Creation method and application of high-temperature-resistant cotton germplasm GhCKI-Pro5 and GhCKI-Pro6

Abstract

The invention provides a creation method and application of high-temperature-resistant cotton germplasm GhCKI-Pro5 and GhCKI-Pro6, and belongs to the technical field of plant genetic engineering. The invention provides an edited GhCKI gene promoter related to the high temperature resistance character of cotton, and the nucleotide sequence of the promoter is shown as SEQ ID NO. 4 or SEQ ID NO. 5. The edited GhCKI gene promoter is obtained after editing, a cotton plant containing the edited GhCKI gene promoter can still keep certain fertility at high temperature, the cotton yield at high temperature is kept, and an important germplasm resource is provided for high-temperature-resistant breeding of cotton.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and specifically relates to a creation method and application of high temperature resistant cotton germplasms GhCKI-Pro5 and GhCKI-Pro6. Background Art

[0002] Cotton is an important economic crop in my country. However, the frequency of high temperatures in summer is relatively high, and the duration of high temperatures will also be longer. Cotton is a thermophilic crop, but severe high temperature stress will cause physiological disorders during the growth period of cotton, affect the quality and yield of cotton, and even cause plant death. High temperature affects both vegetative growth and reproductive growth, but compared with vegetative organs such as leaves, the impact of high temperature on reproductive organs is more serious (Ahmad et al., 2021). The reproductive organs of plants include pistils and stamens. When subjected to high temperature stress, stamens are more sensitive to high temperatures than pistils (Zhang et al., 2021). High temperature can cause pollen vitality to decrease, anthers to not crack, buds to fall off, etc., which in turn affects the fruit set rate and seed yield. In addition, high temperature can also reduce fiber length and strength, affecting cotton quality. Therefore, it is extremely necessary to create high temperature resistant cotton germplasm.

[0003] At present, cotton breeding for heat resistance mainly adopts traditional breeding methods and transgenic technology. Traditional breeding methods have long cycles and low efficiency, and it is difficult to meet the needs of rapid breeding. Transgenic technology can effectively introduce heat-resistant genes into cotton, but there are certain safety and ethical issues. Therefore, developing a safe and rapid method to obtain heat-resistant cotton germplasm is a technical problem to be solved at this stage. Summary of the invention

[0004] In view of this, the purpose of the present invention is to provide a method for creating and applying high-temperature resistant cotton germplasms GhCKI-Pro5 and GhCKI-Pro6. The present invention obtains plants containing the edited GhCKI gene promoter through CRISPR / LbCpf1 gene editing technology, which can still maintain a certain fertility under high temperature, maintain the cotton yield under high temperature, and provide important germplasm resources for cotton high-temperature resistance breeding.

[0005] In order to solve the above technical problems, the present invention provides the following technical solutions:

[0006] The present invention provides a cotton high temperature resistant edited GhCKI gene promoter, wherein the nucleotide sequence of the edited GhCKI gene promoter is shown as SEQ ID NO.4 or SEQ ID NO.5.

[0007] The present invention provides the use of the edited GhCKI gene promoter in creating a high temperature resistant cotton strain.

[0008] The present invention provides an sgRNA for editing a cotton GhCKI gene promoter, wherein the nucleotide sequence of the sgRNA is shown in SEQ ID NO.6.

[0009] The present invention provides a recombinant expression vector, comprising the sgRNA.

[0010] Preferably, the sgRNA is connected to the CRISPR / LbCpf1 vector through an infusion system to obtain a recombinant expression vector.

[0011] The present invention provides a recombinant bacterium, comprising the recombinant expression vector.

[0012] The present invention provides the use of the sgRNA or the recombinant expression vector or the recombinant bacteria in creating a high temperature resistant cotton strain.

[0013] The present invention provides a method for creating a high temperature resistant cotton strain, comprising the following steps: transforming the recombinant expression vector into a wild cotton plant by genetic transformation to obtain a high temperature resistant cotton strain with an edited GhCKI gene promoter.

[0014] Preferably, the genetic modification method includes Agrobacterium-mediated method.

