Halophilic alpha-galactosidase mutant E278S activated by metal ions and application of halophilic alpha-galactosidase mutant E278S

Abstract

The invention discloses a halophilic alpha-galactosidase mutant E278S activated by metal ions and application of the halophilic alpha-galactosidase mutant E278S, and relates to the technical field of genetic engineering. The amino acid sequence of the mutant E278S is as shown in SEQ ID NO. 1. The optimal pH of the mutant E278S is 4.5, the optimal temperature is 40 DEG C, compared with a recombinant wild enzyme with an amino acid sequence as shown in SEQ ID NO.5, the enzyme activity of the E278S is extremely low in a salt-free reaction system, and after metal salts with low concentrations of 10.0 mM and 100.0 mM and NaCl, NaF, CH3COONa and Na2SO4 with medium and high concentrations are added into the system, the activity of the E278S can be activated to different degrees, so that the mutant E278S can be used for preparing the recombinant wild enzyme. The characteristic of salt activation is favorable for controlling the catalytic reaction by adjusting the salt concentration, and the catalyst can be better applied to the harsh industrial fields requiring high salt concentration, such as food processing, brewing, feed, papermaking and the like.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a metal ion-activated and halophilic alpha-galactosidase mutant E278S and an application thereof. Background Art

[0002] α-galactosidase (EC 3.2.1.22) is a kind of exohydrolase that can be isolated from plants, animals and microorganisms. It has a wide range of sources and can specifically catalyze the hydrolysis of the non-reducing terminal α-galactosidic bond to release the non-reducing terminal galactose. Substrates and receptors containing non-reducing terminal α-galactosidic bonds are widely distributed in nature, so α-galactosidase is also one of the enzyme preparations with the most application potential. α-galactosidase from different sources has important applications in food, feed, papermaking, and even medical industries.

[0003] The advantage of halophilic enzymes is that they can maintain high catalytic activity and stability in high-salt environments. Therefore, they can be used in high-salt food and seafood processing. Processing food in a high-salt environment can not only prevent contamination by other microorganisms, but also reduce the production cost caused by sterilization and disinfection, and improve production efficiency. For example, in the soy sauce brewing industry, which requires high salt concentrations, beans rich in galactomannan are its main raw materials, and α-galactosidase can synergistically degrade galactomannan. Therefore, halophilic α-galactosidase has a high application value in the production of liquid fermented soy sauce with high NaCl concentrations. In addition, adding α-galactosidase to soy foods can solve the problem of abdominal distension caused by the fermentation and decomposition of anti-nutritional factors such as α-galactoside oligosaccharides in the intestines, and increase the body's absorption and utilization of the nutrients in soy products.

[0004] Soybean meal is the main component of animal feed, but monogastric animals cannot digest and absorb α-galactosides in soybean meal, while α-galactosidase can hydrolyze this type of substance into galactose and sucrose that can be used by animals, which can not only improve feed utilization, but also solve the problem of animal gastrointestinal flatulence caused by anti-nutritional substances; α-galactosidase can also cooperate with β-mannanase to hydrolyze galactomannan, reduce the viscosity of gastrointestinal contents, and improve feed utilization; calcium, magnesium, copper, zinc, manganese and iron are the main essential mineral elements for animals, but metal ions in the diet and gastrointestinal tract will affect the activity and stability of feed enzyme preparations. Therefore, the development of a metal ion-activated and halophilic α-galactosidase is beneficial for its application in the production of feed enzyme preparations and the feed industry.

[0005] As a raw material for papermaking, cork is mainly composed of hemicellulose composed of arabinoxylan and galactoglucomannan, and a-galactosidase can separate a-galactose at the end of galactoglucomannan from its carbon chain skeleton. Therefore, paper made from cork pulp treated with xylanase, mannanase and a-galactosidase can significantly improve the bleaching effect; in addition, sodium sulfate has many uses in the papermaking industry and can be used as a bleaching agent, strength agent, wetting agent and softener for paper to improve the quality, printing performance and feel of paper. Therefore, the development of a metal ion-activated and salt-loving α-galactosidase has potential application value in the papermaking industry.

