Molecular marker used as yak marker assisted selection and related to immune traits and application of molecular marker

Abstract

The invention provides a molecular marker used for yak marker assisted selection and related to immune traits and application of the molecular marker, and belongs to the technical field of molecular biological detection. The invention provides an SNP (Single Nucleotide Polymorphism) site related to immune traits of a yak. The SNP site is positioned at the 163688148th basic group of a first chromosome of a LUBosgruv3.0 version of a yak genome. According to the scheme, compared with a traditional detection method, the method for detecting the immune traits of the yak by utilizing the SNP site and the molecular marker based on the site has the advantages of high accuracy, high detection speed, low cost, easiness in result judgment and the like; the invention provides a new SNP molecular marker resource for non-diagnostic yak immune trait marker-assisted selection.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biological detection, and in particular relates to a molecular marker related to immune traits used as marker-assisted selection for yaks and an application thereof. Background Art

[0002] Yaks are a key livestock breed in the high-altitude pastoral areas of the Qinghai-Tibet Plateau and a vital component of the plateau's animal husbandry. Yaks have adapted to extreme natural conditions, such as high altitude, low air pressure, strong ultraviolet rays, lack of oxygen, and insufficient nutrition. They possess a resilient ability to survive and provide a variety of production and livelihood resources for pastoral areas, including meat, milk, wool, and hides. Yaks are not only a livelihood for plateau herders but also a significant symbol of their wealth. Furthermore, yaks represent a valuable genetic treasure trove, possessing unique biological characteristics, a robust physique, and a high degree of adaptability to harsh environments.

[0003] Currently, the yak industry still faces challenges in selecting and breeding for productive traits such as disease resistance and fertility. The small size of the yak herd makes it difficult to meet market demand. Furthermore, the development of breeding technology systems is relatively underdeveloped, hindering the sustainable development of the yak industry. These issues have become a key factor restricting the development of the yak industry.

[0004] Therefore, there is an urgent need to develop modern yak breeding methods, particularly strategies tailored to disease resistance. By screening for genes associated with disease resistance and using molecular genetics for marker-assisted selection, the genetic improvement of yaks will be accelerated, promoting the development of new breeds and the healthy development of the yak industry.

[0005] Research on the genetic basis of disease resistance, combined with molecular biology and genetic engineering technology, can effectively enhance the resistance and immunity of yaks to pathogens, thereby reducing the threat of diseases to yaks' health, reducing economic losses, and promoting the development of the yak industry in an efficient and sustainable direction. Summary of the Invention

[0006] The purpose of the present invention is to provide a molecular marker related to immune traits and its application as marker-assisted selection for yak.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] The present invention provides a SNP molecular marker associated with yak immune traits. The SNP molecular marker is located at the 163688148th base on chromosome 1 of the yak reference genome LU_Bosgru_v3.0 version, and the mutant base is C or T.

[0009] Preferably, when the base of the SNP site is C, the genotype is CC or CT; when the base of the SNP site is T, the genotype is TT; when the genotype is TT, the IgA and IgG of the yak individual are significantly higher than those of the genotype CC, and when the genotype is TT, the IgG of the yak individual is significantly higher than that of the genotype CT.

[0010] The present invention also provides the use of the SNP molecular marker in preparing products for detecting yak immunity or products for yak assisted breeding.

[0011] The present invention also provides a primer pair for amplifying the SNP molecular marker, and the sequence of the primer pair is shown in SEQ ID NOs: 2-3.

[0012] The present invention also provides the use of the primer pair in preparing a product for detecting yak immunity or a product for yak assisted breeding.

[0013] The present invention also provides a kit for detecting yak immunity, comprising a reagent for detecting the SNP molecular marker or the primer pair.

[0014] The present invention also provides a kit for yak assisted breeding, comprising a reagent for detecting the SNP molecular marker or the primer pair.

[0015] The present invention also provides a method for marker-assisted selection of yak immune traits for non-diagnostic purposes, comprising the following steps:

[0016] (1) Extracting yak genomic DNA;

[0017] (2) using the yak genomic DNA obtained in step (1) as a template, and performing amplification using the primer pair to obtain an amplified product;

[0018] (3) performing genotyping analysis on the amplified products to obtain yaks with different genotypes; correlating the genotypes of the yaks with immune indicators; and the immunoglobulin is immunoglobulin A or immunoglobulin G.

