Root system silicon deposition and stress resistance regulation and control method based on gene overexpression and silicon supply strategy

Abstract

The invention discloses a root system silicon deposition and stress resistance regulation and control method based on gene overexpression and a silicon supply strategy. The gene which plays a key role in silicon deposition of the rice root system is found for the first time. The effect of independently overexpressing the gene or supplying silicon on the silicon non-accumulating plant is poor, but the resistance of the silicon non-accumulating plant in heavy metals (such as hexavalent chromium and cadmium) and high temperature stress can be remarkably improved by adopting a gene overexpression and silicon supplying strategy.

Description

Technical Field

[0001] The present invention belongs to the field of crop stress resistance, and more specifically, the present invention relates to a root silicon deposition and stress resistance regulation method based on gene overexpression and silicon supply strategy. Background Art

[0002] Food security in my country and around the world is threatened by environmental changes. Increasing industrial pollution and rapid urbanization have been increasing the release of pollutants into the environment, including heavy metals such as cadmium and chromium, which affect crop growth and affect human health through the food chain. In addition, human activities have accelerated the release of carbon dioxide and other greenhouse gases, leading to global warming and frequent extreme weather events; the threat of high temperature and drought stress to food security is becoming increasingly serious. Therefore, there is an urgent need to improve the resistance of crops to these different forms of abiotic stresses. Silicon, as an important beneficial element for plants, has been shown to be very effective in improving the resilience of crops to a range of abiotic and biotic stresses.

[0003] Although silicon is the second most abundant element in the earth's crust and soil, it is present in plants only in the form of unpolymerized silicic acid. This form of silicon can be absorbed by roots and transported to above-ground plant parts by transpiration and active transport. More than 90% of Si can be deposited as amorphous silica in the apoplast, especially in the cell wall, forming a defensive barrier against various stresses. For example, silicon can enhance the mechanical properties of cell walls to resist lodging, improve the stability of cell membranes to withstand high temperatures, reduce the entry of heavy metal ions into cells, and inhibit the colonization of pathogens and feeding by herbivores. Major cereal crops including rice, wheat, and corn are able to accumulate large amounts of silicon, which helps to increase crop yield and stress resistance, so silicon fertilizers are widely used for these crops. However, there are very large differences in silicon concentrations between different species and plant families, ranging from less than 0.1% to more than 10%. According to the silicon content and the absorption of silicon by plants, they can be divided into silicon-accumulating (stem silicon content is 1.5%-10%), passive (0.5-1.5%), and non-accumulating (<0.2%) species. In stark contrast to monocot species such as rice, many dicot species such as Arabidopsis are non-accumulators of Si and thus they are unable to form effective Si-based defense barriers, which limits its positive impact on stress resistance in these species. Summary of the invention

[0004] The purpose of the present invention is to adopt the strategy of "gene overexpression + silicon supply" to increase the deposition of silicon in the root system of low-silicon plants and improve their ability to resist stress by allowing low-silicon plants to produce components that induce silicon polymerization from high-silicon plants.

[0005] To achieve the above purpose, the specific technical solutions adopted by the present invention are as follows:

[0006] In the first aspect, the present invention provides a method for regulating root silicon deposition and stress resistance based on gene overexpression and silicon supply strategy, which utilizes Agrobacterium infection to introduce the CslF6 gene into a target plant to obtain a strain that can overexpress the CslF6 gene; during the growth of the strain, additional silicon is supplemented to the environment where its roots are located, so that the roots can obtain silicon from the environment and the plant's stress resistance is improved.

[0007] As a preferred embodiment of the first aspect above, the method of introducing the CslF6 gene into the target plant by Agrobacterium infection is as follows: first, a 35S promoter-driven CslF6 overexpression vector plasmid is constructed by PCR cloning, and then the CslF6 overexpression vector plasmid is introduced into Agrobacterium competent cells and infects the callus tissue of the target plant, and finally, gene integration is promoted by co-cultivation, and positive calli are screened for differentiation and rooting to obtain the strain capable of overexpressing the CslF6 gene.

[0008] As a preference in the above first aspect, the target plant is rice.

[0009] As a preferred embodiment of the first aspect, the callus of the target plant is peeled rice seeds.

[0010] As a preference of the first aspect above, the target plant is Arabidopsis thaliana.

