Gene related to southern blight resistance of dendrobium officinale and application of gene

Abstract

The invention discloses a gene related to southern blight resistance of dendrobium officinale and application of the gene. The CDS sequence of the gene Dof013141 is as shown in SEQ ID NO. 1. The Dof013141 gene is separated and screened, the problems of environmental pollution and drug resistance caused by a traditional chemical prevention and control method are successfully solved through overexpression of the gene in dendrobium officinale, dependence on chemical agents is effectively reduced, a new technical solution is provided for green and sustainable agricultural prevention and control, and the Dof013141 gene has a wide application prospect. The gene has a wide application prospect, can be successfully expressed in dendrobium officinale, and also can be popularized to disease-resistant breeding of other susceptible plants, so that the application of the gene in the fields of agricultural production and plant protection is further widened. The method not only provides powerful guarantee for improving the yield and quality of dendrobium officinale, but also opens up a new research direction for development and utilization of plant disease-resistant genes, and has great economic and social values.

Description

Technical Field

[0001] The present invention relates to the field of plant genetic engineering and agricultural biotechnology, and in particular to a gene related to resistance to white rot of Dendrobium officinale and its application Background Art

[0002] White rot, also known as white silk disease or sclerotinia disease, is one of the main diseases that seriously threaten the health of plants such as Dendrobium officinale. Regarding the identification of the pathogen of the disease, existing studies have pointed out that the main pathogens that cause white rot in Dendrobium officinale are from the subphylum Ascomycota under the phylum Basidiomycetes, specifically Sclerotium rolfsii Sacc. and Sclerotium delphinii Welch. The pathogen is a saprophytic fungus with a wide host range, preferring a high temperature and humid environment, and is mainly distributed in grasslands and rainforests in tropical and subtropical regions. Under these hot and humid climatic conditions, the pathogen exhibits a strong ability to infect and can cause serious damage to a variety of plants, including crops and flowers. For the cultivation of Chinese medicinal materials such as Dendrobium officinale, the outbreak of white rot is often accompanied by huge economic losses.

[0003] In the early stage of the disease, white rot on Dendrobium officinale is manifested as obvious white hyphae at the base of the stem or on the cultivation medium. These hyphae gradually extend to the stems and leaves, causing the leaves to gradually necrotize. In the further development of the disease, the stems begin to rot, gradually bend and eventually die. As the disease worsens, hard sclerotia will form on the dead leaves and stems, and the base of the stem and the roots will also show obvious rot symptoms. This process not only seriously affects the growth of the plant, but also causes devastating damage to the key parts of the plant. In the cultivation process of Dendrobium officinale, especially in the stage of seedling hardening and domestication of tissue culture seedlings, white rot is very easy to break out, resulting in large-scale seedling death, causing heavy economic losses to growers. Due to the rapid spread and strong pathogenicity of white rot, it often has a serious impact on the entire planting environment in a short period of time, further increasing the difficulty of disease prevention and control. This disease not only threatens the yield and quality of Dendrobium officinale, but also increases the cost of cultivation, becoming one of the problems that need to be solved in the cultivation of Dendrobium officinale.

[0004] At present, the prevention and control methods of white rot mainly rely on chemical fungicides. However, the long-term and large-scale use of chemical fungicides may not only cause environmental pollution problems, but also cause pathogens to develop drug resistance, resulting in a decrease in the prevention and control effect. Therefore, finding more environmentally friendly and sustainable prevention and control measures has become one of the key directions of current research. In this context, the study of plant's own disease resistance genes is particularly important. Through the screening and cloning of genes against white rot, it is expected to provide new gene resources for plant disease resistance breeding, thereby developing greener and safer prevention and control methods, reducing dependence on chemical agents, and providing stronger guarantees for the healthy cultivation of crops and Chinese medicinal materials. Summary of the invention

[0005] Purpose of the invention: In view of the deficiencies of the prior art, the present invention provides a gene related to the resistance of Dendrobium officinale to white rot. The present invention identifies a new gene Dof013141 related to the resistance of Dendrobium officinale to white rot, and its overexpression material can significantly improve the resistance of Dendrobium officinale to white rot. The Dof013141 gene of the present invention significantly improves the resistance of Dendrobium officinale to white rot by regulating the internal defense mechanism of the plant, provides an important gene resource for the cultivation of disease-resistant plants, and provides technical support for the selection and breeding of Dendrobium officinale plant varieties with white rot resistance.