[0006] In summary, the development of a metal ion-activated and halophilic α-galactosidase is of great significance for food processing, brewing, feed, papermaking and other demanding industrial industries that require high salt concentrations. The salt-activated characteristic of halophilic enzymes is conducive to controlling the catalytic reaction by adjusting the salt concentration, and can be better applied in high-salt environments, improving the quality of processed products, saving costs and increasing productivity. Summary of the invention

[0007] The purpose of the present invention is to provide a metal ion activated and halophilic α-galactosidase mutant E278S and its application. The mutant has the characteristics of being activated by metal ions and being halophilic, and can be activated by low concentration metal ions and medium and high concentrations of NaCl, NaF, CH3COONa, and Na2SO4. In 10.0mM and 100mM metal ions, the enzyme activity of the mutant E278S can be activated by 1.531-9.129 and 1.449-22.596 times respectively; in the final concentrations of 0.1-4M NaCl, 0.1-0.7M NaF, 0.1-3.5M CH3COONa, and 0.1-2M Na2SO4, the enzyme activity of the mutant E278S can be activated by 27.22, 32.17, 24.73, and 11.44 times respectively. The E278S provided by the present invention is conducive to controlling the catalytic reaction by adjusting the salt concentration, and can be better applied to harsh industrial fields requiring high salt concentrations, especially to industries such as food processing, brewing, feed, and papermaking.

[0008] In order to achieve the above-mentioned object, the present invention provides a metal ion-activated and halophilic α-galactosidase mutant E278S, the amino acid sequence of which is shown in SEQ ID NO.1, and the amino acid sequence of which is obtained by mutating the glutamic acid at position 278 of the recombinant wild α-galactosidase 4NZJ to serine, and the activity of which can be activated by metal ions and NaCl, NaF, CH3COONa, and Na2SO4.

[0009] The present invention provides a gene encoding the above-mentioned metal ion-activated and halophilic α-galactosidase mutant E278S, and its nucleotide sequence is shown in SEQ ID NO.2.

[0010] The present invention also provides a recombinant expression plasmid comprising the above encoding gene.

[0011] Preferably, the above recombinant plasmid is selected from pET series vectors, more preferably pET-28a(+).

[0012] The present invention also provides a recombinant bacterium comprising the above encoding gene.

[0013] Preferably, the above-mentioned recombinant bacteria is selected from Escherichia coli, more preferably from BL21 (DE3).

[0014] The metal ion activated and halophilic α-galactosidase mutant E278S provided by the present invention can be better applied in the biotechnology field requiring high salt concentration, especially in the technical fields of food processing, brewing, feed, papermaking, biosynthesis, etc. The mutant is also used to regulate the rate of enzymatic reactions in real time.

[0015] The metal ion-activated and halophilic α-galactosidase mutant E278S provided by the present invention mainly solves the problem that the activity of wild α-galactosidase is inhibited by metal ions and the activity is reduced by adding salt, and has the following advantages:

[0016] Compared with the recombinant wild α-galactosidase 4NZJ, the mutant E278S provided by the present invention has significantly improved enzyme activity after adding low concentrations of metal ions and medium and high concentrations of NaCl, NaF, CH3COONa and Na2SO4. The optimum pH of the purified wild enzyme 4NZJ and the mutant enzyme E278S are 6.0 and 4.5, respectively, and the optimum temperatures are 50°C and 40°C, respectively. Enzymatic reactions were carried out in 10.0 mM and 100.0 mM CuCl2, CuSO4, FeCl3, Fe2(SO4)3, ZnCl2, ZnSO4, MgCl2, MgSO4, CH3COO(Mg)2, MnCl2, MnSO4, CaCl2, CH3COO(Ca)2, BaCl2, CH3COO(Ba)2, and CoCl2. Except for 100 mM BaCl2 and CH3COO(Ba)2, the other metal salts tested at 10.0 mM and 100.0 mM all had inhibitory effects on the recombinant wild enzyme 4NZJ to varying degrees. For the mutant E278S, among the 10.0mM metal ions measured, except CuCl2, CuSO4, FeCl3, and Fe2(SO4)3, which inhibit enzyme activity, the other metal ions all have an activating effect on E278S, which can activate it 1.531 to 9.129 times; among the 100.0mM metal ions measured, except CuCl2, CuSO4, FeCl3, Fe2(SO4)3, and ZnCl2, which inhibit enzyme activity, the other metal ions all have an activating effect on E278S, which can activate it 1.449 to 22.596 times. The enzymatic reaction was carried out in the final concentrations of 0.1-4M NaCl, 0.1-0.7M NaF, 0.1-3.5M CH3COONa and 0.1-2M Na2SO4. Especially in the high concentration salt solution, the enzymatic activity of the recombinant wild enzyme 4NZJ was inhibited to varying degrees, but the enzymatic activity of the mutant E278S could be activated to varying degrees. When NaCl with a final concentration of 0.1-4M was added to the reaction system, the relative enzyme activity of E278S reached the highest level in 4M NaCl, which was 27.22 times that of the enzyme activity without NaCl; in the reaction system containing a final concentration of 0.1-0.7M NaF, the relative enzyme activity of E278S reached the highest level in 0.6M NaF, which was 32.17 times that of the enzyme activity without NaF; when CH3COONa with a final concentration of 0.1-3.5M was added to the reaction system, the relative enzyme activity of E278S reached the highest level in 3.5M CH3COONa, which was 24.73 times that of the enzyme activity without CH3COONa; in the reaction system containing a final concentration of 0.1-2M Na2SO4, the relative enzyme activity of E278S reached the highest level in 1.5M Na2SO4, which was 11.44 times that of the enzyme activity without Na2SO4.In summary, the activation effects of the four neutral salts tested in the present invention on E278S are as follows: NaF>NaCl>CH3COONa>Na2SO4. The salt-activated characteristic of the mutant E278S is conducive to controlling the catalytic reaction by adjusting the salt concentration, and can be better applied to demanding industrial fields that require high salt concentrations. For example, in industries such as food processing, brewing, feed, and papermaking, production costs can be greatly reduced and production efficiency can be improved. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The SDS-PAGE analysis results of the recombinant wild enzyme 4NZJ and mutant E278S in the present invention are shown.