[0011] As a preferred embodiment of the first aspect, the callus tissue of the target plant is an inflorescence of Arabidopsis thaliana.

[0012] In the second aspect, the present invention provides a method for root silicon deposition and stress resistance regulation based on gene overexpression and silicon supply strategy, which uses Agrobacterium infection to introduce the CslF6 gene into Arabidopsis, and obtains Arabidopsis seeds that can overexpress the CslF6 gene. Arabidopsis seedlings cultivated from Arabidopsis seeds are planted in a matrix under heavy metal stress, and during the growth of Arabidopsis, additional silicon is supplemented to its root environment, thereby improving the growth condition of Arabidopsis under heavy metal stress and reducing the accumulation of heavy metals in the aboveground part.

[0013] In the third aspect, the present invention provides a method for root silicon deposition and stress resistance regulation based on gene overexpression and silicon supply strategy, which uses Agrobacterium infection to introduce the CslF6 gene into Arabidopsis, and obtains Arabidopsis seeds that can overexpress the CslF6 gene. The Arabidopsis seedlings cultivated from the Arabidopsis seeds are planted in a substrate under high temperature stress, and during the growth of Arabidopsis, additional silicon is obtained from the root environment, thereby improving the tolerance of Arabidopsis to high temperature stress and alleviating the symptoms of abnormal root elongation.

[0014] As a preference of the second and third aspects above, the substrate is a culture medium or soil.

[0015] As a preferred embodiment of the first, second and third aspects, during the growth of the overexpression strain, additional silicon is provided to the root environment thereof in the form of applying silicic acid.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] Traditional soil silicon application has obvious effects on silicon-accumulating plants, but many silicon-non-accumulating plants have low silicon utilization efficiency and cannot form an effective silicon-based defense barrier. The gene overexpression + silicon strategy proposed in the present invention can expand the application scope of silicon fertilizer. Secondly, although the plant silicon transporters discovered so far can affect the silicon in the aboveground part, they do not affect the silicon in the roots. In many studies, it has been shown that silicon deposition in the roots is crucial for plants to resist heavy metals and salt stress. The present invention reports the CslF6 gene that affects root silicon deposition, which can affect the silicon content in the roots of silicon-non-accumulating plants, thereby improving stress resistance. In addition, overexpressing CslF6 and supplying silicon to non-silicon-accumulating plants alone cannot improve stress resistance, while the strategy of "gene overexpression + silicon supply" can significantly improve the growth of plants under stress regulation. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 A graph of the rates of silicate polymerization induced by different cell wall components;

[0019] Figure 2 The silicon concentration and hardness results of rice roots after adopting the gene overexpression + silicon supply strategy;

[0020] Figure 3 The results of Arabidopsis thaliana's resistance to hexavalent chromium stress after adopting the gene overexpression + silicon supply strategy;

[0021] Figure 4 The results of Arabidopsis thaliana's resistance to cadmium stress after adopting the gene overexpression + silicon supply strategy;

[0022] Figure 5 The results of Arabidopsis thaliana's resistance to high temperature stress after adopting the gene overexpression + silicon supply strategy. DETAILED DESCRIPTION

[0023] The present invention is further described and illustrated below in conjunction with the accompanying drawings and specific embodiments. The technical features of each embodiment of the present invention can be combined accordingly without conflicting with each other.

[0024] The present invention provides a method for regulating plant root silicon deposition and stress resistance by combining gene editing with silicon fertilizer application. The present invention first discovered that CslF6 is a key gene for regulating plant root silicon deposition. After overexpressing the gene and providing additional silicon, the plant's stress resistance can be significantly improved.

[0025] In the present invention, the specific implementation method of the root silicon deposition and stress resistance regulation method based on gene overexpression and silicon supply strategy is: the CslF6 gene is introduced into the target plant by Agrobacterium infection method to obtain a strain that can overexpress the CslF6 gene. During the growth of the strain, additional silicon is added to the environment where its root system is located, so that the root system obtains silicon from the environment, thereby improving the plant's stress resistance.

[0026] It should be noted that the method of introducing the CslF6 gene into the target plant by Agrobacterium infection is as follows: first, a 35S promoter-driven CslF6 overexpression vector plasmid is constructed by PCR cloning, and then the CslF6 overexpression vector plasmid is introduced into Agrobacterium competent cells and infects the callus tissue of the target plant. Finally, gene integration is promoted by co-cultivation, and positive calli are screened for differentiation and rooting to obtain a strain that can overexpress the CslF6 gene.

