Nano shield capable of preventing respiratory virus infection, preparation method and application

Abstract

The invention provides a nanometer shield capable of preventing respiratory virus infection and a preparation method and application thereof.The nanometer shield is formed by self-assembly of DSPE-PEG amphiphilic polymers, antiviral drug arbidol is wrapped in the nanometer shield, and the nanometer shield capable of generating high viscosity in the respiratory tract system and preventing respiratory virus infection is screened out by optimizing the chain length of PEG in the amphiphilic polymers. Free diffusion of virus particles is slowed down, viruses are physically prevented from entering the surface of epithelial cells, after entering a body fluid system, under the action of body fluid shear force and protein, the nanometer shield can be disassembled and assembled into DSPE-PEG molecules, the DSPE-PEG molecules can be inserted into the surface of the epithelial cells through hydrophilic and hydrophobic interaction, and the activity of the DSPE-PEG molecules on the surface of the epithelial cells is improved. A hydration layer formed by PEG can block the interaction between viruses and cells; meanwhile, arbidol medicine is released, arbidol can further inhibit fusion of virus envelopes and cell membranes and block release of virus nucleic acid, and in-vivo experiments show that effective protection can be provided for at least 8 h by inhaling the nano shield once.

Description

Technical Field

[0001] The present application relates to the field of nano shields and preparation technologies, and specifically to a nano shield capable of preventing respiratory viral infections, a preparation method and an application thereof. Background Art

[0002] Influenza A virus (IAV) belongs to the family Orthomyxoviridae and includes many subtypes. It is characterized by complex structure, high variability, and a wide range of infected hosts. It is an acute upper respiratory tract infection infectious disease. It causes serious health problems, high mortality, and socioeconomic losses worldwide. At present, there are two main ways to prevent viral infection: vaccination and relying on antiviral drugs. Vaccination is one of the most effective ways to prevent viral infection. It can prevent infectious diseases by reducing morbidity and mortality. Its main function is to produce neutralizing antibodies against viral surface proteins. However, mutations in viral surface proteins may limit the efficacy of these vaccines, and it is not clear how long immune protection can last. Antiviral drugs control the spread of influenza virus by inhibiting key steps in viral replication and transmission. However, influenza virus has a strong ability to recombinant mutation and antigenic drift, and with the emergence of drug-resistant mutants, the timeliness of antiviral drugs is also restricted. Therefore, there is an urgent need for a powerful strategy that can effectively prevent influenza virus infection, preferably before the virus reaches the target lung cells. This is of great significance for the effective prevention of influenza virus.

[0003] Most respiratory viruses are transmitted to the nasal mucosa through droplets in the air, and influenza virus, as an important pathogen of respiratory infection, is transmitted through the air and must first penetrate mucus and enter the cells lining the respiratory tract. At the same time, possible reasons for the high transmissibility of respiratory viruses include active replication of viruses in airway epithelial cells in the early stages of infection. Therefore, as the first and top layers of the immune system, physical barriers such as mucus on the lining of the airways play a key role in defending against infection, especially in preventing many respiratory viruses from reaching target cells. At present, studies have used the interaction between bioadhesive polymers and mucus to enhance its diffusion barrier properties and reduce viral penetration, thereby effectively preventing viral infection. Although there are many nasal sprays currently available to prevent viral infection and build a physical viral barrier for users. However, most nasal sprays are designed to resist viral invasion by increasing viscosity, creating a viscous barrier, thereby shielding the virus, or blocking proteins or receptors required for the virus to enter the cell. However, these protective agents have problems such as short prevention time, high cost, and insufficient broad spectrum. Therefore, it is of great significance to develop a potent broad-spectrum protective agent that can effectively prevent multiple subtypes of influenza virus infection. Summary of the invention

[0004] In view of this, the present application provides a nanoshield, preparation method and application that can prevent respiratory viral infections, which solves the technical problems of the protective agents in the prior art, such as short prevention time, high cost and insufficient broad spectrum.

[0005] According to the first aspect of the present application, the present application provides a nano shield that can prevent respiratory viral infections. The nano shield is a spherical structure formed by self-assembly of a DSPE-PEG amphiphilic polymer with drugs wrapped inside. The DSPE-PEG amphiphilic polymer can be inserted into the surface of epithelial cells to block the virus from entering the surface of epithelial cells; the nano shield can disassemble into DSPE-PEG molecules in the body and release the arbidol drug. The released arbidol drug inhibits viral replication, thereby preventing viral infection.

