A molecular marker tightly linked to a rice false smut resistance locus and its application

Abstract

The present invention belongs to the field of rice resistance breeding and molecular biology, and is specifically a molecular marker closely linked to a rice false smut resistance site and its application. The molecular marker uses the disease-resistant variety IR77298-14-1-2::IRGC117374-1 as the male parent, and creates hybrid combination F2, F3 and F4 populations with the susceptible variety 9311 of the female parent; then the artificial injection inoculation method is used to inoculate the rice heading to identify the phenotypic resistance to false smut; then through polymorphic SSR molecular marker screening, genetic map construction and QTL detection; obtain the rice false smut resistance gene site qRFS3.01, which is located between the molecular markers RM15066 and RM6959 of chromosome 3. These molecular markers are used to detect the disease resistance of seedling plants to false smut, thereby eliminating susceptible plants, saving time and cost, improving efficiency, and providing possibility for molecular marker-assisted breeding of rice false smut resistance.

Description

Technical Field

[0001] The present invention belongs to the field of rice resistance breeding and molecular biology, and particularly relates to molecular markers RM15066 and RM6959 that are tightly linked to rice false smut resistance loci, and also relates to the application of molecular markers in rice assisted breeding, specifically a molecular marker that is tightly linked to a rice false smut resistance locus and the application thereof. Background Art

[0002] Rice is one of the most important food crops in the world. Ustilaginoidea virens Rice false smut, which infects the rice panicle, is an important fungal disease of rice and causes serious harm to rice production. Rice false smut not only affects the yield and quality of rice, but also the diseased grains can produce fungal toxins that are toxic to humans and livestock. In recent years, with the promotion of high-quality and high-yield hybrid rice planting areas, excessive use of nitrogen fertilizers and climate change, the occurrence of rice false smut has become more serious year by year, and in severe cases, it can lead to a reduction of more than 50% in rice production. At present, the main prevention and control measure for rice false smut is chemical prevention and control, spraying fungicides during the rice heading stage. Rice false smut only begins to show symptoms during the filling stage, and prevention and control at this time is ineffective. Secondly, the large-scale use of chemical fungicides will promote the production of drug-resistant strains and pollute the environment. Production practice has proved that breeding and planting disease-resistant varieties are the most effective and environmentally friendly measures to prevent and control rice false smut. Therefore, identifying resistance genes and screening molecular markers that are closely related to rice false smut resistance sites are crucial to breaking through rice false smut resistance.

[0003] At present, there have been reports on quantitative resistance loci QTL and molecular markers for rice resistance to false smut in China and abroad, such as Li Yusheng et al., 2011; Andargie et al., 2018. However, the number is small, and there has been no report on the application of linkage molecular markers and resistance genes for rice false smut resistance in rice disease resistance breeding. Rice resistance breeding for false smut is a phenotypic selection of plants through field resistance identification, which is time-consuming, labor-intensive, inefficient, and easily restricted by environmental conditions, often resulting in inaccurate resistance identification. Therefore, exploring new rice false smut resistance loci QTL and developing molecular markers closely linked to them are the key to breakthroughs in rice false smut molecular disease resistance breeding. Summary of the invention

[0004] In order to solve the problems in the prior art, the purpose of the present invention is to provide SSR molecular markers RM15066 and RM6959 that are closely linked to the rice false smut resistance QTL on No. 3 staining to address the shortcomings of rice false smut resistance identification in conventional breeding, such as instability, poor repeatability, low efficiency, and time-consuming and labor-intensive. These molecular markers are used to detect the resistance of seedling plants to false smut, thereby eliminating susceptible plants, saving time and cost, and improving efficiency. It also provides the possibility for rice false smut resistance molecular marker-assisted breeding.

[0005] In order to achieve the above object, the present invention adopts the following technical solution:

[0006] A molecular marker tightly linked to a rice false smut resistance locus, wherein the molecular marker uses the disease-resistant variety IR77298-14-1-2::IRGC117374-1 as the male parent and the disease-susceptible variety 9311 as the female parent to create hybrid combination F2, F3 and F4 populations; then, using F2 and F4 as mapping populations, the rice heading is inoculated by artificial injection to identify the false smut resistance phenotype; then, through polymorphic SSR molecular marker screening, genetic map construction and QTL detection, the rice false smut resistance gene locus qRFS3.01 of the rice false smut resistant variety IR77298-14-1-2::IRGC 117374-1 is obtained, which is located between molecular markers RM15066 and RM6959 on chromosome 3.