[0006] The present invention also provides application of the gene related to the resistance to white rot of Dendrobium officinale.

[0007] Technical solution: To achieve the above-mentioned purpose of the invention, the present invention provides a gene Dof013141 related to resistance to white rot of Dendrobium officinale, and the CDS sequence of the gene Dof013141 is shown in SEQ ID NO.1.

[0008] Among them, the genes also include genes encoding proteins with similar domains as SEQ ID NO.1, which are highly similar to the Dof013141 gene in structure and function.

[0009] Among them, the primers used to amplify the full-length CDS sequence of the gene Dof013141 are:

[0010] Dof013141-F:ATGGAAGTACATGGAGGAGCA

[0011] Dof013141-R: CTATTGTTGTAATAGCAAAAATCTTCC.

[0012] The Dendrobium officinale Scabra rot resistance-related gene Dof013141 overexpression vector pCAMBIA1301-35SN-Dof013141 of the present invention.

[0013] Wherein, the overexpression vector construction method is:

[0014] Primers for amplifying the CDS gene of the gene Dof013141 were designed, and the CDS gene of the gene Dof013141 was used as a template for amplification. The amplified product was connected to the plant expression vector pCAMBIA1301-35SN, and then transformed and the plasmid was extracted to finally obtain the overexpression vector pCAMBIA1301-35SN-Dof013141.

[0015] Wherein, the nucleotide sequence of the plant expression vector pCAMBIA1301-35SN is shown in SEQ ID NO.2.

[0016] The host cell of the present invention uses Agrobacterium as the starting strain, which contains the overexpression vector pCAMBIA1301-35SN-Dof013141.

[0017] The invention discloses an application of the gene Dof013141, the overexpression vector or the host cell in improving the resistance of Dendrobium officinale to Sclerotium rolfsii.

[0018] Among them, the resistance of Dendrobium officinale to white rot was improved by overexpressing the Dof013141 gene.

[0019] The invention discloses an application of the gene Dof013141, the overexpression vector or the host cell in cultivating Dendrobium officinale plants resistant to Sclerotium rolfsii.

[0020] The present invention verifies the overexpression of the Dof013141 gene in Dendrobium officinale and its anti-straight rot effect. The present invention verifies the effect of overexpression of the Dof013141 gene in Dendrobium officinale on improving resistance to straight rot, and describes in detail the specific operation steps of the genetic engineering method.

[0021] 1. Acquisition of Dof013141 gene and vector construction

[0022] Firstly, total RNA was extracted from Dendrobium officinale, and the full-length cDNA sequence of Dof013141 gene was obtained by reverse transcription-PCR amplification.

[0023] The Dof013141 gene was cloned into the plant expression vector pCAMBIA130, and its efficient expression was driven by the 35S promoter. After the construction was completed, the recombinant vector was extracted using a plasmid extraction kit for transformation.

[0024] 2. Plant transformation and overexpression of Dof013141 gene

[0025] The Dof013141 gene was introduced into the leaves of Dendrobium officinale by Agrobacterium-mediated method. The specific steps are as follows: Use a 1mL needle to gently make a small hole on the back of the Dendrobium officinale leaf (be careful not to puncture it), then use a syringe without the needle to absorb the bacterial solution, and inject it into the leaf from the wound (press the front of the leaf with your finger to penetrate the bacterial solution from the back of the leaf). Use a marker to mark the water-soaked area of ​​the Dendrobium officinale leaf. The injected plants were placed in the dark for 12 hours, then cultured at about 26°C, and leaf samples were collected on the third day after introduction. The expression level of the Dof013141 gene in the leaves of Dendrobium officinale was verified by PCR and qRT-PCR methods, confirming the high level of expression of the gene.

