Molecular marker and method for identifying sex of porphyra haitanensis

Abstract

The invention discloses a molecular marker and a method for identifying sex of porphyra haitanensis, the sequence of the female molecular marker is as shown in SEQ ID NO: 1, and the sequences of primers PhF1 for amplifying the marker are as shown in SEQ ID NO: 2 and SEQ ID NO: 3; the sequence of the male molecular marker is as shown in SEQ ID NO: 4, the sequences of primers PhM1 for amplifying the marker are as shown in SEQ ID NO: 5 and SEQ ID NO: 6, and the identification method comprises the following steps: extracting the genome DNA of the protonema or thallus of the porphyra haitanensis, carrying out PCR (Polymerase Chain Reaction) amplification by using the primers PhF1 and PhM1, carrying out electrophoresis detection on an amplification product, and judging the sex of the male and female porphyra haitanensis through a specific band. According to the method, the sex of the porphyra haitanensis thalli can be identified through PCR amplification and agarose gel electrophoresis, the homozygous protonema and the heterozygous protonema can be distinguished at the same time, operation is easy and rapid, and the method is not affected by environmental factors.

Description

Technical Field

[0001] The invention belongs to the technical field of biological detection and seaweed genetic breeding, and in particular relates to a molecular marker and a method for identifying the male and female sexes of Porphyra haitanensis. Background Art

[0002] Pyropia / Porphyra spp. is widely consumed by people due to its delicious taste and high nutritional value, and is cultivated on a large scale in China, Japan and South Korea. Pyropia cultivation not only produces great economic value, but also plays an important role in the ecological restoration of the cultivated sea areas. At present, the lavers that are cultivated on a large scale in my country include Pyropia haitanensis and Pyropia yezoensis. The former is mainly cultivated in Fujian, Zhejiang and Guangdong provinces, and the latter is cultivated in Jiangsu and Shandong provinces. In 2023, the scale of my country's laver industry reached 64,000 hectares, with an annual output of 210,000 tons, ranking first in the world, of which the output of Pyropia haitanensis accounts for about 75% of the country's total laver production.

[0003] The life cycle of Pyropia haitanensis consists of two heterotypic generations: a microscopic filamentous sporophyte (2n) and a large phyllophyte (n). After maturation, the phyllodes form female (caryocysts) and male (sperm) reproductive cells, which produce carpospores through sexual reproduction. The carpospores germinate into filaments, which release conchospores and germinate into phyllodes after maturation. Hybridization experiments using color mutants and wild-type phyllodes have confirmed that the first two divisions of germination of conchospores in Pyropia haitanensis are meiosis, and its sex is determined by a pair of alleles and separated in meiosis, so the offspring phyllodes of sexual reproduction are hermaphrodites (Zhang Y, Yan XH, Aruga Y. The sex and sex determination in Pyropia haitanensis (Bangiales, Rhodophyta). PLoS One, 2013, 8: e73414). In addition, the thallus regenerated from the isolated cells of Porphyra haitanensis, whether female or male, can undergo parthenogenesis, and through natural chromosome doubling, produce genetically completely homozygous filaments, the latter's offspring thallus are unisexual and fertile (Yan Xinghong, Li Lin, Chen Junhua, Youga Yousheng. Parthenogenesis and genetic pure line segregation of Porphyra haitanensis. High Technology Letters, 2007, 17(2): 205-210).

[0004] Under normal circumstances, the male thallus of Porphyra haitanensis matures earlier, while the female thallus matures relatively later. In addition, the maturity of the thallus will directly affect the yield and quality of Porphyra. Therefore, the offspring thallus of the excellent varieties of Porphyra haitanensis selected so far are mostly female. However, in the breeding process, the gender can only be identified after the thallus matures, which will relatively slow down the breeding process. In addition, during the hybrid breeding of Porphyra haitanensis, both heterozygous fruit spores and fruit cells can germinate to form filaments during parthenogenesis, so it is impossible to distinguish whether the selected filaments are heterozygous filaments or homozygous filaments. It can only be confirmed based on whether chimeric thallus appears in the offspring thallus, which is time-consuming and labor-intensive. Therefore, seeking a method for early gender identification is of great value to accelerate the breeding speed of Porphyra haitanensis.