[0007] Furthermore, in the molecular marker tightly linked to the rice false smut resistance locus, the specific steps of identifying the rice false smut resistance phenotype are:

[0008] At the 7th and 8th rice heading stage, the two parents, 201 individual plants in the F2 population and 136 individual plants in the F4 population were inoculated by artificial injection to identify the rice false smut resistance phenotype.

[0009] Furthermore, in the molecular marker closely linked to the rice false smut resistance locus, the specific steps of screening the polymorphic SSR molecular marker are:

[0010] a. Use CTAB method to extract genomic DNA of rice parents;

[0011] b. 1271 pairs of rice SSR primers were selected that were evenly distributed on 12 chromosomes, and PCR amplification was performed on the resistant and susceptible parents to screen out 119 pairs of SSR markers that showed polymorphism between the parents.

[0012] Furthermore, in the molecular marker closely linked to the rice false smut resistance locus, the specific steps of constructing the genetic map are:

[0013] a. Use the CTAB method to extract the genomic DNA of each individual plant in the F2 and F4 populations;

[0014] b. Using the 119 pairs of SSR markers screened, PCR amplification was performed on the F2 and F4 populations, and the amplified products were analyzed by polyacrylamide gel electrophoresis to obtain the molecular marker banding pattern;

[0015] c. According to the molecular marker banding pattern in b, in the F2 population, the F2 individual plant with the same banding pattern as the disease-resistant parent IR77298-14-1-2::IRGC117374-1 was assigned B, the one with the susceptible parent 9311 was assigned A, the heterozygous banding pattern of the two parents was assigned H, and the one without the banding pattern was assigned 0; in the F4 population, the F4 individual plant with the same banding pattern as the disease-resistant parent IR77298-14-1-2::IRGC117374-1 was assigned A, the one with the susceptible parent 9311 was assigned B, and the heterozygous banding pattern of the two parents was assigned 0;

[0016] d. The genotypes of F2 and F4 analyzed in c were used to calculate the linkage genetic distance between molecular markers using the software QTL ICiMapping4.0 and draw a linkage map.

[0017] Furthermore, in the molecular marker closely linked to the rice false smut resistance locus, the specific steps of QTL detection are:

[0018] a. Based on the genotypes of each individual plant of F2 and F4, the resistance phenotypes of the F2 and F4 populations in the field were combined with the resistance identification, and the QTL ICiMapping4.0 software was used to detect and analyze QTLs according to the complete interval mapping method, and the LOD threshold was set to 2.5;

[0019] b. From a, four QTL loci were identified in F2, namely qRFS1.01, qRFS3.01, qRFS5.01 and qRFS12.01-1; qRFS1.01 was located between molecular markers RM5310 and RM3825 on chromosome 1, qRFS3.01 was located between molecular markers RM15066 and RM6959 on chromosome 3, qRFS5.01 was located between molecular markers RM5311 and RM5968 on chromosome 5, and qRFS1 2.0-11 is located between molecular markers RM28195 and RM5341 on chromosome 12; two QTL loci were identified in F4, namely qRFS3.01 and qRFS7.01; qRFS3.01 is between molecular markers RM15066 and RM6959 on chromosome 3; qRFS7.01 is between molecular markers RM3555 and RM3755 on chromosome 7; qRFS3.01 located on chromosome 3 was repeatedly detected in F2 and F4 populations;

[0020] c. The rice false smut resistant variety IR77298-14-1-2::IRGC 117374-1 was obtained. The rice false smut resistant gene locus qRFS3.01 is located between the molecular markers RM15066 and RM6959 on chromosome 3.

[0021] The present application also protects the use of the above-mentioned molecular marker tightly linked to the rice false smut resistance locus in predicting the plant's resistance to rice false smut.