[0015] The invention provides application of the method in creating high temperature resistant cotton strains.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] The present invention uses CRISPR / LbCpf1 gene editing technology to knock out the MYB transcription factor binding site flanking sequence or the MYB transcription factor binding site in the GhCKI gene promoter region to obtain an edited GhCKI gene promoter. Cotton plants containing the edited GhCKI gene promoter can still maintain a certain fertility under high temperature, maintain the cotton yield under high temperature, and provide important germplasm resources for cotton high temperature resistance breeding.

[0018] Furthermore, the method for creating high temperature resistant cotton germplasm based on GhCKI gene promoter editing in the present invention has the advantages of simple operation, high efficiency, good safety, etc., and provides a new technical means for high temperature resistant cotton breeding. In gene editing technology, Cpf1 protein can recognize the 5' end PAM sequence rich in base T. Compared with Cas9 recognizing the 3' end PAM sequence rich in base G (NGG), T base has a wider coverage in biological genomes, especially T sequence rich in promoters, which provides us with a new idea for editing promoters. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1This is a schematic diagram of positive detection after the recombinant plasmid was electroporated into Agrobacterium GV3101. Lanes 1 and 2 are the detection results of the strains picked twice.

[0020] Figure 2 T 0 Schematic diagram of positive detection of LbCpf1 protein in single generation strains.

[0021] Figure 3 T 0 Schematic diagram of PCR amplification of target sites for Hi-Tom sequencing.

[0022] Figure 4 Schematic diagram of GhCKI gene promoter editing single plant.

[0023] Figure 5 T 0 Phenotypes of anthers and pollen activity of individual plants. A is the anther of WT wild-type individual plants, B is the anther of GhCKI-pro5 (missing the flanking sequence of MYB transcription factor binding site), and C is the anther of GhCKI-pro6 (missing the MYB transcription factor binding site); a, b, and c are the corresponding TTC staining images of pollen activity.

[0024] Figure 6 T 0 Phenotypes of anthers and pollen activity of individual plants. A is the anther of WT wild-type individual plants, B is the anther of GhCKI-pro5 (missing the flanking sequence of MYB transcription factor binding site), and C is the anther of GhCKI-pro6 (missing the MYB transcription factor binding site); a, b, and c are the corresponding TTC staining images of pollen activity. DETAILED DESCRIPTION

[0025] The present invention provides a cotton high temperature resistant edited GhCKI gene promoter, the nucleotide sequence of the edited GhCKI gene promoter is shown in SEQ ID NO.4 or SEQ ID NO.5. The edited GhCKI gene promoter of the present invention is obtained by knocking out the flanking sequence of the MYB transcription factor binding site or the MYB transcription factor binding site in the GhCKI gene promoter region by CRISPR / LbCpf1 gene editing technology. The nucleotide sequence of the GhCKI gene promoter of the present invention is shown in SEQ ID NO.1. The fragment sequence of the flanking sequence of the MYB transcription factor binding site in the GhCKI gene promoter region knocked out of the present invention is shown in SEQ ID NO.2 (5'-AACCCTAGGTTT-3'), and the fragment sequence of the MYB transcription factor binding site in the GhCKI gene promoter region knocked out is shown in SEQ ID NO.3 (5'-CGCATTTAGATTAACCTAACCTAACCCTAGGTTTTTTTTTTG-3'). The nucleotide sequence of the MYB binding site in the GhCKI gene promoter of the present invention is 5'-AACCTAAC-3'. The gene name of the edited GhCKI gene promoter after knocking out the fragment shown in SEQ ID NO.2 or SEQ ID NO.3 of the present invention is GhCKI-pro5 gene (sequence shown in SEQ ID NO.4) or GhCKI-pro6 gene (sequence shown in SEQ ID NO.5).

[0026] The present invention provides the use of the edited GhCKI gene promoter in creating high temperature resistant cotton strains. The cotton germplasm containing the edited GhCKI gene promoter in the present invention can still maintain a certain fertility under high temperature, providing important technical support for high temperature breeding of cotton.

[0027] The present invention provides an sgRNA for editing the cotton GhCKI gene promoter, and the nucleotide sequence of the sgRNA is shown in SEQ ID NO. 6. The nucleotide sequence of the sgRNA of the present invention is 5'-GATTAACCTAACCTAACCCTAGG-3' (5'-SEQ ID NO. 6-3').