[0006] In one embodiment, the particle size of the nano-shield is 8-40 nm; the viscosity of the nano-shield is 1.75 mPa.s.

[0007] According to the second aspect of the present application, the present application provides a method for preparing a nanoshield, wherein DSPE-PEG amphiphilic polymer and arbidol drug are weighed in different mass ratios, dissolved in chloroform, and crushed under ultrasonic conditions at 4°C for 20-30 minutes. After ultrasonic crushing, the chloroform is removed by a rotary evaporator, the resulting solution is dissolved in a PBS buffer solution, and a NAP-5 desalting column is used to remove the free arbidol drug, thereby obtaining a nanoshield, and the drug encapsulation efficiency (EE) is determined by a UV-visible spectrophotometer, and the nanoshield is destroyed by 1% Triton X-100, and then the total content of the internal drug is quantitatively determined. The calculation formula of EE% is as follows:

[0008]

[0009] In one embodiment, the mass ratio of the DSPE-PEG amphiphilic polymer to the arbidol drug is 400:(1-16); preferably, the mass ratio of the DSPE-PEG amphiphilic polymer to the arbidol drug is 400:8.

[0010] In one embodiment, the DSPE-PEG amphiphilic polymer is self-assembled in an aqueous solution with a lipid molecule DSPE as one end of the amphiphilicity and a backbone PEG as the other end of the amphiphilicity.

[0011] In one embodiment, the molecular weight of the DSPE-PEG amphiphilic polymer is 350-20000; the chain length of the DSPE-PEG amphiphilic polymer is 0.35K-20K; preferably, the concentration of the DSPE-PEG amphiphilic polymer is 10 μM-200 μM.

[0012] According to the third aspect of the present application, the present application provides a nanoshield prepared by the above preparation method, wherein the nanoshield prevents viral infection by blocking viruses from entering the surface of epithelial cells and inhibiting viral replication.

[0013] According to the fourth aspect of the present application, the present application provides the use of the above-mentioned nanoshield in preventing respiratory viral infections, wherein the nanoshield is used to prevent viral infections, and the viruses include H1N1 influenza virus, H9N2 influenza virus, and new coronavirus pseudovirus, etc.

[0014] According to the fifth aspect of the present application, the present application provides a drug for preventing respiratory viral infection prepared by the above-mentioned NanoShield, wherein the drug for preventing respiratory viral infection includes nasal drops, injections, oral preparations, granules, etc. containing the NanoShield.

[0015] The present application provides a nano shield, preparation method and application for preventing respiratory viral infection. The nano shield is formed by self-assembly of (1,2-distearoyl-sn-glycero-3-phosphoacetamide-N-[methoxy(polyethylene glycol) (DSPE-PEG)) amphiphilic polymer, and the influenza preventive antiviral drug Abidol is wrapped inside. By optimizing the chain length of PEG in the amphiphilic polymer, high viscosity is generated in the respiratory system to physically prevent virus entry. After entering the body fluid system, under the action of body fluid shear force and protein, the nano shield can be disassembled into DSPE-PEG molecules to release the Abidol drug. Then, the DSPE-PEG molecules can be inserted into the surface of epithelial cells through hydrophilic and hydrophobic interactions. The hydration layer formed by PEG can block the interaction between the virus and the cell. At the same time, Abidol can further inhibit the fusion of the virus envelope and the cell membrane and block the release of viral nucleic acid. In vitro experiments show that the nano shield has a triple preventive effect on viral infection. In vivo experiments have shown that a single inhalation of the nanoshield can provide effective protection for at least 8 hours. In addition, the nanoshield is only a few dozen nanometers and will not interfere with normal respiratory function, and its antiviral efficacy will not be affected by viral mutations. Therefore, this antiviral approach can provide additional protection for the population from other subtypes of influenza viruses and even other respiratory pathogens. This design principle can provide important guidance for the design of protective anti-pathogen drugs against other respiratory viruses and pathogenic pathogens. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is a graph showing the experimental results of the characterization of the self-assembly of DSPE-PEG amphiphilic polymers to form nanomicelles and their effects on H1N1 influenza virus in mucus protein;

[0017] Figure 2Figure 1. Experimental results of DSPE-PEG amphiphilic polymer inserted into cell membrane;

[0018] Figure 3 This is the experimental result of the nano-shield inserted into the cell membrane to inhibit the infection of influenza virus to MDCK cells;

[0019] Figure 4 This is an experimental result showing that the Nano Shield inhibits the virus from reaching the lungs and reduces the virus's ability to infect the body;