[0027] It should be noted that the target plant can be a monocot (e.g., rice) or a dicot (e.g., Arabidopsis thaliana). If the target plant is rice, the callus of the target plant can be the peeled rice seed. If the target plant is Arabidopsis thaliana, the callus of the target plant can be the inflorescence of Arabidopsis thaliana.

[0028] It should be noted that the CslF6 gene is a known regulatory gene present in rice, and its sequence is shown in SEQ ID No.1.

[0029] Many silicon non-accumulating plants have low silicon utilization efficiency and cannot form an effective silicon-based defense barrier. The present invention is applicable to silicon non-accumulating plants (such as Arabidopsis). Overexpression of CslF6 or silicon supply alone in dicotyledonous plants is not effective, but the use of both can significantly improve their stress resistance. Because by introducing the CslF6 gene from the typical high-silicon plant rice into silicon non-accumulating plants, when the plants grow in a stress environment, the overexpression of the CslF6 gene can increase the content of glucan on the root cell wall. Therefore, silicon is supplemented to the environment near the root system at this time, and silicon can be quickly deposited in the roots of the plants. By increasing the silicon content in the roots of silicon non-accumulating plants to form a defense barrier, the stress resistance of silicon non-accumulating plants in stress environments can be improved.

[0030] In the embodiments of the present invention, taking Arabidopsis thaliana as an example, the method can be used to improve its stress resistance in a heavy metal stress environment (such as hexavalent chromium and cadmium stress) or a high temperature stress environment.

[0031] In a heavy metal stress environment, the root silicon deposition and stress resistance regulation method based on gene overexpression and silicon supply strategy is specifically as follows: the CslF6 gene is introduced into Arabidopsis by using the Agrobacterium infection method to obtain Arabidopsis seeds that can overexpress the CslF6 gene, and the Arabidopsis seedlings cultivated from the Arabidopsis seeds are planted in a heavy metal stress matrix, and during the growth of Arabidopsis, additional silicon is supplemented to its root environment, thereby improving the growth of Arabidopsis under heavy metal stress and reducing the accumulation of heavy metals in the aboveground parts.

[0032] Under high temperature stress, the root silicon deposition and stress resistance regulation method based on gene overexpression and silicon supply strategy is specifically as follows: the CslF6 gene is introduced into Arabidopsis by using Agrobacterium infection to obtain Arabidopsis seeds that can overexpress the CslF6 gene. The Arabidopsis seedlings cultivated from the Arabidopsis seeds are planted in a substrate under high temperature stress. During the growth of Arabidopsis, additional silicon is supplemented to its root environment to improve the tolerance of Arabidopsis to high temperature stress and alleviate the symptoms of abnormal root elongation.

[0033] It should be noted that the above-mentioned matrix can be a culture medium or soil. When supplementing silicon to plants overexpressing CslF6, it can be directly applied to the soil without spraying on the leaves. In addition, during the growth of the strain, it is preferred to apply silicic acid to provide additional silicon to its root environment. Because silicon added in the form of silicic acid is easier to enter the plant body, the recommended silicic acid concentration is set to 1mM.

[0034] The specific implementation and technical effects of the present invention on different plants are described in detail below through several embodiments.

[0035] Example 1

[0036] In this example, preliminary experiments verified that increasing the amount of glucan on the cell wall can promote silicon deposition. The specific verification process is as follows:

[0037] First, 0.5 g of a series of different cell wall components (including: cellulose, pectin, lignin, xylan 1 (from Saccharum officinarum L.), xylan 2 (from Zea mays L.), xylanase 3 (from Faguslongipetilata Seem.), xyloglucan, glucan, glucomannan) were added to 20 mL of 10 mM silicic acid, and shaken on a shaker at 200 rpm, with three replicates for each component. In addition, a pure silicic acid group without adding cell wall components was established as a control group (CK) in this example.