[0018] Figure 2 These are the activity test results of the recombinant wild enzyme 4NZJ and mutant E278S in the present invention at different pH values.

[0019] Figure 3 These are the results of stability tests of the recombinant wild enzyme 4NZJ and mutant E278S in the present invention at different pH values.

[0020] Figure 4 The thermal activity test results of the recombinant wild enzyme 4NZJ and mutant E278S in the present invention are shown.

[0021] Figure 5 The results of the thermal stability test of the recombinant wild enzyme 4NZJ and mutant E278S at 37°C in the present invention are shown.

[0022] Figure 6 The results of the activity determination of the recombinant wild enzyme 4NZJ and the mutant E278S in NaCl in the present invention are shown.

[0023] Figure 7 The results of the activity determination of the recombinant wild enzyme 4NZJ and the mutant E278S in NaF of the present invention are shown.

[0024] Figure 8 These are the activity assay results of the recombinant wild enzyme 4NZJ and mutant E278S in CH3COONa of the present invention.

[0025] Fig. 9 These are the activity test results of the recombinant wild enzyme 4NZJ and mutant E278S in Na2SO4 of the present invention. DETAILED DESCRIPTION

[0026] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0027] Some experimental materials and reagents used in this invention:

[0028] 1) Strains and vectors: Escherichia coli BL21 (DE3) was purchased from Beijing Biomed Gene Technology Co., Ltd.; pET-28a (+) expression vector was from Jiangsu Suzhou Hongxun Biotechnology Co., Ltd.

[0029] 2) Enzymes and other biochemical reagents: p-nitrophenyl-α-D-galactopyranoside (pNPG) was purchased from Shanghai Yuanye Biotechnology Co., Ltd.; Nickel-NTA protein purification resin was purchased from QIAGEN; plasmid minipreparation kit was purchased from Omega; QuickMutation TM The gene site-directed mutagenesis kit was purchased from Beyotime Biotechnology Co., Ltd.; Dpn1 digestive enzyme was purchased from Takara Biotechnology Co., Ltd.; low molecular weight standard protein marker was purchased from Takara Biotechnology Co., Ltd.; IPTG was purchased from Solebao Technology Co., Ltd.

[0030] 3) Culture medium: LB culture medium: Peptone 10g, Yeast extract 5g. NaCl 10 g, add distilled water to 1000mL, pH natural (about 7). Solid culture medium plus 2.0% (w / v) agar.

[0031] Note: The molecular biology experimental methods not specifically described in the following examples are all carried out with reference to the specific methods listed in the book Molecular Cloning Experiment Guide (3rd Edition) by J. Sambrook, or according to the kits and product instructions.