[0019] Preferably, the amplification system in step (2) is 25 μL in total, including: 12.5 μL of 2×L-Exp Taq Master Mix, 8.5 μL of RNase free water, 1 μL of upstream primer, 1 μL of downstream primer, and 2 μL of template.

[0020] Preferably, the amplification program in step (2) is: 94°C for 1 min, 98°C for 10 s, 58°C for 30 s, 72°C for 1 min, for a total of 35 cycles; and extension at 72°C for 2 min.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] This invention provides molecular markers related to immune traits for marker-assisted selection in yaks and their applications. According to the present invention, a method for detecting immune traits in yaks using single-nucleotide polymorphisms (SNPs) and molecular markers based on these sites offers advantages over traditional detection methods, such as high accuracy, rapid detection, low cost, and easy interpretation of results. This technology provides a new SNP molecular marker resource for marker-assisted selection of immune traits in yaks for non-diagnostic purposes. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.

[0024] Figure 1 is the PCR amplification product, where M represents Marker; 1, 2, and 3 represent three groups of repetitions.

[0025] Figure 2 The peak diagram and sequence obtained after sequencing the PCR product. DETAILED DESCRIPTION

[0026] The present invention provides a SNP molecular marker associated with yak immune traits. The SNP molecular marker is located at the 163688148th base on chromosome 1 of the yak reference genome LU_Bosgru_v3.0 version, and the mutant base is C or T.

[0027] In the present invention, when the base of the SNP site is C, the genotype is CC or CT; when the base of the SNP site is T, the genotype is TT; when the genotype is TT, the IgA and IgG of the yak individual are significantly higher than those of the genotype CC, and when the genotype is TT, the IgG of the yak individual is significantly higher than that of the genotype CT.

[0028] The present invention also provides the use of the SNP molecular marker in preparing products for detecting yak immunity or products for yak assisted breeding.

[0029] The present invention also provides a primer pair for amplifying the SNP molecular marker, and the sequence of the primer pair is shown in SEQ ID NOs: 2-3.

[0030] The present invention also provides the use of the primer pair in preparing a product for detecting yak immunity or a product for yak assisted breeding.

[0031] The present invention also provides a kit for detecting yak immunity, comprising a reagent for detecting the SNP molecular marker or the primer pair.

[0032] The present invention also provides a kit for yak assisted breeding, comprising a reagent for detecting the SNP molecular marker or the primer pair.

[0033] The present invention also provides a method for marker-assisted selection of yak immune traits for non-diagnostic purposes, comprising the following steps:

[0034] (1) Extracting yak genomic DNA;

[0035] (2) using the yak genomic DNA obtained in step (1) as a template, and performing amplification using the primer pair to obtain an amplified product;

[0036] (3) performing genotyping analysis on the amplified products to obtain yaks with different genotypes; correlating the genotypes of the yaks with immune indicators; and the immunoglobulin is immunoglobulin A or immunoglobulin G.

[0037] In the present invention, the amplification system described in step (2) is 25 μL in total, including: 2×L-Exp TaqMasterMix 12.5 μL, RNase free water 8.5 μL, upstream primer 1 μL, downstream primer 1 μL, and template 2 μL.

[0038] In the present invention, the amplification program in step (2) is: 94°C for 1 min, 98°C for 10 s, 58°C for 30 s, 72°C for 1 min, for a total of 35 cycles; and extension at 72°C for 2 min.

[0039] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0040] Example 1

[0041] 1. Sample collection

[0042] The invention uses the Niangya yak breed as the detection object, collects 5mL of blood samples from 192 fasting yaks from the Jiali County pasture in Nagqu City, Tibet Autonomous Region, and puts them into clean pro-coagulant vacuum blood collection tubes. The samples are allowed to stand for 30 minutes, then centrifuged at 3500r / min for 10 minutes, and the supernatant is aspirated into a PE tube, which is sealed and stored in a -20℃ low-temperature refrigerator. Another 5mL of blood sample is collected into a blood collection tube with EDTA-K2 anticoagulant added. After the blood sample is collected, it is quickly mixed and temporarily placed in a sampling box containing an ice pack. After being transported back to the laboratory, it is frozen in a -20℃ refrigerator for genomic DNA extraction.