[0022] Furthermore, in the application of the molecular marker tightly linked to the rice false smut resistance locus in predicting the plant's resistance to rice false smut, the plant's resistance to rice false smut can be predicted by detecting the two molecular marker band types on chromosome 3.

[0023] Compared with the prior art, the present invention has the following beneficial effects:

[0024] 1) The discovery and localization of qRFS3.01 provides a new resistance locus for rice resistance to rice false smut, which can be used for rice molecular disease resistance breeding.

[0025] 2) Resistance-linked molecular markers RM15066 and RM6959 can be used for molecular detection of rice false smut resistance, which improves the accuracy and repeatability of rice false smut resistance identification in conventional breeding, saves time and cost, and improves efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is an analysis of the resistance performance of individual plants in the F2 and F4 populations to rice false smut at the heading stage; A is the F2 population; B is the F4 population;

[0027] Figure 2 It is the genetic linkage map of the molecular markers on chromosome 1 in the F2 population;

[0028] Figure 3 It is the genetic linkage map of the molecular markers on chromosome 3 in the F2 population;

[0029] Figure 4 Genetic linkage map of chromosome 5 molecular markers in F2 population

[0030] Figure 5 Genetic linkage map of chromosome 12 molecular markers in F2 population

[0031] Figure 6 This is the genetic linkage map of the molecular markers on chromosome 3 in the F4 population;

[0032] Figure 7 This is the genetic linkage map of chromosome 7 molecular markers in the F4 population. DETAILED DESCRIPTION

[0033] A molecular marker tightly linked to a rice false smut resistance locus is obtained by the following steps:

[0034] 1) Group building

[0035] The disease-resistant variety IR77298-14-1-2::IRGC117374-1 (male parent) and the susceptible variety 9311 (female parent) were used to create hybrid combination F2, F3 and F4 populations, and F2 and F4 were used as mapping populations.

[0036] 2) Resistance identification

[0037] At the 7th to 8th stage of rice heading, the two parents in step 1), 201 individual plants in the F2 population, and 136 individual plants in the F4 population were inoculated by artificial injection to identify the phenotypic resistance to rice false smut.

[0038] 3) Polymorphic SSR molecular marker screening

[0039] a. Extract the genomic DNA of the rice parent in step 2) using the CTAB method;

[0040] b. 1271 pairs of rice SSR primers were selected that were evenly distributed on 12 chromosomes, and PCR amplification was performed on the resistant and susceptible parents to screen out 119 pairs of SSR markers that showed polymorphism between the parents.

[0041] 4) Construction of genetic map

[0042] a. Use the CTAB method to extract the genomic DNA of each individual plant in the F2 and F4 populations in step 2).

[0043] b. Using the 119 pairs of SSR markers screened in step 3) b, perform PCR amplification on the F2 and F4 populations, and analyze the amplified products by polyacrylamide gel electrophoresis to obtain the molecular marker banding pattern.

[0044] c. According to the banding pattern in step 4) b, in the F2 population, the banding pattern of the F2 plants that is consistent with the disease-resistant parent IR77298-14-1-2::IRGC117374-1 is assigned a value of B, the banding pattern that is consistent with the susceptible parent 9311 is assigned a value of A, the banding pattern of the two parents is assigned a value of H, and the banding pattern without the parents is assigned a value of 0; in the F4 population, the banding pattern of the F4 plants that is consistent with the disease-resistant parent IR77298-14-1-2::IRGC117374-1 is assigned a value of A, the banding pattern that is consistent with the susceptible parent 9311 is assigned a value of B, and the banding pattern of the two parents is assigned a value of 0.

[0045] d. Use the software QTL ICiMapping4.0 to calculate the linkage genetic distance between molecular markers and draw a linkage map for the genotypes of F2 and F4 analyzed in step 4) c.

[0046] 5) QTL detection

[0047] a. According to the genotype of each individual plant of F2 and F4, combined with the resistance phenotypes of F2 and F4 populations in the field in step 2), the software QTL ICiMapping4.0 was used to detect and analyze QTL according to the complete interval mapping method, and the LOD threshold was set to 2.5.