[0028] The present invention provides a recombinant expression vector, comprising the sgRNA. The present invention connects the sgRNA to the CRISPR / LbCpf1 vector through an infusion system to obtain a recombinant expression vector (GhU6.7: sgRNA). The CRISPR / LbCpf1 vector of the present invention preferably includes pRGEB32-GhU6.7-NPTⅡ(LbCpf1), which is provided by the cotton genetic improvement team of Huazhong Agricultural University (Li et al., 2019Robust CRISPR / Cpf1(Cas12a)-mediated genomeediting in allotetraploid cotton(Gossypiumhirsutum), 2019, 17: 1862-1864).

[0029] The present invention provides a recombinant bacterium, comprising the recombinant expression vector. The present invention transforms the recombinant expression vector into Escherichia coli by heat shock to obtain a positive strain, and then transforms the positive strain into Agrobacterium by electroporation to obtain the recombinant bacterium.

[0030] The present invention also provides the use of the sgRNA or the recombinant expression vector or the recombinant bacteria in creating a high temperature resistant cotton strain.

[0031] The present invention also provides a method for creating a high temperature resistant cotton strain, comprising the following steps: transforming the recombinant expression vector into a wild cotton plant by genetic transformation to obtain a high temperature resistant cotton strain after the GhCKI gene promoter is edited. The genetic transformation method of the present invention preferably includes but is not limited to Agrobacterium-mediated method. The present invention does not specifically limit the specific steps of genetic transformation, and the conventional genetic transformation steps in the art can be used.

[0032] The present invention also provides the use of the above method in creating a cotton high temperature resistant strain. The present invention uses the method to obtain a cotton high temperature resistant strain mutant, which is a transgenic T 0 The present invention provides a method for modifying the transgenic T 0 High-throughput sequencing of the first generation plants revealed that the GhCKI gene promoter produced multiple types of edits, and by observing T 0 It was found that GhCKI-pro5 and GhCKI-pro6 mutants had obvious high temperature resistance potential.

[0033] In the present invention, unless otherwise specified, all components, reagents or culture media are commercially available products well known to those skilled in the art.

[0034] The technical solutions in the present invention will be described clearly and completely below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0035] Example 1

[0036] 1. Design of sgRNA

[0037] According to the CRISPR / LbCpf1 design principles: 1. PAM sequence is TTTN; 2. sgRNA length is 23bp; 3. sgRNA GC content is 35%-55%; 4. sgRNA should not be off-target to other genes, sgRNA targeting the GhCKI gene promoter was designed, see Table 1. The nucleotide sequence of the GhCKI gene promoter of the present invention is shown in SEQ ID NO.1.

[0038] Table 1 sgRNA sequences targeting GhCKI promoter

[0039] Gene sgRNA sequence and PAM site G JZ TTTAGATTAACCTAACCTAACCCTAGG(TTTA-SEQ ID NO.6)

[0040] Note: The bases in bold are PAM (protospacer adjacent motifs).

[0041] 2. Construction of GhCKI promoter editing CRISPR / LbCpf1 vector

[0042] (1) The designed sgRNA was reverse-complemented and then added with an adapter as a reverse primer, which was then sent to GenScript Biotech Co., Ltd. for synthesis. After PCR amplification, the target fragment was obtained and temporarily stored in a refrigerator at 4°C. The vector plasmid pRGEB32-GhU6.7-NPTⅡ(LbCpf1) was digested with BsaI enzyme (BsaI was purchased from Beijing NEB Company, Catalog No.: R3733L). The digestion system is shown in Table 2. Incubate at 37°C for 5 hours to obtain the digested vector.

[0043] Table 2 Enzyme digestion system

[0044] Reactants Volume / Mass pRGEB32-GhU6.7-NPTⅡ plasmid 10 μg 10XcutsmartBuffer 10μL BsaI enzyme (10U / μL) 4.0μL <![CDATA[ddH 2 The]]> Up to 100 μL

[0045] (2) Infusion connection

[0046] After the digestion, agarose gel electrophoresis was used to check whether the vector was linearized, with the undigested vector as a control. Then, the linearized vector was connected to the amplified target fragment containing sgRNA through the infusion system (Table 3), and the vector was placed in a 37°C water bath for 30 minutes and placed on ice for 5 minutes to obtain the recombinant plasmid pRGEB32-GhU6.7-sgRNA-NPTⅡ. The ClonExpress Entry Step Cloning Kit used was purchased from Nanjing Novozyme Biotechnology Co., Ltd.