[0043] 2 Main reagents and instruments

[0044] EDTA-K2 vacuum blood collection tubes were purchased from Jiangsu Yuli Medical Instrument Co., Ltd.; a blood genomic DNA extraction kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; a NanoDrop 2000 spectrophotometer was purchased from Thermo Fisher Scientific (USA); DL2000 Marker, agarose, and nucleic acid dyes were purchased from Beijing Solebold Technology Co., Ltd.; 2×L-Exp Taq MasterMix (dye plus) was purchased from Hunan Aikerui Bioengineering Co., Ltd.; an electrophoresis instrument was purchased from Beijing Liuyi Instrument Factory; and a PCR instrument was purchased from BioRad. IgA (MB-4907A), IgG (MB-4616A), and IgM (MB-4908A) detection kits were purchased from Jiangsu Enzyme Biotechnology Co., Ltd.

[0045] 3 Methods

[0046] 3.1 Immunoglobulin IgA, IgG, and IgM testing

[0047] The double-antibody one-step sandwich assay was performed using the IgA, IgG, and IgM detection kits from Jiangsu Enzyme Biotechnology Co., Ltd. First, remove the desired strips from the aluminum foil pouch after equilibration at room temperature for 20 minutes. The remaining strips were sealed in ziplock bags and returned to 4°C. Standard and sample wells were set up, with 50 μL of standard solution of varying concentrations added to each well. Sample wells were first loaded with 10 μL of the sample to be tested, followed by 40 μL of sample diluent. No sample was added to the blank wells. In addition to the blank wells, 100 μL of horseradish peroxidase (HRP)-labeled detection antibody was added to each well. The wells were sealed with sealing film and incubated at 37°C in a waterbath or incubator for 60 minutes. The liquid was discarded and patted dry on absorbent paper. Wash solution was then filled to the top of each well, left for 1 minute, then the wash solution was discarded and patted dry on absorbent paper. This process was repeated five times (a plate washer can also be used). Substrates A and B were added to each well, each with 50 μL each, and incubated at 37°C in the dark for 15 minutes. Add 50 μL of stop solution to each well and measure the OD value of each well at a wavelength of 450 nm within 15 minutes. Finally, draw a standard curve: In an Excel worksheet, plot the standard concentration as the horizontal axis and the corresponding OD value as the vertical axis. Draw a linear regression curve for the standard. Calculate the IgA, IgG, and IgM concentrations of each sample according to the curve equation.

[0048] 3.2 Extraction of genomic DNA from blood

[0049] Genomic DNA was extracted from blood samples using the blood genomic DNA extraction kit from Tiangen Biochemical Technology (Beijing) Co., Ltd. The extracted DNA was placed under an ultraviolet spectrophotometer to detect the concentration and purity. The concentration was >20 ng / μL and the OD 260 / OD 280A value between 1.7 and 1.9 meets the experimental needs and can be stored at -20°C for future use.

[0050] 3.3 Primer design

[0051] Using genomic DNA as template, a pair of specific primers were designed using PrimerPremier5.0 software.

[0052] Specific primer sequences:

[0053] 5'-ACTAAGATCCCATGAGCCA-3'(SEQ ID NO:2)

[0054] 5'-ATTGAATGAGACACCACCAG-3'(SEQ ID NO:3)

[0055] The amplified fragment was 519 bp in length, and the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0056] 3.4 PCR amplification and sequencing

[0057] PCR amplification system 25uL: 2×L-Exp Taq MasterMix (dye plus) 12.5μL, RNase free water 8.5μL, upstream primer 1μL, downstream primer 1μL, template 2μL.

[0058] PCR amplification program: 94°C for 1 min, 98°C for 10 s, 58°C for 30 s, and 72°C for 1 min, for a total of 35 cycles; extension at 72°C for 2 min.

[0059] The PCR products were detected by 1% agarose gel electrophoresis. After the PCR products passed the agarose gel electrophoresis test, they were sequenced by direct sequencing. The sequencing was completed by Beijing Qingke Biotechnology Co., Ltd.