[0048] b. From step 5) a, four QTL loci (qRFS1.01, qRFS3.01, qRFS5.01 and qRFS12.01-1) were identified in F2, of which qRFS1.01 was located between molecular markers RM5310 and RM3825 on chromosome 1, qRFS3.01 was located between molecular markers RM15066 and RM6959 on chromosome 3, qRFS5.01 was located between molecular markers RM5311 and RM5968 on chromosome 5, and qRFS1.01 was located between molecular markers RM5310 and RM3825 on chromosome 1. S12.01-1 is located between molecular markers RM28195 and RM5341 on chromosome 12. Two QTL loci (qRFS3.01 and qRFS7.01) were identified in F4, of which qRFS3.01 is between molecular markers RM15066 and RM6959 on chromosome 3; qRFS7.01 is between molecular markers RM3555 and RM3755 on chromosome 7. Among them, qRFS3.01 located on chromosome 3 was repeatedly detected in F2 and F4 populations.

[0049] c. The rice false smut resistant variety IR77298-14-1-2::IRGC 117374-1 was obtained. The rice false smut resistant gene locus qRFS3.01 is located between the molecular markers RM15066 and RM6959 on chromosome 3. By detecting the banding patterns of these two molecular markers on chromosome 3, the resistance of the plant to rice false smut can be predicted.

[0050] The present invention is further described in conjunction with the embodiments, which are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, other embodiments obtained by ordinary technicians in the field without creative work are all within the protection scope of the present invention.

[0051] In the following embodiments, if there are any parameters or steps not fully described, they can be implemented using existing technologies and will not have a substantial impact on the effects of the present application.

[0052] In this application, unless otherwise specified, % refers to the mass percentage.

[0053] Primer sequences involved in this application:

[0054]

[0055] Embodiment 1:

[0056] A molecular marker closely linked to a rice false smut resistance locus is obtained by the following steps:

[0057] (1) Construction of genetic analysis population

[0058] The disease-resistant variety IR77298-14-1-2::IRGC 117374-1 was used as the male parent and the susceptible variety 9311 was used as the female parent to create F2, F3 and F4 segregation populations, respectively. F2 and F4 were used as mapping populations, and leaves of F2 and F4 plants were taken and stored in a -80℃ refrigerator for DNA extraction and SSR analysis.

[0059] (2) Inoculum culture

[0060] Two highly pathogenic strains of U.S. smut pathogen were inoculated on potato sucrose solid culture medium respectively, cultured at 28°C for 10 days, the edge mycelium blocks of the pathogen were cut and inoculated into potato sucrose liquid culture medium, cultured in a constant temperature shaker at 28°C for 10 days, and the mycelium and conidia were collected. During inoculation, the mycelium and conidia of the two strains were mixed and resuspended in potato sucrose liquid culture to make a mycelium-conidia suspension of the mixed bacteria as the inoculum.

[0061] (3) Field resistance evaluation

[0062] At the 7th-8th stage of rice heading in the parents, F2 and F4 populations, the panicles were inoculated by artificial injection. After inoculation, the relative humidity of the inoculated panicles was kept above 85%, the temperature was 28-30℃, and the moisture was kept for 3 days. 21 days after inoculation, the number of diseased panicles and the number of diseased grains per panicle of the inoculated panicles were investigated and the disease situation was counted. The resistance and susceptibility were evaluated according to the National Agricultural Industry Standard of the People's Republic of China "Technical Procedures for Identification of Rice False Smut Resistance" (NY / T 3625-2020). Field resistance phenotype analysis was carried out on resistant and susceptible parents, F2 and F4 populations. The resistant parent IR77298-14-1-2::IRGC117374-1 (P1) had no diseased grains, while the disease index DI of the susceptible parent 9311 (P2) was above 50; the DI of 201 individual plants was distributed between 0 and 100, and the phenotype was continuously distributed ( Figure 1 A); The DI of 136 F4 plants also showed a continuous distribution, ranging from 0 to 90 ( Figure 1 B), indicating that rice resistance to rice false smut has genetic characteristics of quantitative traits.