[0038] Since unpolymerized silicic acid can react with molybdenum reagent to form silicomolybdic acid, while polymerized silicic acid cannot. Based on this principle, after five days, the concentration of unpolymerized silicic acid in the solution was determined using molybdenum blue photometry. The polymerization rate of silicic acid in different groups can be calculated by dividing the difference between the initial concentration (10mM) and the final concentration of unpolymerized silicic acid by the experimental period (5 days). By comparison, it was found that the silicic acid polymerization rate in the group with added dextran was the fastest ( Figure 1 ). Theoretically, by overexpressing the CslF6 gene that regulates glucan synthesis, more glucan can be deposited on the cell wall, promoting silicon deposition.

[0039] Example 2

[0040] In this embodiment, the silicon concentration and root hardness of rice roots are increased by the strategy of "gene overexpression + silicon supply".

[0041] First, primers for the CslF6 gene were designed and the target gene was amplified using PCR. The PCR amplification primer sequences are shown in SEQ ID No. 2 and SEQ ID No. 3, respectively, as follows:

[0042] Forward primer CslF6_0(+):aacacgggggactttgcaacatggcgccagcggtggcc

[0043] Reverse primer CslF6_0(-):tgaagacagagctagttacatcatggccaggcgtaggtgaag

[0044] Subsequently, restriction enzyme digestion was performed to prepare a vector containing the 35S promoter and a PCR product. Next, the digestion product was purified and the target gene CslF6 was ligated to the plasmid vector by DNA ligase, the ligation product was transformed into competent Escherichia coli, and positive clones were screened on a medium containing antibiotics. Finally, the correctness of the inserted gene was verified by plaque PCR and sequencing.

[0045] The primer sequences used in plaque PCR are shown in SEQ ID No.4 and SEQ ID No.5, respectively, and are as follows:

[0046] Forward primer CslF6(572C)(+):gtcggagaggtagcaggtg

[0047] Reverse primer HS)35seq(-):ttcatttggagagaacacgggggac

[0048] The four primers CslF6 (572C), CslF6 (1144C), CslF6 (1716C), and CslF6 (2288C) used for sequencing verification of the target gene are shown in SEQ ID No. 6, SEQ ID No. 7, SEQ ID No. 8, and SEQ ID No. 9, respectively, as follows:

[0049] CslF6(572C):gtcggagaggtagcaggtg

[0050] CslF6(1144C):ctggacgaacgcgacggt

[0051] CslF6(1716C):gcgggttgttcctcgaga

[0052] CslF6(2288C):gtggccgtggggatggtgag

[0053] Subsequently, 1 μL of plasmid was added to 50 μL of GV3101 Agrobacterium competent cells, mixed thoroughly and then pipetted into an electroporation cup, and 1 mL of LB liquid medium was added after electroporation, mixed thoroughly and then pipetted into a 1.5 mL centrifuge tube, and cultured on a shaker at 30°C and 180 rpm for 30 min. 50 μL of the activated Agrobacterium liquid was inoculated on LB solid medium and cultured in the dark at 30°C for 48 h. Rice grains with no mold spots and normal buds were selected, disinfected with 75% alcohol for 1 min, washed with sterile water for 1 min / time; disinfected with 15% sodium hypochlorite for 20 min, washed with sterile water 3 times for 1 min / time; the disinfected rice grains were inoculated into the induction medium and cultured under light at 26°C for 20 days. Pick Agrobacterium in the infection solution, prepare Agrobacterium resuspension with OD600=0.2, pick callus in a triangular flask, add Agrobacterium resuspension, discard the bacterial solution after infection for 10-15min, inoculate callus in co-cultivation medium, and co-cultivate at 20℃ for 48-72h. Inoculate callus in screening medium and culture in the dark at 26℃ for 20-30 days; inoculate positive callus in secondary screening medium, and be sure to pick monoclonal callus in the callus picking process, and culture in the dark at 26℃ for 7-10 days; inoculate positive callus in differentiation medium, culture in light at 25-27℃ for 15-20 days, and inoculate in rooting medium after differentiation of 2-5cm buds, and culture in light at 30℃ for 7-10 days. Extract genomic DNA from rice and amplify it using a PCR instrument. Finally, overexpression of CslF6 was confirmed by Western blot. Collect the offspring of mutants for further experiments.

[0054] Seeds were sterilized with 10% hydrogen peroxide for 10 min and germinated in the dark at 30°C for five days. Wild-type (WT) and overexpression (CslF6-OE) rice seedlings were grown in 1 / 4 Kimura B nutrient solution for 21 days and then transplanted to 1 / 4 Kimura B nutrient solution containing 1.0 mM silicic acid for 14 days. The nutrient solution was changed every 7 days. At harvest, root samples were collected, thoroughly washed with EDTA and deionized water, and dried in an oven. Then, the tissue was digested using a microwave digester, and the silicon concentration was measured using ICP-OES. Each rice variety had 5 biological replicates. In addition, some additional roots were collected for hardness testing.