[0020] Figure 5 This is an experimental result showing that mice were protected from influenza virus infection after inhalation of nanoshield;

[0021] Figure 6 This is the result of the free diffusion experiment of the virus in mucin and mucin solution with different concentrations and different PEG chain lengths;

[0022] Figure 7 This is the fluorescence imaging of DSPE-PEG2000-Biotin embedded in the plasma membrane of MDCK cells;

[0023] Figure 8 It is a graph of cell viability of MDCK cells treated with amphiphilic polymers of different concentrations and different PEG chain lengths;

[0024] Fig. 9 This is the experimental result diagram of SA-QD without nonspecific adsorption;

[0025] Fig.10 It is a graph showing the effect of the insertion of long PEG chain amphiphilic polymers into the MDCK cell membrane on the adsorption of H9N2 virus;

[0026] Fig.11 This is an experimental result diagram showing that the insertion of long PEG chain amphiphilic polymers into the cell membrane significantly reduces the infectivity of the H1N1 virus;

[0027] Fig.12 This is the experimental result diagram showing that the insertion of long PEG chain amphiphilic polymer into the cell membrane significantly reduces the infectivity of H9N2 virus;

[0028] Fig.13 It is the UV-visible absorption spectra of different concentrations of Abidol drug;

[0029] Fig.14 This is a picture of the experimental results of the nano-shield inserted into the cell membrane to inhibit the infection of H9N2 virus and new coronavirus pseudovirus;

[0030] Fig.15 It is a comparison chart of cell activity after MDCK cells were incubated with different concentrations of Abidol (0-400 μg / mL) for 24 hours;

[0031] Fig.16 It is a statistical graph of female BALB / c mice intranasally injected with 20 mg / kg nanomicelles and nanoshield;

[0032] Fig.17 are the hematoxylin and eosin (H&E) staining images of the main organs of mice after different treatments (PBS, nanomicelles, or nanoshield);

[0033] Fig.18 This is an image of mouse lung tissue;

[0034] Fig.19 This is the in vitro near-infrared fluorescence image of various tissues and organs of mice one day after infection with the H1N1 influenza virus;

[0035] Fig. 20 In vitro imaging of major tissues and organs at different time points after intranasal injection of nanoshield in mice;

[0036] Fig.21 This is an experimental result showing that inhaled nanoshield can protect mice from H9N2 influenza virus infection;

[0037] Fig. 22 This is a picture of nano-micelles protecting mice from influenza virus infection in a short period of time;

[0038] Fig.23 This is a diagram showing the structure of the nanoshield and the experimental results of its working principle in preventing viral infection in the body;

[0039] Fig.24 is a graph of the viscosity values ​​of amphiphilic polymers with different PEG chain lengths and different PEG concentrations. DETAILED DESCRIPTION

[0040] The following will be combined with the drawings in the embodiments of the present application to clearly and completely describe the technical solutions in the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, not all of the embodiments. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of this application.

[0041] Unless otherwise specified in this application, all reagents are commercially available.

[0042] DSPE-PEG350 / 1000 / 2000 / 5000 / 20000 was purchased from Xi’an Ruixi Biotechnology Co., Ltd.;

[0043] Cy5- N -hydroxysuccinimide ester was purchased from Aladdin Biochemical Technology Co., Ltd.;

[0044] Rabbit anti-influenza A virus NP protein antibody (anti-NP rabbit mAb) was purchased from Beijing Sino Biological Technology Co., Ltd.;

[0045] Arbidol was purchased from Proteintech;

[0046] CellMaskTM green plasma membrane dye was purchased from Invitrogen;

[0047] QD705 (quantum dots with a maximum emission wavelength of 705 nm) was purchased from Invitrogen;

[0048] Nuclear dye (Hoechst 33342) was purchased from Solebol;

[0049] TPCK-trypsin was purchased from Sigma;

[0050] Mucin was purchased from Tianjin Solomon Biotechnology Co., Ltd.;

[0051] Canine kidney epithelial (MDCK) cells were kindly provided by the Wuhan Institute of Virology, Chinese Academy of Sciences;

[0052] Sodium chloride, disodium hydrogen phosphate dodecahydrate, potassium chloride, and potassium dihydrogen phosphate were purchased from Sinopharm Chemical Reagent Co., Ltd.

