A kit for human T lymphocyte counting based on gene methylation detection

Abstract

The present invention provides a kit for realizing human T lymphocyte counting based on gene methylation detection, and the kit is a kit for detecting methylation of B-cell lymphoma / leukemia 11B (BCL11B) gene in a sample. The present invention proposes for the first time that the unmethylated gene region of the BCL11B gene can be used as a biomarker for T lymphocyte identification. The present invention quantifies the copy number of the BCL11B target gene and the internal reference gene by PCR technology, and can conveniently and quickly perform relative quantitative analysis of T lymphocytes in a small amount of blood or dried blood films. The target detected by the present invention is the methylation level of leukocyte DNA in the sample, and can be applied to various types of samples, including fresh or frozen blood, isolated PBMC cells, dried blood spots, etc., and the requirements for samples are greatly reduced.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology, and in particular to a kit for realizing human T lymphocyte counting based on gene methylation detection. Background Art

[0002] Lymphocytes are important cellular components that help the human body resist diseases and stimulate immune responses. They express differentiation antigens, namely CD molecules, during the differentiation and maturation process. Depending on the expression of CD molecules, lymphocyte subsets mainly include T lymphocytes, B lymphocytes, and NK cells. T lymphocytes originate from the bone marrow and then transfer to the thymus to mature. The characteristic markers of T lymphocytes include CD3 and T cell receptors (TCR). According to their functions and surface molecules, they can be mainly divided into CD4+ T cells, CD8+ T cells, and other types.

[0003] The proportion, number and function of different lymphocyte subsets will directly affect the body's immune status. "Lymphocyte subset" detection is an important indicator for evaluating the body's current immune function and balance state, especially for patients with immune dysfunction. It is an indispensable diagnostic item. Under normal circumstances, each lymphocyte subset maintains a certain proportion and number, and works together to maintain the body's homeostasis. During the course of the disease, the proportion and number of immune cells will undergo pathological changes, leading to immune dysfunction. The application scenarios of lymphocyte counting are wide-ranging, mainly including early screening of abnormal total lymphocyte subsets in patients with infection and malignant tumors, verification after screening for primary immunodeficiency, auxiliary diagnosis of chronic lymphocytic leukemia (CLL), post-treatment detection and monitoring of HIV-positive patients, and immune and immune reconstruction monitoring, such as evaluation of immune reconstruction after immunosuppressive treatment for transplantation, autoimmunity and other immune conditions and after hematopoietic stem cell transplantation.

[0004] Currently, flow cytometry (FCM) is the standard method for counting lymphocyte subsets or T lymphocytes. It uses different monoclonal antibodies to bind to CD antigens on the surface of lymphocytes, and then uses multi-color fluorescent dyes to simultaneously detect surface antigens of several lymphocytes, separate T lymphocytes from white blood cells, and thus obtain the number and relative proportion of T lymphocytes. There are several limitations in the use of flow cytometry for T lymphocyte counting: First, the sample requirements are high. The cells to be tested must be intact, and the blood sample must be "fresh", and generally the test is required to be performed within 8 hours; second, due to the high sample requirements for flow cytometry T lymphocytes, blood collection is more problematic for certain application scenarios such as infants and young children; third, flow cytometry detects the fluorescent signal of the complex after the fluorescently labeled antibody binds to the antigen on the cell surface, and it is necessary to determine the threshold between the positive and negative complexes. However, for the surface antigens of different cell subpopulations, their expression is not a process of presence or absence, but different expression levels of low, medium, and high. Therefore, T lymphocyte subpopulations may be counted inaccurately due to inaccurate threshold determination; fourth, due to differences in samples, immunological detection techniques, and operating procedures, the test results of each laboratory vary greatly. Standardization of flow cytometry T lymphocyte counting remains a challenge, and a standardized scheme needs to be established.

[0005] DNA methylation modification plays an important role in the differentiation and development of T lymphocytes. It regulates the expression and shutdown of genes, thereby providing specific methylation markers for T lymphocytes. For example, the promoter regions of some genes involved in the differentiation and development of T lymphocytes are completely unmethylated in T lymphocytes, but highly methylated in other lymphocyte subsets outside of lymphocytes, such as B lymphocytes, NK cells, and non-lymphocytes such as granulocytes and monocytes. These unmethylated CpG sites can be used as specific differentially methylated regions (DMRs), that is, as biomarkers, to identify T lymphocytes and to quantify T cells in peripheral blood. This type of T lymphocyte is characterized not by cell morphology or surface markers, but by epigenetic means, which is expected to overcome the limitations of the above-mentioned flow cytometry method. Summary of the invention

[0006] In order to overcome the above problems, the present invention provides a kit for realizing human T lymphocyte counting based on gene methylation detection, wherein the kit is a kit for detecting BCL11B gene methylation in a sample.