[0063] (4) Polymorphic molecular marker screening

[0064] a. Sample DNA extraction: CTAB method was used to extract leaf genomic DNA from parent 9311, IR77298-14-1-2::IRGC 117374-1, F2 and F4 populations;

[0065] b. Screening of polymorphic SSR molecular markers between parents: 1271 pairs of rice SSR primers evenly distributed on 12 chromosomes were selected from the published rice bioinformatics database (http: / / www.gramene.org), and PCR amplification was performed on the resistant and sensitive parents. PCR reaction system: total volume 20μL, DNA template 1μL, 17 μL Super PCR Mix, 1μL each of forward and reverse primers. PCR reaction procedure: 95℃ pre-denaturation for 5min; 95℃ denaturation for 30s, 55℃ annealing for 30s, 72℃ extension for 30, 35 cycles; finally 72℃ extension for 3 min. The amplified products were analyzed by polyacrylamide gel electrophoresis, and 119 pairs of SSR molecular markers showing polymorphism between parents were screened.

[0066] (5) Construction of genetic map

[0067] a. Analysis of F2 and F4 populations: The 119 pairs of SSR markers screened were used for PCR amplification of 201 F2 population plants and 136 F4 population plants, and the amplified products were analyzed by polyacrylamide gel electrophoresis to obtain the molecular marker banding pattern. In the F2 population, the banding pattern of the F2 plant was assigned to B if it was consistent with the disease-resistant parent IR77298-14-1-2::IRGC117374-1, A if it was consistent with the susceptible parent 9311, H if it was heterozygous for both parents, and 0 if it was not; in the F4 population, the banding pattern of the F4 plant was assigned to A if it was consistent with the disease-resistant parent IR77298-14-1-2::IRGC117374-1, B if it was consistent with the susceptible parent 9311, and 0 if it was heterozygous for both parents.

[0068] b. Genetic map analysis: Based on the banding patterns of each marker, the software QTL ICiMapping4.0 was used to calculate the linkage genetic distances between molecular markers and draw a linkage map.

[0069] (6) Disease resistance QTL detection

[0070] Based on the field phenotypes of the F2 and F4 populations, QTL ICiMapping4.0 software was used to perform composite interval mapping to locate QTLs. The analysis results showed that four QTL loci (qRFS1.01, qRFS3.01, qRFS5.01, and qRFS12.01-1) were identified in F2, among which qRFS1.01 was located between the molecular markers RM5310 and RM3825 on chromosome 1. The LOD value was 9.39, the phenotypic contribution rate was 6.5252%, and the additive effect was 26.0268; qRFS3.01 was between the molecular markers RM15066 and RM6959 on chromosome 3, with an LOD value of 11.27, a phenotypic contribution rate of 37.73%, and an additive effect of 20.48; qRFS5.01 was between the molecular markers RM5311 and RM5968 on chromosome 5, with an LOD value of 5.72, a phenotypic contribution rate of 9.7381%, and an additive effect of 5.73; qRFS12.01-1 was between the molecular markers RM28195 and RM5341 on chromosome 12, with an LOD value of 10.72, a phenotypic contribution rate of 19.73%, and an additive effect of 19.73; ( Figure 2-Figure 5). Two QTL loci (qRFS3.01 and qRFS7.01) were identified in F4, of which qRFS3.01 was between molecular markers RM15066 and RM6959 on chromosome 3, with a LOD value of 13.44, a phenotypic contribution rate of 32.45%, and an additive effect of 16.24; qRFS7.01 was between molecular markers RM3555 and RM3755 on chromosome 7, with a LOD value of 3.75, a phenotypic contribution rate of 18.40%, and an additive effect of 0.534 ( Figure 6-Figure 7 Among them, a resistance QTL qRFS3.01 located on chromosome 3 was repeatedly detected in F2 and F4 populations.

[0071] Therefore, by detecting the banding patterns of the two molecular markers RM15066 and RM6959 on chromosome 3, the resistance of the plant to rice false smut can be identified.