[0032] Experimental Example 1 Construction and transformation of mutant E278S expression vector

[0033] 1) The amino acid sequence of α-galactosidase 4NZJ (numbered CAH07128.1) and the nucleotide sequence of the coding gene 4nzj (numbered CR626927.1) as shown in SEQ ID NO.3 were downloaded from GenBank, and after removing the sequence encoding the signal peptide of 4nzj (the 69-base sequence after the start codon ATG), Suzhou Hongxun Biotechnology Co., Ltd. was commissioned to perform codon optimization on the sequence encoding the mature peptide of 4nzj. After optimization, the nucleotide sequence of α-galactosidase optimized gene 4nzj as shown in SEQ ID NO.6 was obtained, and a recombinant expression plasmid 4nzj-pET-28a(+) containing the optimized gene 4nzj was constructed, and the recombinant expression plasmid 4nzj-pET-28a(+) was transferred into BL21(DE3), and finally a recombinant expression strain BL21(DE3) / 4nzj containing the optimized gene was obtained. The protein expressed by the optimized gene is the optimized wild enzyme 4NZJ, and its amino acid sequence is shown in SEQ ID NO.5.

[0034] 2) The recombinant expression strain (BL21(DE3) / 4nzj) containing the recombinant expression plasmid 4nzj-pET-28a(+) obtained above was inoculated into LB medium (containing 50 μg / mL kanamycin) at a concentration of 0.1%, cultured overnight at 37°C and 180 rpm, and the plasmid was extracted using a plasmid extraction kit.

[0035] 3) Using the recombinant expression plasmid 4nzj-pET-28a(+) as a template, use CE Design or DNAMAN to design two mutation primers (F and R). The specific sequences are shown below. TM The gene site-directed mutagenesis kit was used for mutation, and the PCR reaction parameters were: 95°C pre-denaturation for 3 min; then 95°C denaturation for 30 sec, 65°C annealing for 30 sec, 68°C extension for 7 min, 20 cycles; 68°C extension and completion for 15 min; 4°C cooling for 30 min. PCR amplification obtained a linearized recombinant plasmid e278s-pET-28a(+) containing the coding gene e278s shown in SEQ ID NO.2, and the coding gene encoded a mutant E278S, whose amino acid sequence is shown in SEQ ID NO.1.

[0036] The mutation primer sequences are as follows (5'→3'):

[0037] F (SEQ ID NO.7):

[0038] ATAGCTGTGCAGTTGGGGCCAGCGCGAACCT;

[0039] R (SEQ ID NO.8):

[0040] CCAACTGCACACGCTATACACAATGCTGCGGT.

[0041] 4) The PCR product was digested with Dpn1 enzyme at 37°C for 3 h.

[0042] 5) Transformation and identification: The digestion product was transferred into Escherichia coli BL21 (DE3) by heat shock to obtain a recombinant strain BL21 (DE3) / e278s containing the E278S encoding gene e278s. It was further confirmed by sequencing by Kunming Shenggong Biotechnology Co., Ltd. that the nucleotide sequence of the mutant E278S encoding gene is shown in SEQ ID NO.2. At the same time, it can be seen that the amino acid sequence of the mutant E278S is shown in SEQ ID NO.1. Compared with the optimized wild enzyme 4NZJ (SEQ ID NO.5) amino acid sequence, E278S is a mutation of the glutamic acid residue at position 255 to serine.

[0043] Description: E278 refers to the glutamic acid at position 278 of the wild α-galactosidase 4NZJ (SEQ ID NO.3) including the signal peptide; E278S refers to the mutation of the amino acid residue glutamic acid at position 255 of the optimized wild enzyme 4NZJ (SEQ ID NO.5) to serine, and its amino acid sequence is shown in SEQ ID NO.1.

[0044] Experimental Example 2 Preparation of recombinant wild α-galactosidase 4NZJ and mutant E278S

[0045] 1) The recombinant strains BL21(DE3) / 4nzj and BL21(DE3) / e278s obtained in Experimental Example 1 were inoculated into LB medium (containing 50 μg / mL kanamycin) at an inoculum size of 0.1%, and activated by shaking at 37°C and 180 rpm for about 12 h.

[0046] 2) The activated bacterial solution in 1) was inoculated into fresh LB (containing 50 μg / mL kanamycin) culture medium at a 1% inoculum volume, and cultured in a shaking incubator at 37°C and 180 rpm for about 2 to 3 h (OD 600 After reaching 0.6-1.0), IPTG with a final concentration of 0.7 mM was added for induction, and shaking culture was continued at 20°C and 160 rpm in a shaker for about 20 h to induce the production of recombinant protein.

[0047] 3) Centrifuge at 4°C and 6000 rpm for 8 min to collect the cells. Suspend the cells with an appropriate amount of 0.2 MM ClIlvaine buffer (pH = 7.0) and disrupt the cells by ultrasonic wave in a low-temperature water bath. Centrifuge the above intracellular concentrated crude enzyme solution at 12000 rpm for 30 min, aspirate the supernatant and affinity and purify the target protein with Nickel-NTA Agarose and 0-500 mM imidazole respectively. The SDS-PAGE results of the two purified proteins are as follows: Figure 1 As shown, M is a protein marker, 4NZJ is a wild enzyme, and E278S is a mutant. The results show that the recombinant wild enzyme 4NZJ and the mutant E278S were expressed and purified, and the product was a single band.