[0007] In one embodiment, the kit is a kit for detecting fragments in the differentially methylated region hg38chr14: 99189637-99188739 on the BCL11B gene.

[0008] In one embodiment, the kit is a kit for detecting the differentially methylated region hg38chr14: 99189331-99189185 on the BCL11B gene.

[0009] In one embodiment, the kit is a kit for detecting a gene region comprising at least one of the differentially methylated sites hg38 chr14: 99189256, hg38 chr14: 99189339, hg38 chr14: 99189410 and hg38 chr14: 99189483 on the BCL11B gene.

[0010] In one embodiment, the kit calculates the ratio of human T cells to human leukocytes by detecting the copy numbers of the internal reference gene and the BCL11B gene.

[0011] In one embodiment, the internal reference gene is the RPP30 gene.

[0012] In one embodiment, the kit is a sequencing kit, a quantitative PCR kit, or a digital PCR kit.

[0013] In one embodiment, the kit includes: primers and probes for detecting the methylation status of CpG sites in the region of hg38 chr14: 99189331-99189185 and primers and probes for detecting the copy number of an internal reference gene.

[0014] In one embodiment, the kit comprises: an upstream primer SEQ ID No. 4: GGTAGTTTGGTTGTGTATTTGGGTATTT, a downstream primer SEQ ID No. 5: AACCTACAACACTTCTACAACACTTTAC, and a probe SEQ ID No. 6: CTACCAAAACATAATCAT.

[0015] In one embodiment, the sample is selected from the group consisting of a body fluid, a tissue sample and an organ sample.

[0016] In one embodiment, the sample is selected from the group consisting of peripheral blood samples, capillary blood samples or venous blood samples or subfractions thereof, peripheral blood mononuclear cells, blood clots and dried blood spots.

[0017] Based on the above situation, in order to overcome the current technical limitations of cytological T lymphocyte counting and expand its applicability, the present invention first proposed that the unmethylated gene region of the BCL11B gene can be used as a biomarker for T lymphocyte identification.

[0018] The β value of the CpG site in the methylation chip represents the degree of methylation. Comparing the β difference (Δβ value) of the corresponding CpG points between each group of samples can screen the differential methylation sites. The larger the absolute value of the Δβ value, the greater the difference in the degree of methylation of the site, and the stronger the specificity of the site. When screening the differential CpG sites of T lymphocytes based on the above principle, the present invention creatively sets another screening condition: the Δβ values ​​of the adjacent 4-5 CpG sites in the methylation chip are as large as possible, and these sites are continuous and as dense as possible, so as to ensure that the gene fragment composed of these 4-5 methylation sites has the greatest specificity, thereby meeting the needs of potential biological markers. According to this screening condition, the present invention finally identified four differentially methylated sites on the BCL11B gene with large Δβ values ​​and relatively dense distribution: cg07015803 (hg38 chr14: 99189256), cg16452866 (hg38 chr14: 99189339), cg04712122 (hg38 chr14: 99189410) and cg16147511 (hg38 chr14: 99189483).

[0019] In view of the fact that a gene sequence is used for regulating genes or for methylation detection, a differential methylation region (DMR) must be determined from the differential methylation sites screened above, which is used as a specific marker for distinguishing T lymphocytes. At the same time, the CpG sites covered by the probes in the methylation chip are also non-continuous. The present invention uses the 4 screened differential methylation sites as the base point, and verifies the methylation status of the 44 CpG sites contained in the sequence of about 500bp before and after them by Sanger sequencing after bisulfite conversion and PCR amplification. In T lymphocytes, these sites are all unmethylated, while in other subgroups, these CpG sites are all methylated, which is completely consistent with the methylation status of the 4 screened differential methylation sites, thereby determining a differential methylation region of about 900bp consisting of 44 methylation sites (hg38chr14: 99189637-99188739) as a specific unmethylated region of T lymphocytes.