[0026] 3. Sclerotium rot resistance test

[0027] In order to test the resistance effect of Dof013141 gene to Sclerotium rolfsii, the control group (non-transgenic Dendrobium officinale plants) and the experimental group (Dof013141 transgenic plants) were placed under the same conditions for artificial inoculation experiments.

[0028] The specific steps are as follows:

[0029] The overexpression plasmid carrying the Dof013141 gene was introduced into the leaves of Dendrobium officinale. After 24 hours, neat 5mm diameter Sclerotium mycelium blocks were inoculated into the leaves of Dendrobium officinale. After inoculation, the plants were placed in a constant temperature incubator to maintain appropriate humidity and temperature in order to observe the occurrence and development of the disease. The symptoms of the plants were recorded on the third day after inoculation, including the number and area of ​​lesions and the speed of disease progression.

[0030] 4. Experimental results

[0031] On the third day after inoculation, the Dendrobium officinale plants in the control group showed obvious symptoms of white rot, including lesions at the inoculated fungus blocks on the leaves, leaf wilting and necrosis, while the Dof013141 transgenic plants showed strong disease resistance, with a significant reduction in the number and area of ​​lesions and better plant growth.

[0032] 5. Summary

[0033] The experimental results show that after the Dof013141 gene is overexpressed in Dendrobium officinale, the resistance of the plant to Sclerotium rot is significantly improved. This example proves the effectiveness of the Dof013141 gene as a disease resistance gene in Dendrobium officinale, and demonstrates its application potential in disease resistance breeding.

[0034] The present invention separates and identifies the gene Dof013141 related to the resistance to white rot of Dendrobium officinale, and the CDS nucleotide sequence of the gene is shown in SEQ ID NO.1. The Dof013141 gene significantly improves the resistance of Dendrobium officinale to white rot by regulating the internal defense mechanism of the plant, and provides an important gene resource for the cultivation of disease-resistant plants. The full-length CDS sequence of Dof013141 in the present invention can be artificially synthesized, and its encoding gene is first synthesized, and then biological expression is performed. The present invention first synthesizes its complete encoding gene by chemical means, and then realizes the efficient expression of the gene in the organism through an appropriate expression system. This process provides a feasible technical path for large-scale production and application of the gene, and is helpful for synthesizing and expressing disease-resistant proteins. The genes encoding the above-mentioned similar domain proteins in other plants in the present invention also belong to the protection scope of the present invention, covering genes encoding proteins with similar domains in other plants. Although these genes are derived from different plants, they are highly similar to the Dof013141 gene in structure and function, and can play a disease-resistant role in related plants, so they also belong to the protection content of the present invention. The present invention also provides a recombinant vector or recombinant microorganism containing the gene Dof013141, and protects the recombinant vector or recombinant microorganism containing the Dof013141 gene. These recombinants can express the gene in a suitable host, thereby producing related proteins for resistance to white rot, and are suitable for genetic improvement, breeding and other scientific research applications of plants. The recombinant vector and microorganism containing the gene can not only be used to improve the disease resistance of plants, but also have wide application value in the field of plant biotechnology.

[0035] The application of the gene Dof013141 of the present invention is as follows: regulating the resistance of Dendrobium officinale to white rot; enhancing or reducing the resistance of Dendrobium officinale to white rot. Specifically, by overexpressing the gene, the resistance of Dendrobium officinale to white rot will be enhanced. Therefore, the gene of the present invention can be combined with an overexpression promoter in a plant and then introduced into a suitable expression vector and transformed into a plant host, thereby changing the resistance to white rot and regulating plant yield.