[0055] Atomic force microscopy (AFM, Bruker Dimension Icon) was used to test the root hardness. Specifically, a portion of the root sample was taken and dispersed in an ethanol solution for ultrasonic treatment, and then a few drops of the dispersed liquid were taken and added dropwise to a mica sheet. AFM images were obtained using the tap mode at room temperature (25°C) using AFM. The local nanomechanical spring constant (K value) is determined by the slope of the linear part of the curve and can be used to represent the root hardness. Each group was analyzed three times, and at least three sections were measured each time.

[0056] The results of silicon concentration and hardness of rice roots after adopting the gene overexpression + silicon supply strategy are as follows Figure 2 As shown, the results showed that after using the "gene overexpression + silicon supply" strategy, the silicon concentration in rice roots increased by 27% and the hardness increased by 43%.

[0057] Example 3

[0058] In this example, the strategy of "gene overexpression + silicon supply" was used to improve the growth of non-silicon accumulating plants (Arabidopsis thaliana) under hexavalent chromium stress and reduce the accumulation of chromium in the aboveground parts.

[0059] First, the 35S promoter-driven CslF6 overexpression vector plasmid was constructed by PCR cloning. Take 1 μL of plasmid and add it to 50 μL of GV3101 Agrobacterium competent cells, mix thoroughly and then transfer to an electroporation cup. After electroporation, add 1 mL of LB liquid medium, mix thoroughly and then transfer to a 1.5 mL centrifuge tube, shake and culture on a shaker at 30 ° C and 180 rpm for 30 min, and take 50 μL of the activated Agrobacterium bacterial solution and inoculate it on LB solid medium, and culture it in the dark at 30 ° C for 48 h. Pick Agrobacterium in the resuspension, prepare an Agrobacterium resuspension with OD600 = 0.8-1.2, add silwet-77 to a concentration of 0.02%, dip all the inflorescences of Arabidopsis materials in the bacterial solution for 2-3 seconds, seal the film to keep the humidity > 90%, and culture it in the dark at 25 ° C for 24 hours. The infection cycle is 7 days, and a total of 3 times of infection. The seedlings after the infiltration were placed in 23℃16h / 8h light / dark culture until they set seeds; the mature fruit pods were gently rubbed onto clean white paper, wrapped and dried at 37℃ for 24h. After drying, they were sieved with a 60-mesh sieve and the clean seeds were stored at 4℃. The seeds were disinfected with 95% ethanol for 10min and 75% ethanol for 10min, washed with sterile water 2-3 times, 1min / time, and evenly spread on the corresponding resistance screening medium, and placed at 4℃ for 2-3 days; the plates were taken out and placed at 23-25℃, 16h / 8h light / dark culture for 10-14 days. The surviving seedlings were transplanted into nutrient soil and cultured at 23℃, 16h / 8h light / dark culture. Genomic DNA was extracted from Arabidopsis and amplified using a PCR instrument. Finally, the overexpression of CslF6 was confirmed by Western blot. The offspring of the mutants were collected for further experiments.

[0060] Wild-type and Arabidopsis seeds identified to overexpress CslF6 were used. All Arabidopsis seeds were surface sterilized with 10% (v / v) NaClO and 1% (v / v) Triton X-100 for 5 minutes and then treated with 75% (v / v) ethanol for 1 minute. The seeds were rinsed three times with deionized water and stored at 4°C for two days before sowing. The sterilized seeds were then sown on solid half-strength MS medium containing 1% (w / v) agar and 0.5% (w / v) sucrose (pH 5.7). All Arabidopsis seedlings were grown vertically at 23°C with a 12 / 12 h day / night cycle. After 7 days, they were transferred to 1 / 2 Hoagland's solution, which was changed every 7 days. After 21 days of transfer to the nutrient solution, wild-type (Col-0) and overexpressing Arabidopsis (Col-0) with comparable growth were selected. OsCslF6) for a five-day experiment, setting the hexavalent chromium stress concentration to 50 μM (prepared with potassium dichromate, the concentration is calculated as chromium). Both Arabidopsis plants were treated with silicon (1.0 mM silicic acid) and without silicon. After five days, the fresh weight of five plants in each group was measured. The aboveground parts were washed with deionized water. They were then dried and digested, and the chromium concentration was determined using ICP-OES.

