mg / L to the MS liquid medium. After the buds with leaves are differentiated, the differentiated seedlings are transferred to the MS liquid medium containing TMT with a final concentration of 300 mg / L and Kan with a final concentration of 50 mg / L to induce them to root and form complete plants. The screened positive plants and non-transgenic potato (CK) tissue culture seedlings are transplanted into flower pots (length 20 cm × width 20 cm) filled with moist nutrient soil: vermiculite = 3:1 (mass ratio) and placed in an artificial climate room for cultivation, 16h light / 8h dark, temperature of 25°C, relative humidity of 60%. Four months later, the leaves of the potted potatoes wilt and turn yellow, and the transgenic potato tubers are harvested. The transgenic potato tubers, leaves and CK were used as cDNA templates, miR828-qF and miR828-qR were used as specific primers, and u6 was used as the internal reference gene. The miRcute enhanced miRNA fluorescence quantitative detection kit (SYBR Green) (Tiangen, FP411) was used for qRT-PCR verification. The qRT-PCR reaction system is shown in Table 9, and the qRT-PCR reaction procedure is shown in Table 10. Four technical replicates were used, and 2 -ΔΔCtThe relative expression levels of miR828 in leaves and tubers of transgenic potatoes were calculated by this method.

[0121] Overexpression of miR828 in purple potatoes showed a significant increase in the expression level in leaves of transgenic miR828 potatoes compared with CK ( Fig.14 ). The transgenic potato tubers were harvested. The expression level of miR828 in OE-miR828-1 and OE-miR828-4 tubers was significantly higher than that in wild-type potatoes. Potato tubers overexpressing miR828 were successfully obtained ( Fig.15 ). OE-miR828-3 and OE-miR828-6 failed to produce potato tubers.

[0122] (2) Determination of anthocyanin content in miR828 transgenic potato tubers

[0123] The anthocyanin content was determined by the pH differential method. The anthocyanin content of wild-type potato tubers and transgenic potato tubers was detected using a plant anthocyanin content detection kit. The detection method is referred to Example 3.

[0124] The content of anthocyanin in the leaves of the wild type (CK) was negative, and basically contained no anthocyanin. After overexpression of miR828, the content of anthocyanin in potato leaves increased significantly, with OE-miR828-6 being the most significant, but the anthocyanin content in the leaves of other plants also increased to varying degrees ( Fig.16 In potato tubers overexpressing miR828, the purple color was significantly deepened and the anthocyanin content was significantly increased ( Fig.17 and Fig.18 ).

[0125] It can be seen from the above examples that miR828 is involved in regulating the biosynthesis of anthocyanins in plants. In miR828-overexpressed tobacco and potatoes, the expression of miR828 increased, and the content of anthocyanins also increased. When miR828 was silenced in purple potatoes, the expression of miR828 decreased, and the content of anthocyanins also showed a downward trend. The expression of miR828 can promote the biosynthesis of anthocyanins in plants.

[0126] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A colored potato miR828 gene, characterized in that: Includes the nucleotide sequence shown in SEQ ID NO:

1.

2. A vector comprising the colored potato miR828 gene according to claim 1.

3. Use of the colored potato miR828 gene according to claim 1 in anthocyanin accumulation.

4. Use of the vector according to claim 2 in anthocyanin accumulation.

5. The use according to claim 4, characterized in that: The vector overexpresses the miR828 gene.

6. A method for increasing the anthocyanin content of potatoes, characterized in that: The following steps are involved: Overexpressing the miR828 gene according to claim 1 in potatoes.

7. The method for increasing the anthocyanin content of potatoes according to claim 6, characterized in that: The following steps are involved: A recombinant expression vector containing the miR828 gene according to claim 1 is constructed, and the expression vector containing the miR828 gene is transferred into potatoes.

8. The method for increasing the anthocyanin content of potatoes according to claim 7, characterized in that: The recombinant expression vector is pCAMBIA1302-miR828.

9. The method for increasing the anthocyanin content of potatoes according to claim 8, characterized in that: The following steps are involved: (1) Construction of pCAMBIA1302-miR828 expression vector; (2) preparing Agrobacterium containing the pCAMBIA1302-miR828 expression vector; (3) Potatoes were infected with Agrobacterium containing the pCAMBIA1302-miR828 expression vector to prepare potatoes transformed with the miR828 gene.

Images