[0036] The present invention provides a novel Dendrobium officinale anti-scabra rot gene Dof013141 and its wide application. After the gene is overexpressed in Dendrobium officinale by genetic engineering means, the plant's resistance to scabra rot is significantly enhanced, and the disease resistance and survival rate of Dendrobium officinale are greatly improved, thereby reducing the yield loss caused by the disease. The present invention successfully overcomes the environmental pollution and drug resistance problems caused by traditional chemical control methods by isolating and screening the Dof013141 gene. The overexpression of the gene not only effectively reduces the dependence on chemical agents, but also provides a new technical solution for green and sustainable agricultural prevention and control. The Dof013141 gene has a wide range of application prospects. In addition to its successful performance in Dendrobium officinale, it can also be extended to disease-resistant breeding projects of other susceptible plants, further broadening its application in the fields of agricultural production and plant protection. The present invention not only provides a strong guarantee for improving the yield and quality of Dendrobium officinale, but also opens up a new research direction for the development and utilization of plant disease-resistant genes, and has great economic and social value.

[0037] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0038] The present invention identifies a new gene Dof013141 related to the resistance to white rot of Dendrobium officinale, providing a new gene resource for the molecular genetic improvement of the resistance to white rot of Dendrobium officinale. Further, the present invention obtains a new germplasm of Dendrobium officinale with enhanced resistance to white rot. The present invention obtains a mutant of the overexpression gene Dof013141 of Dendrobium officinale through genetic transformation, and compared with the control, the overexpression mutant of Dendrobium officinale has significantly enhanced resistance to white rot.

[0039] The present invention clones a gene Dof013141 by molecular biological methods, and proves its function in regulating the resistance of Dendrobium officinale to white rot. The application prospect of the Dof013141 gene of the present invention is broad. In addition to its successful performance in Dendrobium officinale, it can also be extended to disease-resistant breeding projects of other susceptible plants, further broadening its application in the fields of agricultural production and plant protection. The invention not only provides a strong guarantee for improving the yield and quality of Dendrobium officinale, but also opens up a new research direction for the development and utilization of plant disease-resistant genes, and has great economic and social value. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 Agarose gel electrophoresis diagram to verify the recombinant plasmid.

[0041] Figure 2 It is a bar graph of the expression level of gene Dof013141.

[0042] Figure 3 This is a picture of a plant overexpressing gene Dof013141.

[0043] Figure 4 It is a statistical graph of resistance data.

[0044] Figure 5 To overexpress the disease resistance of Dendrobium officinale. DETAILED DESCRIPTION

[0045] The present invention is further described below in conjunction with the accompanying drawings and embodiments.

[0046] The reagents used in the examples of the present invention, unless otherwise specified, can be obtained from commercial sources. Experimental methods without specific conditions in the examples are usually carried out under conventional conditions or under conditions recommended by the manufacturer.

[0047] The cultivated Dendrobium officinale seedlings used in the present invention were collected from Anhui, China, and were identified as conventional cultivated Dendrobium officinale. The cultivated Dendrobium officinale seedlings were preserved and provided by the Institute of Plant Resources and Environment, School of Life Sciences, Nanjing Normal University.

[0048] The plant expression vector pCAMBIA1301-35SN was purchased from Shanghai Hewu Biotechnology Co., Ltd., and its sequence is shown in SEQ ID NO.2.

[0049] Example 1

[0050] Cloning of gene Dof013141 and construction of overexpression vector

[0051] 1. Standard molecular biology techniques were used for gene cloning and vector construction. First, total RNA was extracted from healthy tissue culture seedlings of Dendrobium officinale with a growth period of one year using EASY SpinPlant RNA Kit (Aidlab, China). Then, the extracted RNA was transcribed into cDNA using reverse transcription reaction to provide a template for subsequent gene amplification. The full-length CDS sequence of the Dof013141 gene was amplified using PCR technology. The primer design used is shown in Table 1, and the PCR cycle reaction system and parameters are shown in Table 2.

[0052] Table 1: Primers for PCR amplification of full-length cDNA of Dof013141 gene

[0053] Primer name Primer sequence 5'to3' Dof013141-F ATGGAAGTACATGGAGGAGCA Dof013141-R CTATTGTTGTAAATAGCAAAAATCTTCC

[0054] Table 2: PCR cycle system

[0055]

[0056] The PCR amplification product was recovered and purified, and sequenced. The nucleotide sequence encoded by the Dof013141 gene of the present invention is shown as SEQ ID NO. 1, and the size is 843 bp.