[0060] The bioanalysis software MEGA 11.0 was used to compare the sequencing results of PCR products, analyze the sequencing peak graphs, and complete the typing.

[0061] 4 Statistical analysis

[0062] Based on the genotyping results, the number of individuals with different genotypes at each locus was counted. Popgen32 software was used to calculate the g163688148C>T gene frequency, genotype frequency, effective number of alleles (Ne), locus heterozygosity (He), and Hardy-Weinberg equilibrium test. PIC (polymorphism information content) software was used to calculate the polymorphism information content. General linear models in IBM SPSS Statistics 26 were used to analyze the associations between different yak genotypes and immunoglobulins IgA, IgG, and IgM. Results are presented as mean ± standard error.

[0063] 5 Results

[0064] 5.1 PCR amplification and sequencing results

[0065] The amplified product of the g163688148C>T site on yak chromosome 1 was detected by 1% agarose gel (see Figure 1 ), the bands were clear without any other bands, the specificity was good, and the PCR product fragment size was 519 bp, which was in line with the expected size, so the next experiment could be carried out.

[0066] The sequence of SEQ ID NO: 1 is:

[0067] ACTAAGATCCCATGAGCCACAGAGGAACAACTAAGCCCGTGCACTGCAGCTAGAGAGTCTGAGGGCAGCGAGGAAGGTCCCGCATGCTGAAA CTAAGACCCGACGCAGCCCAATAAATAAGCAAAATGCTGTGGTGATGCTACACGGTGACCTCGTCCCCCCACCTAGCTTTCTGTAAAGCCCCACACTCAGGCGGAACCACTGCTGCGGACAGGCAACAGGCGGGCAGGTGATCTTGTCTTGTGAAAATCAATTCAGGGCTCCTAGAGCTCCTGCCGTGTGTGGCCCATTGGAGTGGCCCTGCAGCGCCTCGGCCAGCCAGCTCCTAGGTCCTCACGGCCATCAGGAGGGTGGCCTGGGGCTTCGATGTCCTCTGTCCACACCCTCTCCCGGACGGTCTCACTCACTCATGTGGTTCCACGTGCTGTGGGCTTTCACACCTCCAGCTGGCCCTCCAGCTGATCTGACCCAGGCATTCACCTGCCCACTGGGCATCTTCCTGGTGGTGTCTCATTCAAT

[0068] The peak map and sequence obtained after purification and sequencing of the PCR product are shown in Figure 2 . It can be seen from Figure 2 that there is a C-T mutation at the g163688148C>T locus, and there are three genotypes: CC, CT, and TT.

[0069] 5.2 Statistical analysis results

[0070] The genotypes and allele frequencies of the g163688148C>T SNP locus on chromosome 1 of yaks were analyzed from the perspective of population genetics. As shown in Table 1, at the g163688148C>T SNP locus, the CC genotype frequency is the highest, which is the dominant genotype, and the C allele frequency is 65.9%, showing the dominant allele. By χ 2 adaptive test showed that the SNP locus conformed to the Hardy-Weinberg equilibrium state (P>0.05) (Table 1). The expected heterozygosity of this locus was 0.449, and the PIC was 0.348. 0.25<PIC<0.50, belonging to moderate polymorphism.

[0071] Table 1 Polymorphism of the g163688148C>T SNP locus on chromosome 1 of yaks

[0072]

[0073] 5.3 Association Analysis between Different Genotypes and Immunoglobulin IgA, IgG, and IgM. General linear models were used in IBM SPSS Statistics 26 software to analyze the association between different genotypes and the levels of immunoglobulins IgA, IgG, and IgM in yaks. The results showed that IgA and IgG levels were significantly higher in yaks with the TT genotype than in those with the CC genotype (p < 0.05). Similarly, IgG levels were significantly higher in yaks with the TT genotype than in those with the CT genotype (p < 0.05). However, there were no significant differences in IgA and IgG between yaks with the CC and CT genotypes (p > 0.05). Furthermore, there were no significant differences in IgM levels between the three genotypes (p > 0.05). This suggests that the base sequence at the g163688148C > T site on chromosome 1 is significantly associated with IgA and IgG levels in yaks (p < 0.05), making it a SNP marker associated with yaks. The results are shown in Table 2.