[0061] The results of Arabidopsis thaliana resistance to hexavalent chromium stress after adopting gene overexpression + silicon supply strategy are as follows Figure 3 As shown in the results, the ability of Arabidopsis thaliana to resist hexavalent chromium was not much different from that of the wild-type control group without silicon supply when CslF6 was overexpressed alone and silicon was supplied alone. However, after adopting the strategy of "gene overexpression + silicon supply", the chromium resistance of Arabidopsis thaliana was greatly enhanced, the fresh weight increased by 59%, and the chromium concentration in the aboveground part decreased by 28%.

[0062] Example 4

[0063] In this example, the strategy of "gene overexpression + silicon supply" is used to improve the growth of non-silicon accumulating plants under cadmium stress and reduce the cadmium accumulation in the aboveground parts.

[0064] Wild-type and Arabidopsis seeds identified to overexpress CslF6 were used. All Arabidopsis seeds were surface sterilized with 10% (v / v) NaClO and 1% (v / v) Triton X-100 for 5 minutes and then treated with 75% (v / v) ethanol for 1 minute. The seeds were rinsed three times with deionized water and stored at 4°C for two days before sowing. The sterilized seeds were then sown on solid half-strength MS medium containing 1% (w / v) agar and 0.5% (w / v) sucrose (pH 5.7). All Arabidopsis seedlings were grown vertically at 23°C with a 12 / 12 h day / night cycle. After 7 days, they were transferred to 1 / 2 Hoagland's solution, which was changed every 7 days. After 21 days of transfer to the nutrient solution, wild-type (Col-0) and overexpressing Arabidopsis (Col-0) with comparable growth were selected. OsCslF6 ) for a five-day experiment, setting the cadmium stress concentration to 10 μM (prepared with cadmium chloride, the concentration is calculated as cadmium). Both Arabidopsis plants were treated with silicon (1.0 mM silicic acid) and without silicon. After five days, the aboveground fresh weight of five plants in each group was measured. The aboveground parts were washed with deionized water. They were then dried and digested, and the cadmium concentration was determined using ICP-OES.

[0065] The results of Arabidopsis thaliana resistance to cadmium stress after adopting gene overexpression + silicon supply strategy are as follows Figure 4 As shown in the results, the cadmium resistance of Arabidopsis thaliana with overexpression of CslF6 and silicon supply alone was not much different from that of the wild-type control group without silicon supply. After adopting the strategy of "gene overexpression + silicon supply", the cadmium resistance of Arabidopsis thaliana was greatly enhanced, the fresh weight increased by 44%, and the chromium concentration in the aboveground part decreased by 17%.

[0066] Example 5

[0067] In this embodiment, the growth condition of non-silicon accumulating plants under high temperature stress is improved by the strategy of "gene overexpression + silicon supply".

[0068] Wild-type and Arabidopsis seeds identified to overexpress CslF6 were used. All Arabidopsis seeds were surface sterilized with 10% (v / v) NaClO and 1% (v / v) Triton X-100 for 5 minutes and then treated with 75% (v / v) ethanol for 1 minute. The seeds were rinsed three times with deionized water and stored at 4°C for two days before sowing. The sterilized seeds were then sown on solid half-strength MS medium containing 1% (w / v) agar and 0.5% (w / v) sucrose (pH 5.7). All Arabidopsis seedlings were grown vertically at 23°C with a 12 / 12 h day / night cycle. After 7 days, they were transferred to 1 / 2 Hoagland's solution, which was changed every 7 days. After 21 days of transfer to the nutrient solution, wild-type (Col-0) and overexpressing Arabidopsis (Col-0) with comparable growth were selected. OsCslF6 ) conducted a five-day experiment, setting the stress temperature to 29°C (the optimum temperature for Arabidopsis is 23°C, and the temperature rise is 6°C). Both Arabidopsis plants were treated with silicon (1.0mM silicic acid) and without silicon. In addition, a group of wild-type plants without stress was set as a control. Studies have shown that root elongation is a typical symptom of mild high temperature. Therefore, after five days, the root length of five plants in each group was measured.