[0057] 2. The amplified Dof013141 gene was then cloned into the plant expression vector pCAMBIA1301-35SN, which was selected as a tool for gene overexpression. The 35S promoter in the vector can efficiently drive the expression of the target gene. The nucleotide sequence of the plant expression vector pCAMBIA1301-35SN is shown in SEQ ID NO.2. During the vector construction process, XbaⅠ and BamHI endonucleases were selected for restriction digestion to ensure that the Dof013141 gene could be correctly inserted into the multiple cloning site of the vector. The restriction digestion reaction system of the linearized vector is shown in Table 3. Through the homologous recombination method, an overexpression vector was successfully constructed, which can be used in subsequent Dendrobium officinale experiments to verify the function of the Dof013141 gene in resistance to white rot.

[0058] Table 3: Enzyme digestion system

[0059] Components volume pCAMBIA1301-35SN 2μg 10 × rCutSmart 5μL XbaⅠ 1μL Bam HI 1μL <![CDATA[ddH 2 The]]> Make up to 50 μL

[0060] Specific method for constructing overexpression vector:

[0061] Primers for vector construction were designed based on the CDS region of the Dof013141 gene. The designed primer sequences were used to amplify the CDS sequence with the vector homologous fragment:

[0062] CZDof013141-F: TGGCGGCCGCTCTAGATGGAAGTACATGGAGGAGCACZDof013141-R: GCAGCCCGGGGGATCCTATTGTTGTAAATAGCAAAAA TCTTCC

[0063] First, the CDS sequence of the Dof013141 gene was used as a template to perform PCR amplification using PrimerSTAR high-fidelity enzyme to obtain the product. The reaction system was 50 μL, including 10 μL 5× PrimeSTAR Buffer, 4 μL dNTP Mixture, 1 μL CZDof013141-F primer, 1 μL CZDof013141-R primer, and 1 μL ddH 2 O 32.5μL, template 1μL, PrimerSTAR high-fidelity enzyme 0.5μL. The reaction program was 95℃5min; 95℃15sec, 55℃15sec, 72℃15sec, 35 cycles; 72℃5min. Homologous recombination kit ( ⅡOne Step Cloning Kit) was used to recombinantly connect the purified PCR product with the linear vector of XbaⅠ and BamHⅠ endonucleases. In 10μL of the recombination and connection system, 2μL of 5×CE II Buffer, 1μL of purified PCR product, 1μL of BamHⅠ single enzyme digested pCAMBIA1305.4 vector fragment, 1μL of recombinase Exnase II, and 5μL of sterile water were added. After mixing, 37℃ connection was carried out for 30min.

[0064] Take the competent E. coli DH5α out of the -80℃ freezer and thaw naturally on ice to ensure the activity of the competent cells. After the cells are completely thawed, carefully add 10μL of the recombinant plasmid to 100μL of competent E. coli. Note that you cannot use a pipette to blow during the operation to avoid damaging the cells. Let the mixture stand on ice for 30 minutes to allow the plasmid to fully enter the competent cells. Next, heat shock the centrifuge tube in a 42℃ water bath for 45 seconds. This step can temporarily increase the permeability of the cell membrane, thereby facilitating the plasmid to enter the cell. After the heat shock is completed, immediately transfer the centrifuge tube to ice and cool for 2 minutes to restore the stability of the cells. Subsequently, add 900μL of antibiotic-free LB liquid medium to the centrifuge tube and mix gently to ensure that the cells can quickly resume growth without selection pressure. Place the centrifuge tube on a shaker at 37℃ and 230rpm and culture for 1 hour to promote cell recovery and initial amplification of the plasmid. After recovery, the culture was centrifuged at 5000rpm for 5 minutes, 900μL of supernatant was discarded, and only 100μL of culture medium was retained. Use the remaining culture medium to resuspend the cells, and then evenly spread them on LB solid culture medium containing kanamycin, and use the selective pressure of kanamycin to screen the successfully transformed strains. Invert the culture dish and place it in a 37°C incubator for 12-16 hours until single colonies appear. Pick up individual colonies from the culture dish and transfer them to 2mL centrifuge tubes containing 800μL LB liquid culture medium and kanamycin (one tube for each colony). Place the centrifuge tube on a shaker at 37°C and 230rpm and culture for 24 hours to expand the amount of bacterial solution. After the culture is completed, 2μL of bacterial solution was taken from each centrifuge tube for PCR verification of amplification. The specific PCR cycle system is shown in Table 2, and the primer sequences used are shown in Table 4. The PCR product was then sequenced to ensure the correctness of the recombinant vector. The agarose gel electrophoresis diagram for recombinant plasmid verification is shown in the following figure. Figure 1 After successful sequencing verification, the bacterial solution was added to 60% glycerol, quickly frozen with liquid nitrogen, and the sample was stored in an ultra-low temperature freezer at -80°C for long-term storage.