[0005] Currently, sex-specific molecular markers can be used to accurately identify the genetic sex of organisms, and sex-related DNA molecular markers have been developed for many economic animals and plants, such as large yellow croaker (Larimichthys crocea), half-smooth tongue sole (Cynoglossus semilaevis), asparagus (Asparagus officinalis), kelp (Saccharina japonica) and Gracilariopsis lemaneiformis, etc. However, to date, there is still a lack of molecular markers that can effectively identify the genetic sex of Porphyra haitanensis. Summary of the invention

[0006] The invention aims to provide a molecular marker and method for quickly and accurately identifying the male and female sexes of Porphyra haitanensis.

[0007] The above-mentioned object of the present invention is achieved by the following technical solutions:

[0008] The present invention provides a molecular marker for identifying the female sex of Porphyra haitanensis, which comprises a female molecular marker and a male molecular marker; wherein:

[0009] The nucleotide sequence of the female molecular marker is shown in SEQ ID NO:1, specifically: ctgcggctgttgctgttctgacaagttgctccgtatggattggttgtgtctctcctcctggcccctcgcttgtctccctctgtacactcatgcagccatgggcatctgcgtcaccatcctcaagcgacgttgccgttccgtaggcatccacgcttggccgtaccgaaagatggccatggttgagaagaggattcagctgcgcgagacgatgctcttggatggtagcgccgagcttactgatgactcgtctgaggcgctcagggcggagatatccgagctgaagctccgtatggatctgcttcggaagaatccgaacttgaagtcaagcgacctggtctgaggtatgcctatgaccgtgttctgaacctcatgcttctgtgagtgtctatttattctccgctctcagcctgtctatctgagtggctatgaaattttggcaaacaaggcgtgtacaaagtactccgccaaggcatga;

[0010] The nucleotide sequence of the male molecular marker is shown in SEQ ID NO:4, specifically:.

[0011] Preferably, the sequence of the primer PhF1 for amplifying the female molecular marker is shown in SEQ ID NO: 2 and SEQ ID NO: 3, specifically:

[0012] F: ctgcggctgttgctgttc (SEQ ID NO: 2);

[0013] R: tcatgccttggcggagta (SEQ ID NO: 3).

[0014] Preferably, the sequence of the primer PhM1 for amplifying the male molecular marker is shown in SEQ ID NO:5 and SEQ ID NO:6, specifically:

[0015] F: actcatgcacgtcctccctt (SEQ ID NO: 5);

[0016] R: ctcggttggaaagtctgtgg (SEQ ID NO: 6).

[0017] The present invention also provides a primer for amplifying the female molecular marker or the use of the primer PhF1 in identifying female or hybrid strains of Porphyra haitanensis.

[0018] The present invention also provides a primer for amplifying the male molecular marker or the use of the primer PhM1 in identifying male or hybrid strains of Porphyra haitanensis.

[0019] The present invention also provides a method for identifying the sex of Porphyra haitanensis, comprising the following steps:

[0020] (1) extracting genomic DNA from the conidia or thallus of Porphyra haitanensis;

[0021] (2) using the primer PhF1 and the primer PhM1 to perform PCR amplification respectively;

[0022] (3) Electrophoresis detection of amplified products;

[0023] 1) If only a specific band of 475 bp in length can be detected in the amplification product of primer PhF1, it is judged that the filaments of Porphyra haitanensis are homozygous and the thallus of its offspring are female;

[0024] 2) If only a specific band of 596 bp in length can be detected in the amplification product of primer PhM1, it is judged that the filaments of Porphyra haitanensis are homozygous and the thallus of its offspring are male;

[0025] 3) If a specific band of 475 bp and 596 bp in length can be detected in the amplification products of primer PhF1 and primer PhM1, respectively, it is judged that the filaments of Porphyra haitanensis are heterozygous and the thallus of its offspring are hermaphrodites.