[0072] Example 2: Application of linked molecular markers for rice false smut resistance loci

[0073] An F3 segregation population was constructed with the disease-resistant variety IR77298-14-1-2::IRGC 117374-1 as the male parent and the disease-susceptible variety 9311 as the female parent. The F3 population was inoculated and identified according to the method in step (3) of Example 1 to obtain a certain number of disease-resistant and disease-susceptible plants. At the same time, the obtained resistance-linked molecular markers RM15066 and RM6959 were used to perform genotyping on some disease-resistant plants and some disease-susceptible plants of F3. It was found that the banding pattern of the disease-resistant plants was consistent with that of the disease-resistant parent IR77298-14-1-2::IRGC117374-1, and the banding pattern of the disease-susceptible plants was consistent with that of the disease-susceptible parent 9311. The results of the gene banding detection were compared with the results of field resistance identification. The results showed (Table 1) that the gene detection results were basically consistent with the field detection results.

[0074] Table 1 Detection of resistance to rice false smut in 9311 / IR77298-14-1-2::IRGC 117374-1 F3 population using molecular markers linked to resistance loci

[0075]

[0076] Example 3: Application of linked molecular markers for rice false smut resistance loci

[0077] A new combination was created with the disease-resistant variety IR77298-14-1-2::IRGC 117374-1 as the male parent and the susceptible variety Guichao 2 as the female parent, and a new F2 segregating population was obtained. The new F2 population was inoculated and identified according to the method in step (3) of Example 1, and a certain number of F2 disease-resistant and disease-susceptible plants were obtained. At the same time, referring to the method for screening rice false smut resistance linked markers in Example 1, the two SSR molecular markers were used to perform polymorphism analysis on the parents respectively, and it was found that the molecular markers RM15066 and RM6959 were polymorphic between the parents. The two molecular markers were further used to detect some disease-resistant plants and some susceptible plants of F2, and it was found that the banding pattern of the disease-resistant plants was consistent with the disease-resistant parent IR77298-14-1-2::IRGC 117374-1, and the banding pattern of the susceptible plants was consistent with the susceptible parent Guichao No. 2. The gene banding detection results were compared with the field resistance identification results. The results showed (Table 2) that the gene detection results were basically consistent with the field detection results.

[0078] Table 2 Detection of resistance to rice false smut in the F2 population of Guichao 2 / IR77298-14-1-2::IRGC 117374-1 using molecular markers linked to resistance loci

[0079]

[0080] The above embodiments are only preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any modifications, improvements, and combinations made under the design and principles of the main body of the present invention, and the technical problems they solve are considered to be consistent with the present invention and are within the protection scope of the present invention.

Claims

1. An application of SSR molecular markers RM15066 and RM6959 closely linked to a rice false smut resistance locus in predicting plant resistance to rice false smut, characterized in that: The disease-resistant variety IR77298-14-1-2::IRGC117374-1 was used as the male parent and the susceptible variety 9311 was used as the female parent to create the hybrid combination F2, F3 and F4 populations; then the F2 and F4 were used as mapping populations and inoculated by artificial injection in the rice heading to identify the phenotypic resistance to rice false smut; then the rice false smut resistant variety IR77298-14-1-2::IRGC117374-1 was obtained through polymorphic SSR molecular marker screening, genetic map construction and QTL detection. The rice false smut resistance gene locus qRFS3.01 of 117374-1 is located between the molecular markers RM15066 and RM6959 on chromosome 3, wherein the forward primer sequence of the molecular marker RM15066 is GCCGCAGTTGAGAGAACTCTTCC, and the reverse primer sequence is GAGACGCGGATGACGAGACG; the forward primer sequence of the molecular marker RM6959 is GATTCCTATGGAGGATTGTTGC, and the reverse primer sequence is AACTCCACCGGTGTTAAGAAGG; by detecting the banding patterns of these two molecular markers on chromosome 3, the resistance of the plant to rice false smut was predicted; The plants are an F3 segregating population constructed with the disease-resistant variety IR77298-14-1-2::IRGC117374-1 as the male parent and the susceptible variety 9311 as the female parent; Or an F2 segregation population constructed with the disease-resistant variety IR77298-14-1-2::IRGC117374-1 as the male parent and the susceptible variety Guichao 2 as the female parent.

Images