[0020] In the approximately 900 bp differentially methylated region verified above, multiple amplicon detection fragments with relatively concentrated CpG sites and covering different methylation sites were selected, such as AMP9543, AMP8974 and AMP9324, and primers and probes for the corresponding methylation conversion fragments were designed. The ΔCt values ​​(Ct negative-Ct positive) of the candidate amplicons were compared by fluorescent quantitative PCR (qPCR) results. The higher the ΔCt value, the better the specificity for T lymphocytes. Therefore, a 147 bp differentially methylated region (hg38 chr14: 99189331-99189185) corresponding to the amplicon AMP9324 on the BCL11B gene was selected, which has better specificity and sensitivity and can be used as a biomarker for T lymphocyte identification.

[0021] The technical solution adopted by the present invention is: first, the gDNA of the sample to be tested is extracted, and the extracted gDNA is used as a DNA template after bisulfite conversion. Then, a double qPCR amplification is performed using primer probes specific to the amplicon of the BCL11B target gene and primer probes specific to the internal reference gene RPP30. The amplification reaction is run on a qPCR instrument, and the amplification result is given in the form of a fluorescence curve. Purified T lymphocytes are selected as the reference system, and the fluorescence curve and 2 -ΔΔCt The method can be used to calculate the relative content of T lymphocytes in leukocytes. In addition, a digital PCR detection platform can also be used to directly detect the copy number of the BCL11B target gene and the RPP30 reference gene. According to the corresponding relationship between the copy number of the reference gene and the number of cells (the copy number of RPP30: the number of cells = 2:1), the formula: the relative content of T lymphocytes (%) = the copy number of the BCL11B target gene / the copy number of the reference gene ╳100 can be used to calculate the relative content of T lymphocytes in leukocytes. The RPP30 reference gene detection fragment selected by the present invention is stably expressed in all leukocytes, and the cytosines in the sequence are all in an unmethylated state.

[0022] The target of the present invention is the methylation level of leukocyte DNA in the sample, which can be applied to various types of samples, including fresh or frozen blood, isolated PBMC cells, dried blood spots, etc. The requirements for samples are greatly reduced, and there is no requirement for the storage state of the samples; secondly, DNA amplification detection requires a small amount of samples, and trace DNA can meet the detection requirements; thirdly, the detection signals obtained by PCR are digital, which represent a positive or negative value for each cell, rather than an arbitrarily defined "positive" threshold like the flow cytometry method; finally, epigenetic qPCR can be performed in an automated, operator-independent manner, and reduce sensitivity to reagent variability. The kit of the present invention is not only a beneficial supplement to traditional flow cytometry detection, but also can serve the screening of severe combined immunodeficiency (SCID) in newborns. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0024] Figure 1 It is a DMR sequence used to identify the BCL11B gene of T lymphocytes;

[0025] Figure 2 It is a sulfite-converted DMR sequence used to identify the BCL11B gene of T lymphocytes;

[0026] Figure 3 This is the PCR amplification curve result of plasmid DNA to verify TPG specificity;

[0027] Figure 4 This is the PCR amplification curve result of plasmid DNA to verify CPG specificity;

[0028] Figure 5 This is the PCR amplification curve of the methylation standard to verify the TPG specificity;

[0029] Figure 6 This is the PCR amplification curve of the methylation standard to verify the CPG specificity;

[0030] Figure 7 It is a bar graph of gradient methylation standards to verify the specificity of the PCR system;

[0031] Figure 8 It is a linear plot of gradient methylation standards to verify the specificity of the PCR system;

[0032] Fig. 9 This is a graph showing the digital PCR results of purified cells to verify the marker specificity. DETAILED DESCRIPTION

[0033] In order to enable those skilled in the art to better understand the technical solutions in the present application, the present invention will be further described below in conjunction with the embodiments. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without making creative work should belong to the scope of protection of the present application. In the following embodiments, unless otherwise specified, all are conventional methods.

[0034] The experimental methods in the following examples without specifying specific conditions are usually carried out under conventional conditions or conditions recommended by the manufacturers. The various chemical reagents used in the examples are all commercially available products.