[0026] Compared with the prior art, the present invention has the following beneficial effects:

[0027] (1) The present invention uses DNA molecular marker technology to identify the sex of Porphyra haitanensis. Only two simple PCR amplifications and agarose gel electrophoresis are required to identify the sex of Porphyra haitanensis thallus and distinguish between homozygous and heterozygous filaments. The results are accurate, reliable, and not affected by environmental factors.

[0028] (2) The molecular marker provided by the present invention has the advantages of stable detection results, quick operation, good stability and low detection cost, and is used to identify the male and female thallus of Porphyra haitanensis, and has important application value in the fields of biological detection and seaweed genetic breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1The figures are the electrophoresis results of the DNA amplification products of the filaments and thallus of the female strain of Porphyra haitanensis using female (A) and male (B) specific primers in the example; wherein, 1-3 are thallus of the XS-1 strain; 4-6 are thallus of the WT-10 strain; 7-9 are thallus of the SF-2 strain; 10 is filament of the XS-1 strain; 11 is filament of the WT-10 strain; 12 is filament of the SF-2 strain; and M is a 2000bp DNA Ladder Marker.

[0030] Figure 2 The figures are the electrophoresis results of DNA amplification products of filaments and thallus of the male strain of Porphyra haitanensis using female (A) and male (B) specific primers in the example; wherein, 1-3 are thallus of HR-6 strain; 4-6 are thallus of BA-1 strain; 7-9 are thallus of T2-1 strain; 10 is filament of HR-6 strain; 11 is filament of BA-1 strain; 12 is filament of T2-1 strain; and M is 2000bp DNA Ladder Marker.

[0031] Figure 3 The results of electrophoresis of DNA amplification products of the four-color block chimeric thallus of the hybrid filaments of Porphyra haitanensis and its offspring using female (A) and male (B) specific primers in the example; wherein, 1-6 are the offspring thallus of the hybrid filament Z149; 7-12 are the offspring thallus of the hybrid filament Z150; 13 is the hybrid filament Z149; 14 is the hybrid filament Z150; M is a 2000 bp DNA Ladder Marker. DETAILED DESCRIPTION

[0032] The following embodiments will further illustrate the present invention in conjunction with the accompanying drawings.

[0033] Example 1

[0034] This example proposes a marker and method for identifying the sex of Porphyra haitanensis, which are as follows:

[0035] (1) DNA extraction: Genomic DNA was extracted from the conchoceles and thallus of Porphyra haitanensis, and the DNA quality was detected by measuring the OD value and 1% agarose gel electrophoresis.

[0036] (2) PCR amplification: The female-specific primer PhF1 and the male-specific primer PhM1 were used to amplify the conidia and thallus DNA of Porphyra haitanensis, respectively.

[0037] The sequence of the PhF1 primer is as follows:

[0038] F: ctgcggctgttgctgttc (SEQ ID NO: 2);

[0039] R: tcatgccttggcggagta (SEQ ID NO: 3).

[0040] The sequence of the PhM1 primer is as follows:

[0041] F: actcatgcacgtcctccctt (SEQ ID NO: 5);

[0042] R: ctcggttggaaagtctgtgg (SEQ ID NO: 6).

[0043] The PCR reaction system was: 1 μL of 20 ng / μL DNA template, 12.5 μL of 2×Taq Master Mix, 1 μL each of 10 μmol / L primer-F and primer-R, and ddH2O was added to 25 μL.

[0044] The reaction procedure was: pre-denaturation at 94°C for 5 min; 40 cycles: denaturation at 94°C for 30 s, annealing (temperature depends on primers) for 30 s, extension at 72°C for 30 s; extension at 72°C for 10 min, and insulation at 4°C.

