Primer, kit and method for detecting pathogenic Pseudomonas proteinans based on Pseudomonas proteinans strain oprL gene and application of primer, kit and method for detecting pathogenic Pseudomonas proteinans based on Pseudomonas proteinans strain oprL gene

Abstract

The invention discloses a primer, a kit and a method for detecting pathogenic pseudomonas proteinans based on a pseudomonas proteinans strain oprL gene and application, and belongs to the technical field of microbiological detection. The invention provides a specific primer for detecting pathogenic pseudomonas deformation based on pseudomonas deformation strain oprL genes, and the specific primer is designed according to a difference rule found after multi-sequence comparison, namely, a PCR amplification primer of the oprL genes is designed according to a result obtained after multi-sequence comparison and arrangement of all the pseudomonas deformation strain oprL genes in an NCBI database, and the specific primer is used for detecting the pathogenic pseudomonas deformation based on the oprL genes of the pseudomonas deformation strain oprL genes. The nucleotide sequences of the primers are as shown in SEQ ID No.1, SEQ ID No.2 and SEQ ID No.3. The oprL gene of pseudomonas proteinatica is amplified through PCR (polymerase chain reaction), then the PCR amplification product is subjected to electrophoresis, whether pseudomonas proteinatica has pathogenicity or not can be effectively distinguished according to the imaging condition of an electrophoretogram, rapid detection of pseudomonas proteinatica infected with pseudosciaena crocea can be realized, the specificity of the primers is good, and the detection method is simple, convenient and visual.

Description

Technical Field

[0001] The invention belongs to the technical field of microbial detection, and specifically relates to a primer, a kit, a method and an application for detecting pathogenic Pseudomonas proteus based on the oprL gene of Pseudomonas proteus strain. Background Art

[0002] Pseudomonas plecoglossicida belongs to the Pseudomonadaceae family and the genus Pseudomonas. It is an aerobic rod-shaped Gram-negative bacterium with no spores, flagella and motility. It was first discovered in sweetfish (Plecoglossusaltivelis) in 2000, hence its scientific name (Pseudomonas plecoglossicida). It is also translated into Chinese as sweetfish Pseudomonas or sweetfish-killing Pseudomonas. Since its discovery and naming, Pseudomonas plecoglossicida has been detected in fish, water, soil, air dust, human epidermis and saliva, and its distribution is very wide. In the course of research on Pseudomonas proteus, people have successively discovered that different isolates of Pseudomonas proteus have the ability to cause pathogenicity, decompose organic matter, and produce enzymes. At present, the functions of some isolates are still unknown, and not all Pseudomonas proteus are pathogenic. Therefore, it is of great significance to distinguish whether Pseudomonas proteus is pathogenic, judge its pathogenicity, and further study Pseudomonas proteus.

[0003] Studies have shown that pathogenic Pseudomonas aeruginosa can infect fish such as sweetfish, large yellow croaker (Larimichthyscrocea), grouper (Epinephlus coioides), and rainbow trout (Oncorhynchus mykiss), which poses a great threat to the aquatic industry. Currently, there is no vaccine available for this disease, and antibiotics are still the first choice for preventing and treating the disease in aquaculture production. However, the long-term and large-scale use of antibiotics will lead to a series of risks such as the continuous increase of drug-resistant strains, the destruction of the aquaculture ecosystem, and the threat to the quality and safety of finished products. Therefore, it is particularly important to judge the pathogenicity of strains in the water before aquaculture and do a good job of prevention in advance to improve the economic benefits of fish farming. Summary of the invention

[0004] In view of the above problems, the present invention provides a primer, a kit, a method and an application for detecting pathogenic Pseudomonas proteus based on the oprL gene of Pseudomonas proteus strain, which can realize rapid detection of pathogenic Pseudomonas proteus. The method is simple, intuitive and has good applicability.

[0005] The present invention is achieved through the following technical solutions:

[0006] A primer for detecting pathogenic Pseudomonas proteus based on the oprL gene of Pseudomonas proteus strain, the primer comprising:

[0007] oprL-F1: GCTGAAGTTTGGTAAATTTGCTGCG;

[0008] oprL-F2:CTGGTGAAGGCGCTGTCGAT;

[0009] oprL-R:CTTACGCAGTTCTACGCGACGG.

[0010] A kit for detecting pathogenic Pseudomonas proteus based on the oprL gene of Pseudomonas proteus strain, the kit comprising the primers as described above.