[0048] 4) Add 100 times the volume of the purified protein sample (pH = 7.0 McIlvaine buffer) to the dialysis device. Cut the dialysis bag (mw: 14000) into small pieces of appropriate length (10-20cm), boil it in boiling water for 30 minutes, and then thoroughly wash the dialysis bag with distilled water. Put the purified recombinant wild enzyme JB13GH39P28 and mutant D41G obtained in 3) into the dialysis bag respectively, and clamp the two ends of the dialysis bag with 3-5cm of length reserved with dialysis clips. Place the dialyzed sample in the dialysis buffer and dialyze at 4℃. Change the dialysis solution every 2 hours, and change it 3 times.

[0049] Experimental Example 3 Determination of properties of recombinant wild-type α-galactosidase 4NZJ and mutant E278S

[0050] The enzyme activity was determined by the pNP method: p-nitrophenyl-α-D-galactopyranoside (pNPG) was used as a substrate to determine the activity of the recombinant wild enzyme 4NZJ and the mutant E278S. A pNPG solution with a final concentration of 2 mM was prepared and adjusted to the corresponding pH. The reaction system contained 50 μL of enzyme solution and 450 μL of 2 mM pNPG substrate. The substrate was preheated at the reaction temperature for 5 min, and 50 μL of appropriately diluted enzyme solution was added to react for 10 min. Then 2 mL of 1 M Na2CO3 was added to terminate the reaction. After cooling to room temperature, the amount of pNP released was measured at a wavelength of 405 nm. At the same time, a control was set up for each group, that is, 2 mL of 1 M Na2CO3 was added to terminate the reaction and then the enzyme solution was added. One enzyme activity unit (U) is defined as the amount of enzyme required to decompose the substrate to produce 1 μmol pNP per minute.

[0051] Enzyme activity determination method: The enzyme activity calculation formula is as follows:

[0052] Enzyme activity (U / mL) = c×n / (t×V)

[0053] Wherein: c is the amount of p-nitrophenol after the enzyme reaction calculated by the p-nitrophenol standard equation (μmol); n is the enzyme solution dilution multiple; t is the enzyme and substrate reaction time (min); V is the volume of the enzyme solution involved in the reaction (mL).

[0054] 1) Activity determination of recombinant wild-type enzyme 4NZJ and mutant E278S at different pH

[0055] The purified enzyme in Experimental Example 3 was placed in a pH = 3.0-9.0 buffer (pH = 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 8.0: McIlvaine buffer; pH = 9.0: 0.2 mol / L Glycine-NaOH Buffer), and the enzymatic reaction was carried out at 37°C to determine the enzyme activity of the recombinant wild enzyme 4NZJ and the mutant E278S.

[0056] The results of activity determination of recombinant wild-type enzyme 4NZJ and mutant E278S at different pH values ​​are shown in Figure 2 As shown, the results showed that the optimum pH of mutant E278S shifted 1.5 units toward the acidic region compared with the recombinant wild-type enzyme 4NZJ. The optimum pH of the recombinant wild enzyme 4NZJ is 6, and its enzyme activities are 5.47%, 57.96%, 77.07%, 88.34%, 99.04%, 98.53%, 84.58%, 36.11% and 1.39% at pH 3.0, 3.5, 4.0, 5.0, 5.5, 6.5, 7.0, 8.0 and 9.0, respectively; the optimum pH of the recombinant mutant E278S is 4.5, and its enzyme activities are 6.31%, 73.90%, 81.99%, 54.64%, 34.78%, 16.93%, 6.10% and 1.11% at pH 3.5, 4.0, 5.0, 5.5, 6.0, 6.5, 7.0 and 8.0, respectively.

[0057] 2) Stability determination of recombinant wild-type enzyme 4NZJ and mutant E278S at different pH

[0058] The purified enzyme in Experimental Example 2 was placed in a pH = 4.0-10.0 buffer (pH = 4.0, 4.5, 5.0, 6.0, 7.0, 8.0: McIlvaine buffer, pH = 9.0, 10.0: 0.2 mol / L Glycine-NaOH Buffer) and treated at 37°C for 60 min. According to the enzyme activity determination method, the enzymatic reaction was carried out at the corresponding optimal pH (pH 6.0 or pH 4.5) and 37°C, with pNPG as the substrate, and the reaction was carried out for 10 min to determine the enzyme activity of the recombinant wild enzyme 4NZJ and the mutant E278S.