[0047] Table 3 Infusion connection system

[0048]

[0049] (3) Heat shock transformation of Escherichia coli

[0050] In the clean bench, the constructed recombinant plasmid was mixed with competent Top10 and placed in an ice bath for 10 minutes; after the ice bath, heat shock was performed at 42°C for 90 seconds, and then placed in an ice bath for another 2 minutes; the heat shock product was transferred to a 2mL sterilized centrifuge tube, 300μL SOC was added, and the culture was shaken at 37°C for 30 minutes; 200μL was spread evenly on a Kan+ dish and dried, and then inverted and cultured in a 37°C incubator for 12-14 hours. A single clone was selected for activation, U6-7 F was used as a forward primer, and a sequence P1 on the Ubi promoter was used as a reverse primer for positive detection. The obtained positive strain was then placed in a -80°C refrigerator for bacteria preservation. Among them, U6-7 F: 5'-TGTGCCACTCCAAAGACATCAG-3' (SEQ ID NO.7), and the reverse primer P1: 5'-TTGTTGGTCGCCGTTAGGAC-3' (SEQ ID NO.8).

[0051] (4) Electrotransformation of Agrobacterium

[0052] The positive single clone was shaken, and the recombinant plasmid was extracted using the Tiangen Plasmid Extraction Kit (DP106); the electroporator was taken out for preheating, the electroporation cup was washed three times with 75% ethanol, and then placed on a clean bench to dry, and sterilized with ultraviolet light for 2 minutes; the recombinant plasmid was added to the thawed Agrobacterium GV3101 competent cells, gently pipetted and mixed, and quickly added to the electroporation tank of the precooled electroporation cup, and the electroporation cup was quickly placed in the electroporator, and electroporated at 1800V; the electroporation cup was taken out, 400μL SOC was added, and gently pipetted and mixed, and then transferred to a new 2mL sterile centrifuge tube, and cultured on a shaking table at 28°C for recovery for 1.5h; 200μL of the recovered bacterial solution was evenly spread on a solid LB plate (containing 100mg / L kanamycin and 50mg / L rifampicin), and placed in a dark incubator at 28°C for inversion culture for 48h; a single clone was picked for activation, U6-7 F (SEQ ID NO.7) as the forward primer, and a sequence P1 (SEQ ID NO.8) on the Ubi promoter as the reverse primer for amplification. The PCR product showed a band of about 600 bp by agarose gel electrophoresis, indicating a positive strain ( Figure 1 ), the positive strain was picked twice and tested twice. After the test was positive, it was placed in a -80℃ refrigerator for bacteria preservation.

[0053] Example 2 GhCKI promoter editing CRISPR / LbCpf1 vector transformation of cotton

[0054] The constructed vector is introduced into cotton host cells through Agrobacterium-mediated transformation. The specific transformation steps are as follows:

[0055] (1) Select full and healthy seeds of Upland Cotton Jin668, peel off the seed coat, and use 0.1% HgCl 2 Soak for 10 minutes, then wash with sterile water 3 times, inoculate the sterilized cotton seeds on the sterile seedling germination medium, and culture in a 28℃ constant temperature box in the dark for 4-6 days;

[0056] (2) Take the hypocotyls of sterile seedlings, cut them into 0.5-0.8 cm small segments and inoculate them into Agrobacterium suspension suspended in Agrobacterium activation medium with an OD value of 0.5. After infection for 10 minutes, use sterile filter paper to absorb the bacterial solution on the surface of the hypocotyls;

[0057] (3) Inoculate the hypocotyls in co-culture medium and co-culture at 21°C for 48 hours; transfer to 2,4-D screening medium and subculture once every month until embryonic callus is obtained; transfer the embryonic callus to differentiation medium to obtain a large number of embryoids;

[0058] (4) The obtained embryoids are transferred to embryo germination and rooting medium until transgenic plant seedlings are obtained.