[0065] Through the above steps, the E. coli transformation, amplification, verification and preservation of the recombinant plasmid were successfully completed, providing a reliable bacterial liquid resource for subsequent experiments.

[0066] Table 4: Validation primer sequences

[0067] Primer name Primer sequence 5'to3' OX-F1 GAGAACACGGGGGACTCTAG OX-R1 GCCAAATGTTTGAACGATCTGC

[0068] Example 2

[0069] The recombinant vector is transformed into competent Agrobacterium. The constructed vector is introduced into the leaves of Dendrobium officinale. In this embodiment, Agrobacterium competent cells are used for transformation operation to introduce the recombinant plasmid for subsequent experiments. The operation steps are as follows:

[0070] First, take about 1 μg of the recombinant plasmid DNA constructed in Example 1 and add it to 200 μL of Agrobacterium competent EHA105, mix gently and place on ice for 30 minutes. In order to ensure the repeatability of the experiment, prepare 4 tubes of competent Agrobacterium for parallel operation. Subsequently, heat the cells in a 37°C air bath for 5 minutes to promote the entry of plasmid DNA. Next, quickly place the centrifuge tube on ice to cool for a moment, and then perform liquid nitrogen quick freezing for 10 seconds. This step helps to enhance the efficiency of plasmid transformation. After quick freezing, put the centrifuge tube back into the 37°C air bath and heat for 5 minutes, then immediately put it back on ice to cool.

[0071] Next, add 1 mL of LB medium without antibiotics to each tube of competent cells, mix gently, and culture at 30°C for 3 hours to allow the cells to recover and allow plasmid expression. After recovery, centrifuge the culture at 4°C and 5000rpm for 5 minutes, discard 1 mL of supernatant, and retain only a small amount of culture medium. Use the remaining culture medium to gently resuspend the bacteria and then spread it on LB solid culture medium containing rifampicin and kanamycin. Place the culture dish in an incubator at 30°C for 3 days until a single colony appears. Pick a single colony on the LB solid culture medium and transfer it to a 2 mL centrifuge tube containing LB liquid culture medium containing rifampicin and kanamycin. Place the bacterial solution in a shaker and culture at 30°C and 230rpm for 36 hours to obtain a sufficient amount of Agrobacterium cells. After the culture is completed, take 2 μL of bacterial solution from each centrifuge tube for PCR verification amplification. The PCR reaction system is shown in Table 2, and the verification primer sequence used is shown in Table 4. The amplified PCR product is sent for sequencing to confirm the correctness of the plasmid DNA. The correct bacterial solution will be added to 50% glycerol, frozen with liquid nitrogen, and stored in an ultra-low temperature refrigerator at -80°C for subsequent experiments. PCR reaction system: 2× Rapid Taq Master Mix: 25μL, double distilled water: 22μL, primers: 1μL each, bacterial solution: 2μL.