[0059] The results of stability test of recombinant wild-type enzyme 4NZJ and mutant E278S at different pH are shown in Figure 3 As shown, the results showed that the recombinant wild enzyme 4NZJ and mutant E278S could maintain high enzyme activity in a wide pH range. When treated at pH = 5.0-9.0 for 60 minutes, both the wild enzyme 4NZJ and mutant E278S could maintain more than 75% of their enzyme activity.

[0060] 3) Thermal activity assay of the recombinant wild-type enzyme 4NZJ and mutant E278S

[0061] The enzymatic reaction of 4NZJ was carried out in the buffer with the optimum pH (pH=6.0) at 10, 20, 30, 40, 45, 50, 55, 60, and 70°C; the enzymatic reaction of E278S was carried out in the buffer with the optimum pH (pH=4.5) at 10, 20, 30, 35, 40, 45, 50, and 60°C. pNPG was used as the substrate, and the reaction lasted for 10 min to determine the enzyme activities of the recombinant wild enzyme 4NZJ and the mutant E278S.

[0062] The results of thermal activity assay of recombinant wild-type enzyme 4NZJ and mutant E278S are shown in Figure 4 As shown, the results showed that compared with the recombinant wild enzyme 4NZJ, the optimal temperature of mutant E278S dropped to 40°C, and the mutant E278S still had 30.99% enzyme activity at 20°C. The optimum temperature of wild enzyme 4NZJ is 50℃, and the enzyme activities are 7.20%, 14.91%, 41.80%, 73.48%, 91.25%, 77.04%, 12.55% and 1.71% at 10℃, 20℃, 30℃, 40℃, 45℃, 55℃, 60℃ and 70℃, respectively; the optimum temperature of mutant E278S is 40℃, and the enzyme activities are 9.04%, 30.99%, 77.71%, 83.31%, 88.52%, 39.31% and 15.89% at 10℃, 20℃, 30℃, 35℃, 45℃, 50℃ and 60℃, respectively. The enzyme activity of mutant E278S at 30℃ is significantly improved, which is about 36% higher than that of wild enzyme 4NZJ.

[0063] 4) Thermal stability determination of recombinant wild-type enzyme 4NZJ and mutant E278S

[0064] Two enzyme solutions with the same enzyme amount were placed at 45°C for 60 minutes, and the enzymatic reaction was carried out at the optimal pH (pH=6.0 and pH=4.5) and 37°C, respectively, with the untreated enzyme solution as a control. pNPG was used as a substrate, and the reaction lasted for 10 minutes. The enzyme activities of the recombinant wild enzyme 4NZJ and the mutant E278S were measured every 10 minutes.

[0065] The results of thermal stability test of recombinant wild-type enzyme 4NZJ and mutant E278S after treatment at 45°C for 60 min are shown in Figure 5 As shown, the results showed that after treatment at 45°C for 60 min, the enzyme activities of the purified recombinant wild enzyme 4NZJ and mutant E278S were still relatively stable, and both were able to maintain more than 90% of the enzyme activity.

[0066] 5) Activity determination of recombinant wild-type enzyme 4NZJ and mutant E278S in NaCl

[0067] NaCl with a final concentration of 0.1 to 4 M (0.1, 0.5, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0) was added to the enzymatic reaction system, and the enzymatic reaction was carried out at pH = 6.0 and 37° C. pNPG was used as a substrate, and the reaction was carried out for 10 min, and the activity of the purified recombinant wild enzyme 4NZJ and mutant E278S in NaCl was determined.

[0068] The results of the activity assay of the recombinant wild-type enzyme 4NZJ and mutant E278S in NaCl are shown in Figure 6 As shown, Figure 6 a in the figure is the activity of the recombinant wild enzyme in a salt environment. Figure 6 b in the figure is the activity of the mutant in a salt environment. The results show that when NaCl with a final concentration of 0.1 to 4 M is added to the reaction system, the enzyme activity of the recombinant wild enzyme 4NZJ does not change much, while the enzyme activity of the mutant E278S increases significantly with the increase of NaCl concentration. With the addition of NaCl in the reaction system, the activity of the mutant E278S is activated, and the enzyme activity is the highest after adding NaCl with a final concentration of 4 M, which is 27.22 times the enzyme activity without NaCl. For the recombinant wild enzyme 4NZJ, the enzyme activity is the highest when NaCl is not present, and its average relative activity decreases by about 26% with the addition of NaCl in the reaction system.