[0059] Among them, the culture medium components and preparation methods used in the transformation process are as follows:

[0060] LB medium (for Agrobacterium activity): 10 g / L tryptone, 5 g / L yeast extract, 5 g / L sodium chloride, 10 g / L agar (solid).

[0061] Sterile seedling germination medium: 25 mL MS medium, 15 g / L glucose, 2.5 g / L Phytagel; pH value is 6.1-6.2.

[0062] Co-culture medium (1L): 50mL MS macro, 10mL micro, 10mL iron salt, 10mL inositol, 10mL ammonium nitrate, 1mL L-Gly, 1mL B5 organic matter, 1mL 2,4-D, 0.2mL KT, 0.9-1.0g magnesium chloride hexahydrate, 30g grape, Phytagel 2.6g; pH value is 5.85-5.95.

[0063] 2,4-D screening medium (1L): 50mLMS macro, 10mL trace, 10mL iron salt, 10mL inositol, 10mL ammonium nitrate, 1mL L-Gly, 1mLB5 organic matter, 2,4-D 1mL, 0.2mLKT, magnesium chloride hexahydrate 0.9-1.0g, 30g grape, Phytagel 2.6g, kanamycin 50mg / L, cephalosporin 400mg / L; pH value is 5.85-5.95.

[0064] Differentiation medium (1L): 50mL MS macro, 10mL micro, 10mL iron salt, 10mL inositol, 50mL potassium nitrate, 1mL L-Gly, 1mL B5 organic matter, 1mL LIBA, 0.3mL KT, 1g glutamine, 0.5g asparagine, 30g glucose, 2.6g Phytagel; pH value is 6.1-6.2.

[0065] Rooting medium (1 L): 25 mL MS macro, 5 mL micro, 5 mL iron salt, 10 mL inositol, 1 mL L-Gly, 1 mL B5 organic matter, 15 g glucose, 2.6 g Phytagel; pH 5.90-5.95.

[0066] Example 3 Molecular Detection and Editing Detection of Transgenic Plants

[0067] After the transformation process of Example 2, the transgenic plant T 0 , DNA was extracted from the transgenic plants using the Magen Biotech Plant DNA Rapid Extraction Kit. The specific extraction steps are as follows:

[0068] (1) Place the young cotton leaves to be extracted (0.1 g) into a 2 mL centrifuge tube and store it in liquid nitrogen for a short time. During extraction, place the centrifuge tube on ice, quickly add steel beads and 400 μL DNA extraction buffer, balance the sample and place it in a grinder, grind at 60 Hz for 60 s, add 400 μL DNA extraction buffer after grinding, and grind for another 10 s. At this time, open the water bath, adjust the water temperature to 65 °C, and preheat BufferPAL;

[0069] (2) Centrifuge the polished sample at 12000 r / min for 18 min and discard the supernatant;

[0070] (3) Immediately add 700 μL of Buffer PAL preheated to 65°C to the sample, vortex vigorously to fully disperse the sample, and place in a 65°C water bath for 40 min, gently inverting every 10 to 20 min. After the water bath is completed, centrifuge at 12,000 rpm for 10 min.

[0071] (4) Aspirate the supernatant into a new 2 mL centrifuge tube, add 700 μL of phenol-chloroform (Tris-phenol:chloroform = 1:1, mix and let stand overnight before use), gently extract and shake for 20 min, and centrifuge at 12000 r / min for 8 min;

[0072] (5) Aspirate the supernatant into a new 2 mL centrifuge tube, add an equal volume of chloroform, gently extract and shake for 20 min, and centrifuge at 12000 r / min for 8 min;

[0073] (6) Aspirate the supernatant into a new 2 mL centrifuge tube, add 700 μL of Buffer GWP to the supernatant, and mix by inverting 10 to 15 times;

[0074] (7) Place the DNA column in a collection tube, transfer half of the mixed solution to the column, and centrifuge at 12,000 rpm for 1 min.