[0035] Example 1 Discovery of differentially expressed genes and differentially methylated regions

[0036] In order to find the DNA methylation regions specific to T lymphocytes, we first analyzed the 450K and 850K methylation chip data from Illumina, and obtained the methylation β value through operations such as probe filtering. Then the β threshold was set to 0.2 and 0.8. After processing and analysis in the confirmation data set and the validation data set, the differential sites were obtained by comparing the overall methylation levels of different lymphocyte subset samples and performing data quality control and standardization operations. The differences in the sites were measured by the Δβ value. The larger the absolute value of the Δβ value, the more obvious the difference between the groups. According to the absolute value of the Δβ value greater than 0.5 and the Q value less than 0.01 (Q<0.01 represents a significant difference), we selected the differential genes BCL11B and CD3D / E / G with more differential sites. The CD3D / E / G gene encodes a subunit of the membrane protein CD3. The membrane protein CD3 is a T cell-specific molecule that is expressed on the surface of T cells. Its function is to transduce the activation signal generated by the T cell antigen receptor recognizing the antigen, which is essential for the normal development and function of T cells. The BCL11B gene is expressed at all stages of T cell development and regulates T cell proliferation and differentiation, and is an important factor in maintaining T cell identity. On the basis of obtaining differentiated genes, the present invention sets another screening condition: the Δβ values ​​of 4-5 adjacent CpG sites in the methylation chip are as large as possible, and these sites are continuous and as dense as possible, so that the gene fragment composed of these 4-5 methylation sites can be guaranteed to have the greatest specificity, thereby meeting the needs of potential biological markers. As shown in Table 1, the average Δβ value (-0.77) of several relatively dense differential methylation sites on the BCL11B gene (cg07015803, cg16452866, cg04712122 and cg16147511) is larger than the average Δβ value (-0.73) of several relatively dense differential methylation sites on the CD3D gene (cg07728874, cg24841244, cg03074244, cg16036316). Therefore, we screened and obtained four differentially methylated sites on the BCL11B gene with large Δβ values ​​and relatively dense distribution, namely, the specific positions corresponding to the BCL11B gene are hg38 chr14: 99189256, hg38 chr14: 99189339, hg38 chr14: 99189410 and hg38 chr14:99189483.

[0037] Table 1 Screened differential genes and differential sites

[0038]

[0039] Next, the present invention confirms the differential sites by experimental methods. Using gDNA of purified T lymphocytes from fresh peripheral blood after sulfite conversion as a positive template and gDNA of non-T lymphocytes from the same source after sulfite conversion as a negative template, Sanger sequencing and pyrophosphate sequencing verification were performed after qPCR amplification. As shown in the verification results in Table 2, the four differentially methylated sites (cg07015803, cg16452866, cg04712122 and cg16147511) on the BCL11B gene are indeed differentially methylated sites.

[0040] In view of the fact that a gene sequence is used for regulating genes or for methylation detection, a DMR must be determined from the above-screened differential methylation sites to be used as a specific marker for distinguishing T lymphocytes. At the same time, the CpG sites covered by the probes in the methylation chip are also non-continuous. The present invention uses the above-determined 4 differential methylation sites as the base point, expands the possible range of differential sites in the sequence of about 500bp upstream and downstream of the gene (the gene fragment length is 1000bp and the CG point is relatively dense), and then searches for possible differential methylation region DMR. The gDNA derived from purified T lymphocytes is converted by bisulfite, and multiple pairs of universal primers are designed to amplify the target gene fragments where multiple possible differential methylation sites are located, and then Sanger sequencing is performed. It can be seen from the sequencing results shown in Table 3 that when the positive template is amplified, the sequencing results of each site to be tested are expressed as "T" (unmethylated state), and when the negative template is amplified, the sequencing results are expressed as "C" (methylated state), which is completely consistent with the methylation state of the 4 differential methylation sites screened. Based on this, the present invention determined the differentially methylated region DMR (hg38 chr14: 99189637-99188739) composed of the above 44 differentially methylated sites, and the DMR is distributed in the promoter region of the BCL11B gene.

[0041] Table 2 Sanger sequencing and pyrosequencing validation results of the four differentially methylated sites on the BCL11B gene.

[0042]

[0043] Table 3 Sanger sequencing results of each tested site.

[0044]

[0045] In particular, Figure 1 The DNA sequence, CpG site analysis, and specific gene localization of four differentially methylated sites for the DMR of the BCL11B gene used to identify T lymphocytes are shown. Figure 1 The four differentially methylated sites are bold and underlined.