[0011] A method for detecting pathogenic Pseudomonas proteus based on the oprL gene of Pseudomonas proteus strain, wherein the method uses the primers as described above to amplify the oprL gene of Pseudomonas proteus, and specifically comprises the following steps:

[0012] (1) streaking the Pseudomonas aeruginosa strain to be tested on a TSA plate to obtain a single colony of the strain to be tested, and mixing the single colony with water to obtain a mixture;

[0013] (2) using the mixture as a template and using the primers described above to perform a PCR amplification reaction to obtain a PCR amplification product;

[0014] (3) After the amplification is completed, the PCR amplification product is subjected to agarose gel electrophoresis, and the electrophoresis gel image is observed to determine the pathogenicity of the Pseudomonas aeruginosa strain to be tested.

[0015] Furthermore, if there are two target bands of 487 bp and 407 bp in the electrophoresis gel image, the strain to be tested is pathogenic Pseudomonas proteus; if there is only one band of 490 bp, the strain to be tested is non-pathogenic Pseudomonas proteus.

[0016] Furthermore, in step (3), the electrophoresis conditions are: detection on 2.0% agarose gel, 20 μL of PCR amplification product, voltage 100 V, and electrophoresis for 60 min.

[0017] Furthermore, in step (2), the PCR amplification reaction system is 50 μL, including: 2×Taq Master Mix 25 μL, primer oprL-F1 0.5 μL, primer oprL-F2 1 μL, primer oprL-R 1 μL, mixture template 0.5 μL, ddH2O 22 μL.

[0018] Furthermore, in step (2), the PCR amplification reaction procedure is: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 63°C for 30 s, extension at 72°C for 40 s, and insulation at 16°C for 10 min.

[0019] A use of the method as described above in detecting Pseudomonas aeruginosa infection in fish.

[0020] Compared with the prior art, the advantages and beneficial effects of the present invention are:

[0021] 1. The present invention provides specific primers for detecting pathogenic Pseudomonas proteus based on oprL gene of Pseudomonas proteus strains. The primers are designed according to the difference rules found after multiple sequence alignment, that is, the results of multiple sequence alignment of all Pseudomonas proteus oprL genes in the NCBI database are collated to design PCR amplification primers of the oprL gene. The nucleotide sequences of the primers are shown in SEQ ID No.1, SEQ ID No.2 and SEQ ID No.3. The oprL gene of Pseudomonas proteus is amplified by PCR, and the PCR amplification product is electrophoresed. Whether the Pseudomonas proteus is pathogenic can be effectively distinguished according to the imaging of the electrophoresis diagram, and rapid detection of Pseudomonas proteus infecting fish can be achieved. The primers have good specificity, the method is simple and intuitive, and the applicability is good.

[0022] 2. The present invention designs specific primers for detecting pathogenic Pseudomonas proteus according to the typing difference rules, which has strong specificity. After experimental verification, it can effectively distinguish pathogenic Pseudomonas proteus, providing a basis for judging the pathogenicity of Pseudomonas proteus in the future. The method can be used in the fields of pathogen detection in aquaculture water, bacteriological classification and epidemiological investigation, and has far-reaching social benefits and greater economic benefits. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is an imaging diagram of the electrophoresis results of the PCR amplification products in the present invention.

[0024] Figure 2 It is a curve diagram of the survival rate of Pseudomonas aeruginosa challenge in the present invention.

[0025] Figure 3 This is a dissection diagram of a fish body after being challenged with Pseudomonas proteus NyZ12 in the present invention.

[0026] Figure 4 This is a dissection diagram of a fish body after infection with Pseudomonas aeruginosa sea in the present invention.

[0027] Figure 5 This is a dissection diagram of a fish body after being challenged with Pseudomonas proteus PQLYC4 in the present invention.

[0028] Figure 6This is a dissection diagram of a fish body after being challenged with Pseudomonas aeruginosa 2022L in the present invention.

[0029] Figure 7 This is a dissection diagram of a fish body after being challenged with Pseudomonas aeruginosa DSM15088 in the present invention. DETAILED DESCRIPTION

[0030] The present invention is further described in detail below by way of examples. These examples are only used to illustrate the present invention and do not limit the protection scope of the present invention.