[0075] (8) Discard the filtrate and put the column back into the collection tube, transfer the remaining mixed solution to the column, and centrifuge at 12000r / min for 1min;

[0076] (9) Discard the filtrate and return the column to the collection tube. Add 500 μL of Buffer PW1 to the column and centrifuge at 12,000 rpm for 1 min.

[0077] (10) Discard the filtrate and return the column to the collection tube. Add 500 μL of Buffer PW2 to the column and centrifuge at 12,000 rpm for 1 min.

[0078] (11) Repeat step (10);

[0079] (12) Discard the filtrate and return the column to the collection tube. Centrifuge at 12,000 rpm for 2 min to remove the residual ethanol in the column.

[0080] (13) Transfer the column to a new 1.5 mL centrifuge tube, add 50 μL of Buffer AE preheated to 65 °C to the center of the column membrane, let stand at room temperature for 2 min, and centrifuge at 12,000 rpm for 1 min;

[0081] (14) Discard the DNA binding column, take 1 μL of the extracted DNA and dilute it 10 times for electrophoresis, and take 1 μL to measure the concentration using NanoDrop 2000. The remaining DNA is stored at -20°C for subsequent experiments.

[0082] After DNA extraction, forward primer P2 and reverse primer P3 were used for positive detection of LbCpf1 protein. Figure 2 The schematic diagram of positive detection of LbCpf1 protein is shown in Figure 1. The relevant primer sequences used for amplification are: forward primer P2: 5'-GAACAACCACGGGCAAAT-3' (SEQ ID NO.9); reverse primer P3: 5'-GCAGCACCCTGACCTCTGTATT-3' (SEQ ID NO.10).

[0083] After testing the transgenic plants for vector positivity, we need to further determine the specific editing status of the transgenic plants. Therefore, we designed primers to amplify the flanking sequence of sgRNA and amplify the target fragment ( Figure 3 ), the amplified PCR products were mixed and purified, and then high-throughput sequencing was performed. After the high-throughput sequencing data was returned, the data was split and the editing efficiency was tested. Visual inspection was performed in R. According to the gene editing type and editing efficiency, the GhCKI promoter knockout mutant T was 0 The generation materials were divided into GhCKI-pro5 and GhCKI-pro6. The results are as follows Figure 4 As shown. The relevant primer sequences for amplifying GhCKI-pro5 and GhCKI-pro6 mutant DNA are: forward primer P4: 5'-GACgcctagAGATAGTGATAGGAAAAA AA-3' (SEQ ID NO.11), reverse primer P5: 5'-GACacgtcaGACAACCCATAAACA TCCAG-3' (SEQ ID NO.12); forward primer P6: 5'-GACgcgctaAGATAGTGATAGG AAAAAAA-3' (SEQ ID NO.13), reverse primer P7: 5'-GACaccatgGACAACCCAT AAACATCCAG-3' (SEQ ID NO.14).

[0084] Figure 3 T 0 The results of PCR amplification of target sites by Hi-Tom sequencing. Figure 4 GhCKI-pro5 and GhCKI-pro6 T were shown respectively. 0 The editing status of the GhCKI gene promoter in the first generation of single plants. The results of high-throughput sequencing showed that the single flanking sequence of MYB binding site 1 in GhCKI-pro5 was edited, and the main editing types were deletions of 12, 9 and 6 bases, with an editing efficiency of 75.86%. MYB binding site 1 in GhCKI-pro6 was successfully edited, and the main editing types were deletions of 42 bases, 12 bases, 9 bases and 6 bases, with an editing efficiency of 88.59%.

[0085] Example 4 Investigation of male fertility phenotype of GhCKI promoter knockout mutant at normal and high temperatures

[0086] After determining the specific editing situation in the GhCKI promoter knockout mutant, the male fertility of the knockout mutant was investigated at normal and high temperatures.

[0087] Wild plants, GhCKI-pro5 and GhCKI-pro6 were planted at the experimental base of Huazhong Agricultural University in Wuhan, Hubei Province. During the flowering period of cotton, the flowers blooming on the same day were collected in the morning under normal and high temperature conditions on a clear day. If it was cloudy or overcast, the time could be appropriately postponed to ensure that the control had lost pollen. The collected flowers were temporarily placed on ice to keep fresh, and the anther cracking was observed and recorded by taking photos. Then the anthers were carefully peeled off with pointed tweezers, TTC staining was performed in a 2mL centrifuge tube, and it was placed at room temperature and away from light. After 30 minutes, the activity of the pollen could be preliminarily judged by the coloring of the pollen grains. If the pollen grains are red, it means that the pollen activity is good. If they are not colored, it means that the pollen is inactive. The morphology and activity of the pollen grains were then further observed under a stereo microscope. The results are as follows. Figure 5 and Figure 6 .