[0045] Take 5 μL of PCR amplification product and run it on 1% agarose gel electrophoresis under the following conditions: buffer 1×TAE, voltage 200 V, current 150 mA, time 0.5 h. Then use gel imaging to detect the electrophoresis product. The results are as follows: Figure 1-3 As shown in Figure 2, the PhF1 primer was found to amplify a 475 bp band in the filaments and thallus of the female strain of Porphyra haitanensis, while the PhM1 primer had no extension product in the female strain ( Figure 1 ); The PhF1 primer did not produce any extension product in the filaments and thallus of the male strain of Porphyra haitanensis, while the PhM1 primer could extend a 596 bp band in the male strain ( Figure 2 ); Both PhF1 and PhM1 primers can amplify bands in the heterozygous conidia of Porphyra haitanensis and its progeny tetra-chimeric thallus (hermaphrodites), with sizes of 475 bp and 596 bp, respectively ( Figure 3 ).

[0046] (3) Recovery and sequencing of the target band: The target band obtained in step (2) of Example 1 was recovered and sequenced. The results showed that the sequence of the target band of 475 bp was as shown in SEQ ID NO: 1, and the sequence of the target band of 596 bp was as shown in SEQ ID NO: 4.

[0047] The test results of this example show that the marker bands amplified by the primers PhF1 and PhM1 can be used to identify the male and female sexes of Porphyra haitanensis thallus, and can distinguish between homozygous and heterozygous filaments.

[0048] In summary, the molecular markers provided by the present invention are used to identify the sex of Porphyra haitanensis. Only two simple PCR amplifications and agarose gel electrophoresis are required to identify the sex of the Porphyra haitanensis thallus and to distinguish between homozygous and heterozygous filaments. The results are accurate and reliable and are not affected by environmental factors. The molecular markers provided by the present invention have important application value in biological detection and genetic assisted breeding of seaweed.

[0049] The above description of the embodiments is to facilitate the understanding and use of the present invention by those skilled in the art. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative work. Therefore, the present invention is not limited to the above embodiments. Improvements and modifications made by those skilled in the art based on the principles of the present invention without departing from the scope of the present invention should be within the protection scope of the present invention.

Claims

1. A molecular marker for identifying the female sex of Porphyra haitanensis, characterized in that: It includes female molecular markers and male molecular markers; among which: The nucleotide sequence of the female molecular marker is shown in SEQ ID NO: 1; The nucleotide sequence of the male molecular marker is shown in SEQ ID NO:

4.

2. The molecular marker for identifying the female sex of Porphyra haitanensis according to claim 1, characterized in that: The sequences of the primer PhF1 for amplifying the female molecular marker are shown in SEQ ID NO:2 and SEQ ID NO:

3.

3. The molecular marker for identifying the female sex of Porphyra haitanensis according to claim 1, characterized in that: The sequences of the primer PhM1 for amplifying the male molecular marker are shown in SEQ ID NO:5 and SEQ ID NO:

6.

4. Use of the primer for amplifying the female molecular marker of claim 1 or the primer PhF1 of claim 2 in identifying female or hybrid strains of Porphyra haitanensis.

5. Use of the primer for amplifying the male molecular marker according to claim 1 or the primer PhM1 according to claim 3 in identifying male or hybrid strains of Porphyra haitanensis.

6. A method for identifying the sex of Porphyra haitanensis, characterized in that: The steps include: (1) extracting genomic DNA from the conidia or thallus of Porphyra haitanensis; (2) using the primer PhF1 described in claim 2 and the primer PhM1 described in claim 3 to perform PCR amplification respectively; (3) Electrophoresis detection of amplified products; 1) If only a specific band of 475 bp in length can be detected in the amplification product of primer PhF1, it is judged that the filaments of Porphyra haitanensis are homozygous and the thallus of its offspring are female; 2) If only a specific band of 596 bp in length can be detected in the amplification product of primer PhM1, it is judged that the filaments of Porphyra haitanensis are homozygous and the thallus of its offspring are male; 3) If a specific band of 475 bp and 596 bp in length can be detected in the amplification products of primer PhF1 and primer PhM1, respectively, it is judged that the filaments of Porphyra haitanensis are heterozygous and the thallus of its offspring are hermaphrodites.

Images