[0046] Example 2 Determined Amplicon and Specific Primer Probe

[0047] Figure 2 The bisulfite-converted DNA sequences of the identified DMR regions are shown. Figure 2 The horizontal boxes in correspond to the CpG positions (CpG 1, 2, …, 44) in the analyzed BCL11B gene, and the positions indicated (hg38 chr14: 99189637, hg38 chr14: 99189621 …, hg38 chr14: 99188739) correspond to CpG 1, 2, …, CpG44. To further determine the optimal target gene amplicon sequence, three sets of primers and probes were designed according to the MethyLight rule for the amplicon AMP9543 (CpG5-CpG12, specific genomic location is hg38 chr14: 99189545-99189367), AMP9324 (CpG14-CpG25, specific genomic location is hg38chr14: 99189331-99189185) and AMP8974 (CpG31-CpG41, specific genomic location is hg38 chr14: 99188984-99188797), and the primers and probes were optimized to achieve the best specificity and sensitivity. As shown in Table 4, SEQ ID No. 1-15 shows the specific primer and probe sequences used according to the present invention. The present invention uses positive samples (gDNA extracted and transformed from T cells) and negative samples (gDNA extracted and transformed from non-T cells) as templates for the TPG system of the qPCR detection platform, and uses ΔCt (Ct negative-Ct positive) to evaluate the specificity of the amplicon in identifying T cells. The higher the ΔCt value, the better the specificity for T lymphocytes. The results of qPCR are shown in Table 5. The primer probe corresponding to AMP9324 shows the largest ΔCt, which particularly shows that this amplicon has good specificity and sensitivity and can be used as a biomarker for identifying T lymphocytes.

[0048] Preferably, Figure 2The underlined positions (genomic locations hg38 chr14: 99189331-99189185) show the CPG sites analyzed on the amplicons determined for identification of the BCL11B target gene in T lymphocytes. The horizontal boxes correspond to the CPG positions (CPGs 14, 15, ... 25) in the best amplicons analyzed, and the gene positions indicated are hg38 chr14: 99189324, hg38 chr14: 99189312 ... hg38 chr14: 99189192, corresponding to CPGs 14, 15, ... 25.

[0049] SEQ ID No. 16 and SEQ ID No. 17 show the DNA sequences of the target gene amplicons converted by sulfite according to the qPCR and digital PCR detection systems of the present invention. The CPG system refers to the DNA sequence of the target gene amplicon after sulfate conversion, and the methylated "CG" site still remains the differential methylation site of "CG" and the specific primers and probes for detecting the site. The TPG system refers to the DNA sequence of the target gene amplicon after sulfate conversion, and the unmethylated "CG" site is converted into a differential methylation site of "TG" and the specific primers and probes for detecting the site.

[0050] Preferably, the CPG (methylation site detection) system-specific amplicon (SEQ ID No. 16):

[0051]

[0052] Preferably, the TPG (detection of unmethylated sites) system-specific amplicon (SEQ ID No. 17):

[0053]

[0054] Table 4 Sequences of primers and probes specific for target gene BCL11B

[0055]

[0056] Table 5 qPCR amplification results of three sets of primers and probes

[0057]

[0058] Example 3 Validation of TPG and CPG specific PCR systems

[0059] The specificity of the PCR system was verified using a test template (plasmid DNA). Two templates with different concentration gradients were set up. The sequence of the C plasmid was the same as SEQ ID No. 16, and the sequence of the T plasmid was the same as SEQ ID No. 17. The TPG and CPG systems were tested by PCR amplification. The results were as follows: Figure 3 and Figure 4 shown.

[0060] Depend on Figure 3 It can be seen that when the added template is a high-concentration T plasmid or a high-concentration T plasmid diluted 100 times, the qPCR amplification curve is a typical S amplification curve, but when the template is a high or low-concentration C plasmid, the amplification curve does not appear, which is consistent with the amplification of NTC. The above results prove that the primer probe of the TPG system has good specificity.

[0061] Depend on Figure 4 It can be seen that when the added template is a high-concentration T plasmid or a high-concentration C plasmid diluted 100 times, the qPCR amplification curve is a typical S amplification curve, but when the template is a high or low-concentration T plasmid, the amplification curve does not appear, which is consistent with the amplification of NTC. The above results prove that the primer probe of the CPG system has good specificity.

[0062] In addition, methylation standards with a methylation rate of 0% and 100% were used to verify the specificity of the TPG and CPG systems. The methylation standards were from QIAGEN. Figure 5 and Figure 6 It is known that when the 0% methylation standard is used as a template, the TPG system produces a typical amplification curve, while the CPG system does not. Similarly, when the 100% methylation standard is used as a template, the CPG system produces a typical amplification curve, while the TPG system does not. The above results show that the primer probe specificity of the TPG and CPG systems is good.