[0031] The experimental strains, main instruments and reagents used in the following examples are:

[0032] Experimental strains: P.plecoglossicida 2013, P.plecoglossicida 2014, P.plecoglossicida2015, P.plecoglossicida 2016, P.plecoglossicida 2017, P.plecoglossicida 2018, P.plecoglossicida PQLYC4, P.plecoglossicida 2019R, P.plecoglossicida 2022L (the above strains were isolated from the lesion tissues of diseased fish with visceral white spot disease in the laboratory), P.plecoglossicida NB2011 (Mao Zhijuan, Zhejiang Wanli College), P.plecoglossicida DSM15088 (China Center for Type Culture Collection), P.plecoglossicida NZBD9 (Yan Qingpi, Jimei University) The above strains are pathogenic strains, P.plecoglossicida NyZ12 (Yan Dazhong from Wuhan University of Technology) and P.plecoglossicida sea (isolated from sampled seawater in the laboratory) are non-pathogenic strains.

[0033] Main instruments: Applied Biosystems SimpliAmp PCR thermal cycler, electrophoresis instrument, fully automatic digital gel imager. Main reagents: high-purity low-electrosmotic agarose, nucleic acid gel dye, 1×TAE buffer.

[0034] Example 1 Method for detecting pathogenic Pseudomonas proteus based on oprL gene of Pseudomonas proteus strain

[0035] According to the published genome sequence of Pseudomonas proteans, oprL gene was selected as the detection target gene, and primer pairs were designed according to the difference rules found by the multiple sequence alignment method, that is, primers were designed according to the oprL gene in all the complete genomes of Pseudomonas proteans included in the NCBI database. The nucleotide sequences of the primers are:

[0036] oprL-F1: GCTGAAGTTTGGTAAATTTGCTGCG (SEQ ID No. 1);

[0037] oprL-F2: CTGGTGAAGGCGCTGTCGAT (SEQ ID No. 2);

[0038] oprL-R: CTTACGCAGTTCTACGCGACGG (SEQ ID No. 3).

[0039] The method for detecting oprL genotyping of Pseudomonas aeruginosa strains specifically comprises the following steps:

[0040] (1) Streaking the Pseudomonas aeruginosa strain on a TSA plate to obtain a single colony of the strain to be tested. The specific process is: using an inoculation loop to take the Pseudomonas aeruginosa strain to be tested and streak it on a TSA plate medium, and then culturing it at a constant temperature of 25° C. for 24 hours to obtain a single colony of the bacteria.

[0041] (2) In an ultra-clean workbench, a single colony of the strain to be tested was picked up with a pipette tip and thoroughly blown and mixed into 20 μL of deionized water. The mixture was used as a template and a PCR amplification reaction was performed using primers oprL-F1, oprL-F2 and oprL-R to amplify the oprL gene of the strain to be tested and obtain a PCR amplification product; wherein the PCR amplification reaction system and procedure are as follows:

[0042] The PCR amplification reaction system was 50 μL, including: 2×Taq Master Mix 25 μL, primer oprL-F1 0.5 μL, primer oprL-F2 1 μL, primer oprL-R 1 μL, mixed template 0.5 μL, ddH2O 22 μL. The PCR amplification reaction program was: 95°C pre-denaturation for 5 min, 95°C denaturation for 30 s, 63°C annealing for 30 s, 72°C extension for 40 s, and 16°C incubation for 10 min.

[0043] (3) Agarose gel electrophoresis: After amplification, the PCR amplification product is subjected to agarose gel electrophoresis, and the electrophoresis gel image is observed to determine the pathogenicity of the Pseudomonas aeruginosa strain to be tested. The specific steps of agarose gel electrophoresis are as follows:

[0044] ① Preparation of gel (2%): Add 60 mL 1×TAE buffer and 1.2 g agarose into a flask, heat the flask in a microwave oven until boiling, and shake until there are no particles.

[0045] ② Pour the gel: first place the gel board, insert the comb, and then pour the gel. When the gel cools to about 60°C, add dye (60mL gel + 6μLGelRed) and slowly pour it into the electrophoresis tank. After the gel solidifies, take out the comb.

[0046] ③ Add sample: 20 μL PCR amplification product (the sample wells are placed at the negative end, i.e. black against black, red against red).

[0047] ④ Electrophoresis: Electrophoresis was performed at 100 V under a constant voltage condition, and the electrophoresis was stopped when bromophenol blue moved to nearly 2 / 3 of the gel (approximately 60 min).

[0048] ⑤Observation results: Observe the electrophoresis gel image on the UV analyzer, such as Figure 1 shown.