[0072] Through this step, the Agrobacterium transformation, amplification and preservation of plasmid DNA were successfully achieved, providing a stable and reliable strain resource for subsequent plant transgenic experiments.

[0073] Use a 1mL needle to gently make a small hole on the back of a healthy, 3-year-old Dendrobium officinale leaf (be careful not to puncture it), then use a needle without the needle to absorb the bacterial solution and inject it into the leaf from the wound (press the front of the leaf with your finger to allow the bacterial solution to penetrate from the back of the leaf). Use a marker to mark the water-stained area of ​​the Dendrobium officinale leaf. Figure 3 The injected plants were placed in the dark for 12 h and then cultured at about 26°C. Leaf samples were collected on the third day after the injection, and the expression level of the Dof013141 gene in the leaves of D. officinale was verified using PCR and qRT-PCR methods, confirming the high level of expression of the gene.

[0074] (1) Choose healthy, 3-year-old leaves of Dendrobium officinale for injection. Young or wrinkled leaves are not easy to inject, and the expression efficiency of aging leaves is low. It is easier to inject when the stomata of the leaves are open, so it is best to inject during the day. (2) The concentration of Agrobacterium liquid is OD600 = 1.0. High concentrations may cause leaf death or affect the results.

[0075] Then, use III RT SuperMix was used for qPCR (Vazyme, China). Snapgene software was used for primer design. qRT-PCR was performed on an ABI-7500 real-time fluorescence quantitative PCR detection system. The reaction mixture contained 1 μL of template, the final volume was 20 μL, and the cDNA was diluted to 200 ng. Each experiment was repeated three times. The PCR amplification conditions were as follows: 95°C for 30 s, then 40 cycles of 95°C for 10 s, 60°C for 30 s, and finally extended at 60°C for 15 s. The expression data were calculated using the 2^-ΔΔCT method. GAPDH was an internal reference gene. The expression level of the Dof013141 gene in overexpressed plant tissues was quantitatively analyzed using qRT-PCR technology, as shown in Figure 2 The results show that the gene is significantly up-regulated when the plant is infected by Sclerotium rolfsii. The primer sequences are listed in Table 5.

[0076] Table 5: qRT-PCR primer sequences

[0077] Primer name Primer sequence 5'to3' Dof013141-F AGCGAGGAGGAGATGGAGCT Dof013141-R GGAGATAGTTCAGCCACCGAAG GAPDH-F TTCGGAAGGATTGGAAGGCTTGTAG GAPDH-R GAGATGATAACCTTCTTGGCACCGC

[0078] Example 3

[0079] In order to test the resistance effect of Dof013141 gene to white rot, the control group (non-transgenic Dendrobium officinale plants) and the experimental group (Dof013141 transgenic plants) were placed under the same conditions for artificial inoculation test. The specific steps are as follows:

[0080] The overexpression plasmid carrying the Dof013141 gene successfully constructed in Example 2 was introduced into the leaves of Dendrobium officinale, and cultured in a dark incubator for 24 hours at a temperature of 25°C to fully express the gene in the leaf cells. Subsequently, neat Sclerotium hyphae blocks with a diameter of 5 mm were used as pathogens and inoculated on the surface of the transformed Dendrobium officinale leaves to observe its disease resistance effect. After inoculation, the plants were placed in a constant temperature incubator at a temperature of 28°C, and a small amount of water was sprayed on the leaf surface every day to maintain a certain humidity in order to observe the occurrence and development of the disease. The symptom manifestations of the plants were recorded on the third day after inoculation, including the number and area of ​​lesions and the speed of disease progression. The experimental results showed that on the third day after inoculation, the lesion area of ​​the leaves of Dendrobium officinale overexpressing the Dof013141 gene was significantly smaller than that of the leaves of the control group (WT) after inoculation with the pathogen. The Dendrobium officinale plants in the control group showed obvious symptoms of white rot, including lesions at the inoculated bacteria block on the leaves, leaf wilting and necrosis, while the Dof013141 transgenic plants showed strong disease resistance, with a significant reduction in the number and area of ​​lesions, and good plant growth, indicating that the overexpression of this gene significantly enhanced the resistance of Dendrobium officinale to white rot. This result further verified the important role of the Dof013141 gene in regulating plant disease resistance. The specific experimental data and lesion area comparison are shown in Table 6. Figure 4 and Figure 5 . The experimental results showed that after the Dof013141 gene was overexpressed in Dendrobium officinale, the plant's resistance to white rot was significantly improved. This example proves the effectiveness of the Dof013141 gene as a disease resistance gene in Dendrobium officinale, and demonstrates its potential for application in disease-resistant breeding. This experiment provides strong evidence for the Dof013141 gene as a functional gene for resistance to white rot, highlights its potential in improving the disease resistance of Dendrobium officinale, and provides a scientific basis for future variety improvement and disease resistance mechanism research.