[0074] Table 2 Correlation analysis between different genotypes and IgA, IgG, IgM

[0075]

[0076] Note: Data in the same row with different lowercase letters indicate significant differences (P<0.05).

[0077] The SNP molecular marker described in the present invention is located at the 163688148th base on chromosome 1 of the reference yak genome LU_Bosgru_v3.0 version; the variation type is C / T, named g163688148C>T, and there are three genotypes. When the 163688148th base on chromosome 1 is C, the genotype is CC or CT; when the 163688148th base on chromosome 1 is T, the genotype is TT; by not Correlation analysis between genotypes and IgA, IgG, and IgM levels revealed that yaks with the TT genotype had significantly higher IgA and IgG levels than those with the CC genotype (p < 0.05). Similarly, yaks with the TT genotype had significantly higher IgG levels than those with the CT genotype (p < 0.05). However, there were no significant differences in IgA and IgG between yaks with the CC and CT genotypes (p > 0.05), and no significant differences in IgM between the three genotypes (p > 0.05). By detecting the base at nucleotide position 163,688,148 on chromosome 3, the immunoglobulin A and immunoglobulin G levels of yaks can be determined. This study provides a new SNP molecular marker resource for marker-assisted selection of yak immune traits for non-diagnostic purposes.

[0078] As can be seen from the above examples, the present invention provides molecular markers related to immune traits for marker-assisted selection in yaks and their applications. According to the present invention, the method for detecting immune traits in yaks using SNPs and molecular markers based on these sites offers advantages over traditional detection methods, such as high accuracy, rapid detection, low cost, and easy interpretation of results. This technology provides a new SNP molecular marker resource for marker-assisted selection of immune traits in yaks for non-diagnostic purposes.

[0079] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A SNP molecular marker associated with yak immune traits, characterized in that: The SNP molecular marker is located at the 163688148th base on chromosome 1 of the yak reference genome LU_Bosgru_v3.0 version, and the mutant base is C or T.

2. The SNP molecular marker according to claim 1, characterized in that: When the base of the SNP site is C, the genotype is CC or CT; when the base of the SNP site is T, the genotype is TT; when the genotype is TT, the IgA and IgG of individual yaks are significantly higher than those of the genotype CC, and when the genotype is TT, the IgG of individual yaks is significantly higher than that of the genotype CT.

3. Use of the SNP molecular marker described in claim 1 or 2 in the preparation of products for detecting yak immunity or products for yak assisted breeding.

4. A primer pair for amplifying the SNP molecular marker according to claim 1 or 2, characterized in that: The sequences of the primer pairs are shown in SEQ ID NOs: 2-3.

5. Use of the primer pair according to claim 4 in preparing a product for detecting yak immunity or a product for yak assisted breeding.

6. A kit for detecting yak immunity, characterized in that: It comprises a reagent for detecting the SNP molecular marker according to claim 1 or 2 or a primer pair according to claim 4.

7. A kit for yak assisted breeding, characterized in that: Contains a reagent for detecting the SNP molecular marker according to claim 1 or 2 or a primer pair according to claim 4.

8. A method for marker-assisted selection of yak immune traits for non-diagnostic purposes, characterized in that: The steps include: (1) Extracting yak genomic DNA; (2) using the yak genomic DNA obtained in step (1) as a template, and performing amplification using the primer pair described in claim 4 to obtain an amplified product; (3) Performing genotyping analysis on the amplified products to obtain yaks with different genotypes; correlating the genotypes of the yaks with immune indicators; and the immunoglobulin is immunoglobulin A or immunoglobulin G.

9. The method according to claim 8, characterized in that The amplification system described in step (2) is 25 μL in total, including: 12.5 μL of 2×L-Exp Taq MasterMix, 8.5 μL of RNase free water, 1 μL of upstream primer, 1 μL of downstream primer, and 2 μL of template.

10. The method according to claim 8, characterized in that The amplification program described in step (2) is: 94°C for 1 min, 98°C for 10 s, 58°C for 30 s, 72°C for 1 min, for a total of 35 cycles; and extension at 72°C for 2 min.

Images