[0069] 6) Activity determination of recombinant wild-type enzyme 4NZJ and mutant E278S in NaF

[0070] NaF with a final concentration of 0.1-0.7 M (0.1, 0.2, 0.25, 0.3, 0.4, 0.5, 0.6, 0.7) was added to the enzymatic reaction system, and the enzymatic reaction was carried out at pH = 6.0 and 37° C. pNPG was used as a substrate, and the reaction lasted for 10 min. The enzyme activity of the purified recombinant wild enzyme 4NZJ and the mutant E278S in NaF was determined.

[0071] The results of the activity assay of the recombinant wild-type enzyme 4NZJ and mutant E278S in NaF are shown in Figure 7 As shown, Figure 7 a in the figure is the activity of the recombinant wild enzyme in a NaF environment. Figure 7b in the figure is the activity of the mutant in a NaF environment. The results show that when NaF with a final concentration of 0.1-0.7M is added to the reaction system, the enzyme activity of the recombinant wild enzyme 4NZJ does not change much, while the enzyme activity of the mutant E278S increases significantly with the increase of NaF concentration. With the addition of NaF in the reaction system, the activity of the mutant E278S is activated, and the enzyme activity is the highest after adding NaF with a final concentration of 0.6M, which is 32.17 times the enzyme activity without NaF. For the recombinant wild enzyme 4NZJ, the enzyme activity is the highest when NaF is not present. With the addition of NaF in the reaction system, its average relative activity decreases, but it still has 65% relative enzyme activity in 0.7M NaF.

[0072] 7) Activity determination of recombinant wild-type enzyme 4NZJ and mutant E278S in CH3COONa

[0073] CH3COONa with a final concentration of 0.1 to 3.5 M (0.1, 0.5, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5) was added to the enzymatic reaction system, and the enzymatic reaction was carried out at pH = 6.0 and 37°C. pNPG was used as a substrate, and the reaction lasted for 10 minutes, and the activity of the purified recombinant wild enzyme 4NZJ and mutant E278S in CH3COONa was determined.

[0074] The results of the activity assay of the recombinant wild-type enzyme 4NZJ and mutant E278S in CH3COONa are shown in Figure 8 As shown, Figure 8 a in the figure is the activity of the recombinant wild enzyme in the CH3COONa environment. Figure 8 b in the figure is the activity of the mutant in the CH3COONa environment. The results show that when CH3COONa with a final concentration of 0.1-3.5M is added to the reaction system, the enzyme activity of the wild enzyme 4NZJ gradually decreases with the increase of CH3COONa concentration, while the enzyme activity of the mutant E278S is activated. The average relative activity of the wild enzyme 4NZJ decreased to 49% in 3.5M CH3COONa; after adding 0.1-3.5M CH3COONa to the reaction system, the average relative activity of the mutant E278S was the highest in 3.5M CH3COONa, which was 24.73 times the enzyme activity when no CH3COONa was added.

[0075] 8) Activity determination of recombinant wild-type enzyme 4NZJ and mutant E278S in Na2SO4

[0076] Na2SO4 with a final concentration of 0.1-2M (0.1, 0.3, 0.5, 0.7, 1.0, 1.5, 2.0) was added to the enzymatic reaction system, and the enzymatic reaction was carried out at pH = 6.0 and 37°C. pNPG was used as a substrate, and the reaction lasted for 10 minutes. The activity of the purified recombinant wild enzyme 4NZJ and mutant E278S in Na2SO4 was determined.

[0077] The results of the activity assay of the recombinant wild-type enzyme 4NZJ and mutant E278S in Na2SO4 are shown in Fig. 9 As shown, Fig. 9 a in the figure is the activity of the recombinant wild enzyme in a Na2SO4 environment. Fig. 9 b in the figure is the activity of the mutant in a Na2SO4 environment. The results show that when a final concentration of 0.1-2M Na2SO4 is added to the reaction system, the wild enzyme 4NZJ has little change in enzyme activity at a concentration of 0.1-1M, and can maintain a relative activity of more than 75%. However, in a final concentration of 1.5M Na2SO4, its relative activity drops sharply to 26%, and only 8% at a concentration of 2M. When 0.1-1.5M Na2SO4 is added to the reaction system, the enzyme activity of the mutant E278S gradually increases with the increase of Na2SO4 concentration, and the activation effect is best in a final concentration of 1.5M Na2SO4, which is 11.44 times that when no Na2SO4 is added. In 2M Na2SO4, the relative enzyme activity of the mutant drops to 419%.