[0049] from Figure 1 It can be seen that Pseudomonas aeruginosa strains PQLYC4 (P. plecoglossicida PQLYC4), NZBD9 (P. plecoglossicida NZBD9), NB2011 (P. plecoglossicida NB2011), DSM15088

[0050] (P.plecoglossicida DSM15088), PP2013 (P.plecoglossicida 2013), PP2014

[0051] (P.plecoglossicida 2014), PP2015 (P.plecoglossicida 2015), PP2016 (P.plecoglossicida 2016), PP2017 (P.plecoglossicida 2017), PP2018 (P.plecoglossicida 2018), PP2019R (P.plecoglossicida 2019R) and PP2022L (P.plecoglossicida 2022L) all showed two target bands of 487 bp and 407 bp, while NyZ12 (P.plecoglossicida NyZ12) and sea (P.plecoglossicida sea) only showed one target band of 490 bp. The electrophoresis gel image shows that if the Pseudomonas aeruginosa strain to be tested has two target bands of 487 bp and 407 bp, it is pathogenic Pseudomonas aeruginosa; if there is only one band of 490 bp, it is non-pathogenic Pseudomonas aeruginosa. This can achieve rapid detection of pathogenicity of Pseudomonas aeruginosa infected fish.

[0052] Confirmatory experiments:

[0053] (1) The non-pathogenicity of Pseudomonas plecoglossicida NyZ12 (P. plecoglossicida NyZ12) and sea (P. plecoglossicida sea) was further verified by challenge experiments. The challenge experiment lasted for 15 days, and the sample size was 15 large yellow croakers. A control group PBS (PBS is a phosphate buffered saline solution, generally used as a solvent, which plays a role in dissolution and protection) was set up in the experiment. The blank control group was set up to eliminate errors such as the health of the fish itself, the health of the water body, and the intraperitoneal injection technique. Three NyZ12 experimental groups with different concentrations were set up: NyZ12 1×10 6 CFU / mL, NyZ12 1×10 7 CFU / mL, NyZ12 1×10 8 CFU / mL and a 1×10 6 CFU / mL concentration of sea experimental group.

[0054] Large yellow croaker was intraperitoneally injected with 200 μL of the above PBS and 1×10 6 CFU / mL concentration of Pseudomonas sea and three different concentrations of Pseudomonas NyZ12 were used to record the mortality of large yellow croaker within 15 days and draw the infection survival rate curve. The curve is shown in the figure. Figure 2 The large yellow croaker fish that were challenged with Pseudomonas proteus NyZ12 and sea were dissected to check the infection status of their internal organs, as shown in the figure. Figure 3 and 4 shown.

[0055] from Figure 2 It can be seen that after 15 days of experiment, the large yellow croaker injected with medium and high concentrations of Pseudomonas aeruginosa NyZ12 and Pseudomonas aeruginosa sea was still alive and well, with a survival rate of 100%. Figure 3 and Figure 4 From the anatomical diagram, we can see that the spleen of yellow croaker is normal and has no lesions, indicating that Pseudomonas aeruginosa NyZ12 and Pseudomonas aeruginosa sea will not cause visceral white spot disease in yellow croaker.

[0056] (2) The pathogenicity of Pseudomonas plecoglossicida PQLYC4 (P. plecoglossicida PQYC4), Pseudomonas plecoglossicida DSM15088 (P. plecoglossicida DSM15088), and Pseudomonas plecoglossicida 2022L (P. plecoglossicida 2022L) was further verified by challenge experiments. The challenge experiment lasted for 15 days, and the sample size was 15 large yellow croakers. The control group was PBS (PBS is a phosphate buffered saline solution, generally used as a solvent to dissolve and protect). The blank control group was set up to eliminate errors such as the health of the fish itself, the health of the water body, and the intraperitoneal injection technique. The experimental group: PQLYC4 2×10 3 CFU / mL, 2022L 2×10 3 CFU / mL. And three different concentrations of DSM15088 experimental groups: DSM1508 1×10 6 CFU / mL, DSM1508 1×10 7 CFU / mL, DSM1508 1×10 8 CFU / mL (PQLYC4 and 2022L were isolated from lesion tissues infected with visceral white spot disease in the laboratory, so low concentrations were used in the challenge experiment; DSM15088 was purchased from the China Center for Type Culture Collection, so medium and high concentrations were used in the challenge experiment).