[0081] The white rot resistance gene Dof013141 provided by the present invention has demonstrated its potential for wide application in Dendrobium officinale and other susceptible plants, opening up a new path for disease-resistant breeding. Through the application of this gene, not only can the resistance of plants to white rot be significantly improved, but also a more environmentally friendly and efficient solution is provided for the green prevention and control of plant diseases. As an important tool in plant disease resistance research, the Dof013141 gene not only helps to deeply analyze the disease resistance mechanism of plants, but also can promote its genetic improvement in a variety of economic crops. In the future, this gene is expected to be widely used in agricultural production, not only to improve the disease resistance of crops, but also to reduce the use of chemical pesticides and achieve the goal of sustainable agricultural development. This invention provides innovative genetic resources and research directions for the fields of plant breeding and disease control.

[0082] Table 6: Statistics of the lesion area of ​​Dendrobium officinale leaves

[0083]

Claims

1. A gene Dof013141 related to resistance to white rot of Dendrobium officinale, characterized in that: The CDS sequence of the gene Dof013141 is shown in SEQ ID NO.

1.

2. The gene Dof013141 related to resistance to Sclerotium rot of Dendrobium officinale according to claim 1, characterized in that: The genes also include genes encoding proteins with similar domains as SEQ ID NO. 1, which are highly similar to the Dof013141 gene in structure and function.

3. The gene Dof013141 related to resistance to Sclerotium rot of Dendrobium officinale according to claim 1, characterized in that: The primers used to amplify the full-length CDS sequence of the gene Dof013141 are: Dof013141-F:ATGGAAGTACATGGAGGAGCA Dof013141-R: CTATTGTTGTAATAGCAAAAATCTTCC.

4. An overexpression vector pCAMBIA1301-35SN-Dof013141 of the gene Dof013141 related to the resistance to white rot of Dendrobium officinale according to claim 1.

5. The overexpression vector according to claim 4, characterized in that The overexpression vector construction method is preferably: Homologous recombination primers for amplifying the full-length CDS sequence of the gene Dof013141 were designed, and the full-length CDS sequence of the gene Dof013141 was used as a template for amplification. The amplified product was connected to the plant expression vector pCAMBIA1301-35SN, and then transformed and the plasmid was extracted to finally obtain the overexpression vector pCAMBIA1301-35SN-Dof013141.

6. The overexpression vector according to claim 4, characterized in that The nucleotide sequence of the plant expression vector pCAMBIA1301-35SN is shown in SEQ ID NO.

2.

7. A host cell, characterized in that The host cell uses Agrobacterium as a starting strain, and contains the overexpression vector pCAMBIA1301-35SN-Dof013141 described in claim 4.

8. Use of the gene Dof013141 according to claim 1, the overexpression vector according to claim 4, or the host cell according to claim 7 in improving the resistance of Dendrobium officinale to Sclerotium rolfsii.

9. The use according to claim 8, characterized in that: By overexpressing the Dof013141 gene, the resistance of Dendrobium officinale to white rot is improved.

10. Use of the gene Dof013141 according to claim 1, the overexpression vector according to claim 4, or the host cell according to claim 7 in cultivating Dendrobium officinale plants resistant to Sclerotium rolfsii.

Images