[0063] Considering the differences in methylation levels in actual samples, the specificity of the PCR system was further verified using gradient methylation standards. To this end, a methylation standard with a methylation rate of 0% was mixed with a methylation standard with a methylation rate of 100% to simulate methylation values ​​in the range of 0%-100%. Then, the ratio (%) of TPG templates in these mixtures was detected using the assay of the present invention. The results are shown in FIG. Figure 7 and Figure 8 As shown in Figure 2, when the methylation ratio changes from 0% to 100%, the ratio calculated by the digital PCR test also changes in the same way, showing a good linear relationship (R 2 = 0.9979). The test results of the gradient methylation standard fully demonstrate that the TPG and CPG systems have good specificity and can distinguish different methylation levels.

[0064] Example 4 Validation of BCL11B target gene as a T cell specific marker

[0065] Purified cells were used to verify the specificity of BCL11B as a T lymphocyte marker. To this end, the DNA extracted and transformed from lymphocytes (T lymphocytes, CD4+T lymphocytes, CD8+T lymphocytes, B lymphocytes and NK cells) purified by magnetic bead sorting was used as a template, and the copy number of the target gene BCL11B and the internal reference gene RPP30 was directly obtained using a digital PCR platform. The relative content of each cell subset can be directly calculated using the formula: relative content of cell subsets (%) = number of copies of the BCL11B target gene / number of copies of the internal reference gene ⍐100. Fig. 9 It is known that the proportion of T lymphocytes, CD4+ T lymphocytes and CD8+ T lymphocytes detected by the TPG system is very high, while the proportion of B lymphocytes and NK cells is very low, and the test results are very consistent with the results of flow cytometry. This result shows that the BCL11B target gene can be used as a T lymphocyte-specific marker.

[0066] Example 5 Determination of T lymphocyte content in actual samples

[0067] The BCL11B primer probe of the present invention is used to quantify the T lymphocyte content (%) in the dried blood sample of the peripheral blood of the newborn. SCID is an immunodeficiency disease caused by a series of gene mutations (involving more than 20 genes). Children with the disease have T and B lymphocyte function defects, significantly low T lymphocyte counts, with or without low B lymphocyte counts, NK cell function defects or low numbers. Digital PCR detection obtains the copy number of the BCL11B gene and the internal reference gene. The relative content of T lymphocytes in leukocytes can be calculated using the formula: T lymphocyte proportion (%) = BCL11B target gene copy number / reference gene copy number ╳ 100. As shown in Table 6, the target gene copy number of the SCID sample is 0-36 copies / µL, accounting for 0-2.8% in leukocytes, while the target gene copy number of the normal newborn sample is 179-1087 copies / µL, accounting for 16.6-34.1% in leukocytes. The above results indicate that the method provided by the present invention can significantly distinguish SCID patients from normal newborns and can serve for newborn SCID screening.

[0068] Table 6 Quantification of BCL11B gene and proportion of T lymphocytes in peripheral blood dried blood samples

[0069]

[0070] It should be understood that the disclosed invention is not limited only to the specific method, scheme and material of description, because these all can change.It should also be understood that the terminology used herein is only for the purpose of describing specific embodiment scheme, rather than being intended to limit the scope of the present invention, and the scope of the present invention is only limited to the appended claims.

[0071] Those skilled in the art will also recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are also intended to be encompassed by the appended claims.

Claims

1. Application of a reagent for detecting the non-methylation of all CpG sites in the differentially methylated region hg38 chr14: 99189331-99189185 on the BCL11B gene in a sample in the preparation of a kit for counting human T lymphocytes.

2. The use according to claim 1, characterized in that: The kit calculates the ratio of human T cells to human leukocytes by detecting the copy numbers of the internal reference gene and the BCL11B gene.

3. The use according to claim 2, characterized in that: The internal reference gene is the RPP30 gene.

4. The use according to claim 2, characterized in that: The kit is a sequencing kit, a quantitative PCR kit or a digital PCR kit.

5. The use according to claim 4, characterized in that: The kit comprises: primers and probes for detecting the methylation status of CpG sites in the region of hg38 chr14:99189331-99189185 and primers and probes for detecting the copy number of an internal reference gene.

6. The use according to claim 5, characterized in that: The kit includes: an upstream primer SEQ ID No. 4: GGTAGTTTGGTTGTGTATTTGGGTATTT, a downstream primer SEQ ID No. 5: AACCTACAACACTTCTACAACACTTTAC, and a probe SEQ ID No. 6: CTACCAAAACATAATCAT.

7. The use according to claim 1, characterized in that: The sample is selected from the group consisting of peripheral blood samples, capillary blood samples or venous blood samples or sub-fractions thereof, peripheral blood mononuclear cells, blood clots and dried blood spots.

Images