[0057] Large yellow croaker was intraperitoneally injected with more than 200 μL of PBS, 2×10 3 CFU / mL concentration of Pseudomonas aeruginosa PQLYC4, 2×10 3 CFU / mL concentration of Pseudomonas aeruginosa 2022L, and 1×10 6 CFU / mL, 1×10 7 CFU / mL, 1×10 8The mortality of large yellow croaker within 15 days was recorded, and the survival rate curve of Pseudomonas proteus PQLYC4, 2022L and DSM15088 was drawn. The curve is as follows Figure 2 The bodies of yellow croakers challenged with three types of Pseudomonas proteans were dissected to check the infection status of their internal organs. Figure 5 , 6 and 7.

[0058] from Figure 2 It can be seen that after 15 days of experiments, even at low concentrations, Pseudomonas protei PQLYC4 and 2022L can kill all large yellow croakers, with a mortality rate of 100%, and at medium and high concentrations, Pseudomonas protei DSM15088 is highly pathogenic, with deaths starting on the third day and all dead on the fifth day, with a mortality rate of 100%, indicating that Pseudomonas protei PQLYC4, 2022L and DSM15088 can cause white spot disease in large yellow croaker viscera. Figure 5 , 6 From the anatomical diagrams in Figure 7, we can see that the spleen of the large yellow croaker is diseased and has grown many white nodules, namely, white spots on the internal organs.

[0059] The above test results confirmed Figure 1 The conclusion of judging whether Pseudomonas aeruginosa is pathogenic based on the electrophoresis gel imaging situation illustrates the accuracy of the method of the present invention.

[0060] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A primer for detecting pathogenic Pseudomonas proteus based on the oprL gene of Pseudomonas proteus strain, characterized in that: The primers include: oprL-F1: GCTGAAGTTTGGTAAATTTGCTGCG; oprL-F2:CTGGTGAAGGCGCTGTCGAT; oprL-R:CTTACGCAGTTCTACGCGACGG.

2. A kit for detecting pathogenic Pseudomonas proteus based on the oprL gene of Pseudomonas proteus strain, characterized in that: The kit comprises the primers according to claim 1.

3. A method for detecting pathogenic Pseudomonas proteus based on the oprL gene of Pseudomonas proteus strain, characterized in that: The method uses the primers as claimed in claim 1 to amplify the oprL gene of Pseudomonas proteus, and specifically comprises the following steps: (1) streaking the Pseudomonas aeruginosa strain to be tested on a TSA plate to obtain a single colony of the strain to be tested, and mixing the single colony with water to obtain a mixture; (2) using the mixture as a template and using the primers described in claim 1 to perform a PCR amplification reaction to obtain a PCR amplification product; (3) After the PCR amplification is completed, the PCR amplification product is subjected to agarose gel electrophoresis, and the electrophoresis gel image is observed to determine the pathogenicity of the Pseudomonas aeruginosa strain to be tested.

4. The method for detecting pathogenic Pseudomonas proteus based on the oprL gene of Pseudomonas proteus strain according to claim 3, characterized in that: In step (3), if there are two target bands of 487 bp and 407 bp in the electrophoresis gel image, the strain to be tested is pathogenic Pseudomonas proteus; if there is only one band of 490 bp, the strain to be tested is non-pathogenic Pseudomonas proteus.

5. The method for detecting pathogenic Pseudomonas proteus based on the oprL gene of Pseudomonas proteus strain according to claim 3, characterized in that: In step (3), the electrophoresis conditions are: detection on 2.0% agarose gel, 20 μL of PCR amplification product, voltage 100 V, and electrophoresis for 60 min.

6. The method for detecting pathogenic Pseudomonas proteus based on the oprL gene of Pseudomonas proteus strain according to claim 3, characterized in that: In step (2), the PCR amplification reaction system is 50 μL, including: 2×Taq Master Mix 25 μL, primer oprL-F1 0.5 μL, primer oprL-F2 1 μL, primer oprL-R 1 μL, mixture template 0.5 μL, ddH2O 22 μL.

7. The method for detecting pathogenic Pseudomonas proteus based on the oprL gene of Pseudomonas proteus strain according to claim 3, characterized in that: In step (2), the PCR amplification reaction procedure is: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 63°C for 30 s, extension at 72°C for 40 s, and insulation at 16°C for 10 min.

8. Use of the method according to any one of claims 3 to 7 in detecting Pseudomonas aeruginosa infection in fish.

Images