[0088] Among them, the high temperature stress condition is: the daytime temperature is higher than 35℃ and the nighttime temperature is higher than 28℃. After 7 days of high temperature treatment, the anther samples in the tetrad period are collected as high temperature samples. After the anthers are collected, they are immediately frozen in liquid nitrogen and stored in a -70℃ refrigerator for use. Planted in a greenhouse, the photoperiod is 16h light and 8h dark, the relative humidity is 60%, the daytime temperature is 25℃, and the dark temperature is 20℃. When the plants are subjected to high temperature treatment, the temperature is adjusted to 36℃ for 12h.

[0089] The specific steps of TTC pollen viability staining observation are as follows: 8 grams of TTC (2,3,5-triphenyltetrazolium chloride, molecular weight 334.8) are dissolved in 1L phosphate buffer (26.6g of dipotassium hydrogen phosphate trihydrate, 10.2g of dipotassium hydrogen phosphate) to prepare a 2% working solution, and stored at 4°C in the dark; when used, the solution is divided into 2mL centrifuge tubes, anthers are inserted, and the tubes are reacted at room temperature for 30 minutes before being taken out for observation under a microscope.

[0090] Figure 5 The phenotype of transgenic plants at normal temperature is shown in Figure 2. Figure 5 It can be seen that at room temperature, the flowers of WT (Jin668) and regenerated plants collected at around 8 o'clock on the day of flowering showed normal anther dehiscence. After TTC staining of the anthers of each material on the day of flowering and observation under a stereomicroscope, the pollen grains had normal morphology and good vitality. Figure 6 This is the phenotype of transgenic plants under high temperature. Figure 6 It can be seen that after high temperature stress, the anthers of WT (Jin668) can no longer dehisce normally, while the anthers of GhCKI-pro5 and GhCKI-pro6 can still dehisce normally; after TTC staining, under a stereo microscope, the pollen of WT (Jin668) has lost its vitality. In contrast, the pollen of GhCKI-pro5 and GhCKI-pro6 can still maintain a certain vitality.

[0091] From the above, it can be seen that the edited GhCKI gene promoter genes GhCKI-pro5 and GhCKI-pro6 can improve the high temperature resistance of cotton anthers.

[0092] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A cotton high temperature resistant edited GhCKI gene promoter, characterized in that: The nucleotide sequence of the edited GhCKI gene promoter is shown in SEQ ID NO.4 or SEQ ID NO.

5.

2. Use of the edited GhCKI gene promoter according to claim 1 in creating high temperature resistant cotton strains.

3. A sgRNA for editing the cotton GhCKI gene promoter, characterized in that: The nucleotide sequence of the sgRNA is shown in SEQ ID NO.

6.

4. A recombinant expression vector, characterized in that: Comprising the sgRNA of claim 3.

5. The recombinant expression vector according to claim 4, characterized in that The sgRNA is connected to the CRISPR / LbCpf1 vector through an infusion system to obtain a recombinant expression vector.

6. A recombinant bacterium, characterized in that: Comprising the recombinant expression vector according to claim 4 or 5.

7. Use of the sgRNA according to claim 3, the recombinant expression vector according to claim 4 or 5, or the recombinant bacteria according to claim 6 in creating a high temperature resistant strain of cotton.

8. A method for creating a high temperature resistant cotton strain, characterized in that: The steps include: The recombinant expression vector according to claim 4 or 5 is transformed into wild cotton plants by genetic transformation to obtain a high temperature resistant cotton strain in which the GhCKI gene promoter is edited.

9. The method according to claim 8, characterized in that The genetic modification method includes Agrobacterium-mediated method.

10. Use of the method according to claim 8 or 9 in creating high temperature resistant cotton strains.

Images