[0078] 9) Activity determination of recombinant wild-type enzyme 4NZJ and mutant E278S in different metal salts

[0079] CuCl2, CuSO4, FeCl3, Fe2(SO4)3, ZnCl2, ZnSO4, MgCl2, MgSO4, CH3COO(Mg)2, MnCl2, MnSO4, CaCl2, CH3COO(Ca)2, BaCl2, CH3COO(Ba)2 and CoCl2 were added to the enzymatic reaction system at final concentrations of 10.0 mM and 100.0 mM, respectively. The enzymatic reaction was carried out at pH = 6 and 37 °C with pNPG as substrate for 10 min. The effects of low concentration of metal salts on the enzyme activity of purified recombinant wild enzyme 4NZJ and mutant E278S were determined.

[0080] The activity test results of the recombinant wild enzyme 4NZJ and mutant E278S in different metal salts at low concentrations are shown in Table 1 below. The results show that, except for 100mM BaCl2 and CH3COO(Ba)2, the enzyme activity of the recombinant wild enzyme 4NZJ was inhibited to varying degrees in the other 10.0mM and 100.0mM metal ions tested. For mutant E278S, among the 10.0mM metal ions tested, except for CuCl2, CuSO4, FeCl3, and Fe2(SO4)3, which inhibited the enzyme activity, the other metal ions all activated E278S, and the enzyme activity increased by 1.531 to 9.129 times; among the 100.0mM metal ions tested, except for CuCl2, CuSO4, FeCl3, Fe2(SO4)3, and ZnCl2, which inhibited the enzyme activity of mutant E278S, the other metal ions all activated E278S, and the enzyme activity increased by 1.449 to 22.596 times, and Mn 2+ The activation effect is the best.

[0081] Table 1 Effects of different metal ions on the enzyme activity of the recombinant wild-type enzyme 4NZJ and mutant E278S

[0082]

[0083]

[0084] In summary, the halophilic α-galactosidase mutant E278S provided by the present invention has an optimum pH of 4.5 and an optimum temperature of 40°C, and its activity can be activated by low concentrations of ZnCl2, ZnSO4, MgCl2, MgSO4, CH3COO(Mg)2, MnCl2, MnSO4, CaCl2, CH3COO(Ca)2, BaCl2, CH3COO(Ba)2, CoCl2 and high concentrations of NaCl, NaF, CH3COONa, and Na2SO4, and the activation effect is NaF>NaCl>CH3COONa>Na2SO4. In a normal reaction system, the enzyme activity of the mutant is extremely low. However, after adding the measured low concentration of metal ions and medium and high concentrations of NaCl, NaF, CH3COONa, and Na2SO4, the enzyme activity of the mutant increases rapidly. This characteristic makes it possible to control the reaction rate of the enzyme by adjusting the concentration of added salt in practical applications, which is beneficial for real-time regulation of enzymatic reactions. It is especially applicable to food processing, brewing, feed, papermaking and other demanding industries that require high salt concentrations.

[0085] Although the content of the present invention has been described in detail through the above preferred embodiments, it should be appreciated that the above description should not be considered as a limitation of the present invention. After reading the above content, it will be apparent to those skilled in the art that various modifications and substitutions of the present invention will occur. Therefore, the protection scope of the present invention should be limited by the appended claims.

Claims

1. A metal ion activated and halophilic α-galactosidase mutant E278S, characterized in that: The amino acid sequence of the mutant E278S is shown in SEQ ID NO.

1.

2. The gene e278s encoding the metal ion activated and halophilic α-galactosidase mutant E278S according to claim 1, characterized in that: The nucleotide sequence of the coding gene is shown in SEQ ID NO.

2.

3. A recombinant expression plasmid comprising the coding gene as claimed in claim 2.

4. The recombinant plasmid according to claim 3, characterized in that The recombinant plasmid is selected from pET-28a(+).

5. A recombinant expression bacterium comprising the coding gene as claimed in claim 2.

6. The recombinant bacterium according to claim 5, characterized in that The bacteria are selected from BL21 (DE3).

7. Use of the α-galactosidase mutant E278S as claimed in claim 1 in the field of biotechnology under high salt concentration environment requirements.

8. The use according to claim 7, characterized in that: The biotechnology field includes food processing, brewing, feed and paper making.

9. Use of the α-galactosidase mutant E278S as claimed in claim 1 in real-time regulation of enzymatic reaction rate.

Images