[0069] The results of Arabidopsis thaliana resistance to high temperature stress after adopting gene overexpression + silicon supply strategy are as follows Figure 5 As shown in the figure, the root length of Arabidopsis thaliana with overexpression of CslF6 and silicon supply alone was not much different from that of the wild type without silicon supply, and was significantly longer than the control group without stress. After adopting the strategy of "gene overexpression + silicon supply", the symptoms of Arabidopsis root length elongation were alleviated.

[0070] Through the above description, relevant staff can make various changes and modifications without departing from the technical idea of ​​the present invention. The technical scope of the present invention is not limited to the contents of the specification, and its technical scope must be determined according to the scope of the claims. The above-described embodiment is only a preferred solution of the present invention, but it is not intended to limit the present invention. Ordinary technicians in the relevant technical field can also make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, all technical solutions obtained by equivalent replacement or equivalent transformation fall within the protection scope of the present invention.

Claims

1. A method for regulating root silicon deposition and stress resistance based on gene overexpression and silicon supply strategy, characterized in that: The CslF6 gene was introduced into the target plant using the Agrobacterium infection method to obtain a strain that can overexpress the CslF6 gene; during the growth of the strain, additional silicon was added to the environment where its root system was located, so that its root system obtained silicon from the environment and the plant's stress resistance was improved.

2. The method for regulating root silicon deposition and stress resistance based on gene overexpression and silicon supply strategy according to claim 1, characterized in that: The method of introducing the CslF6 gene into the target plant using the Agrobacterium infection method is as follows: first, a 35S promoter-driven CslF6 overexpression vector plasmid is constructed by PCR cloning, then the CslF6 overexpression vector plasmid is introduced into Agrobacterium competent cells and infects the callus tissue of the target plant, and finally, gene integration is promoted by co-cultivation, and positive calli are screened for differentiation and rooting to obtain a strain that can overexpress the CslF6 gene.

3. The method for regulating root silicon deposition and stress resistance based on gene overexpression and silicon supply strategy according to claim 2, characterized in that: The target plant is rice.

4. The method for regulating root silicon deposition and stress resistance based on gene overexpression and silicon supply strategy according to claim 3, characterized in that: The callus tissue of the target plant is the rice grain after the husk is removed.

5. The method for regulating root silicon deposition and stress resistance based on gene overexpression and silicon supply strategy according to claim 2, characterized in that: The target plant is Arabidopsis thaliana.

6. The method for regulating root silicon deposition and stress resistance based on gene overexpression and silicon supply strategy according to claim 5, characterized in that: The callus tissue of the target plant is the inflorescence of Arabidopsis thaliana.

7. A method for regulating root silicon deposition and stress resistance based on gene overexpression and silicon supply strategy, characterized in that: The CslF6 gene was introduced into Arabidopsis thaliana by Agrobacterium infection to obtain Arabidopsis thaliana seeds that could overexpress the CslF6 gene. The Arabidopsis thaliana seedlings cultivated from the Arabidopsis thaliana seeds were planted in a substrate under heavy metal stress. During the growth of the Arabidopsis thaliana, additional silicon was provided to its root environment, thereby improving the growth of Arabidopsis thaliana under heavy metal stress and reducing the accumulation of heavy metals in the aboveground parts.

8. A method for regulating root silicon deposition and stress resistance based on gene overexpression and silicon supply strategy, characterized in that: The CslF6 gene was introduced into Arabidopsis thaliana by Agrobacterium infection to obtain Arabidopsis thaliana seeds that could overexpress the CslF6 gene. The Arabidopsis thaliana seedlings cultivated from the Arabidopsis thaliana seeds were planted in a substrate under high temperature stress. During the growth of the Arabidopsis thaliana, additional silicon was provided to its root environment to improve the growth of Arabidopsis thaliana under high temperature stress and alleviate the symptoms of root length elongation.

9. The method for regulating root silicon deposition and stress resistance based on gene overexpression and silicon supply strategy according to claim 7 or 8, characterized in that: The substrate is culture medium or soil.

10. The method for regulating root silicon deposition and stress resistance based on gene overexpression and silicon supply strategy according to claim 1, 7 or 8, characterized in that: During the growth of the overexpression lines, additional silicon was provided to their root environment in the form of silicic acid.

Images