[0053] Experimental Example 1

[0054] The nanomicelles formed by the self-assembly of DSPE-PEG amphiphilic polymers were characterized, and the H1N1 influenza virus was added to mucus proteins with different concentrations and different PEG chain lengths for comparative experiments. Figure 1 This is a result diagram of the characterization of the self-assembly of DSPE-PEG amphiphilic polymers to form nanomicelles and their effect on H1N1 influenza virus in mucus protein; Figure 1 a is the experimental result of the effect of nano-micelles on the movement of H1N1 influenza virus in mucus protein; Figure 1 a. DSPE is selected as one end of the amphiphilic molecule. As a lipid molecule, DSPE can be well inserted into the cell membrane, while the long-chain PEG as the other end will increase the viscosity of the surrounding environment, which is expected to achieve similar effects to existing physical protective nasal sprays, limiting the penetration of viruses by increasing the viscosity of nasal mucus, thereby blocking viral infection; Figure 1 b is the chemical formula of the nanomicelles formed by self-assembly of DSPE-PEG amphiphilic polymers; Figure 1As shown in b, in order to determine the main skeleton of the nanoshield, amphiphilic polymers with PEG molecular weight (Mw) of 350 (DSPE-PEG350), 1K (DSPE-PEG1K), 2K (DSPE-PEG2K), 5K (DSPE-PEG5K) and 20K (DSPE-PEG20K) were selected, and their physical properties were detected, indicating that DSPE-PEG with different chain lengths can self-assemble to form nanomicelles; Figure 1 c is a dynamic light scattering (DLS) graph of nanomicelles formed by self-assembly of amphiphilic polymers with different PEG chain lengths; Dynamic light scattering (DLS): DLS data is obtained on a laser scattering spectrometer. The constrained regularization method is used to invert the data and analyze the intensity autocorrelation function. In order to avoid the influence of bubbling on the scattering intensity, the scattered light intensity of amphiphilic polymers with different PEG chain lengths is measured after standing for 1 minute.

[0055] Figure 1 d is a transmission electron microscopy (TEM) (HT7800, Hitachi) image of nanomicelles of DSPE-PEG (molecular weight Mw is 20K) at a concentration of 200 μM; Transmission electron micrograph (TEM): TEM images were recorded on a transmission electron microscope (HT7800 (Hitachi)). The sample was prepared by dropping the solution onto a copper grid coated with Formvar film. Excess water was removed with filter paper and dried at room temperature for TEM observation.

[0056] Figure 1 c Dynamic light scattering (DLS) and Figure 1 d Transmission electron microscopy (TEM) shows that the hydrodynamic sizes of these amphiphilic polymers with different PEG chain lengths are in the range of 8–40 nm ( Figure 1 c), and can self-assemble in aqueous solution to form nanomicelles ( Figure 1 d), Figure 1 d The hydrated particle size of nanomicelles is 10 nm; Figure 1 e is the diffusion trajectory of influenza virus after adding nano-micelles with different chain lengths to mucus protein; Figure 1As shown in Fig. e, based on the single virus tracking (SVT) technology, we traced the diffusion behavior of quantum dot (QD)-labeled H1N1 influenza A virus in mucus protein with different PEG chain lengths. The typical motion trajectory analysis showed that even at high concentrations, the addition of nanomicelles with short PEG chain lengths (such as DSPE-PEG350, DSPE-PEG1K and DSPE-PEG2K) did not change the diffusion behavior of the virus, but the addition of long PEG chain lengths (DSPE-PEG20K) to mucus protein significantly reduced the diffusion ability of virus particles, even at a low concentration of 50 μM. In addition, DSPE-PEG5K only inhibited the diffusion behavior of the virus at a concentration of up to 200 uM; 1f-j are the diffusion coefficient D values ​​of H1N1 influenza virus in mucus protein with different DSPE-PEG concentrations added; as shown in Fig. Figure 1 f-shown, based on the relationship curve between the mean square displacement (MSD) and the time interval (Δt), the diffusion coefficient (D) of the virus particles in different media was calculated, which further confirmed that the addition of nanomicelles with long PEG chain lengths to mucus proteins can effectively reduce the diffusion movement of virus particles; Figure 1 k is the heat map of the viscosity of the system after treatment with different concentrations and different DSPE-PEG chain lengths; the viscosity of the solution was calculated based on the relationship between the D value and the viscosity. The results show that as the PEG chain length increases, the viscosity of the system also increases; Figure 1 l is the typical motion trajectory and MSD-Δt diagram of H1N1 influenza virus in mucus and in mucus with DSPE-PEG20K at a concentration of 200 μM; therefore, Figure 1 It can be seen that high concentration of DSPE-PEG has high viscosity, and high viscosity DSPE-PEG reduces the diffusion ability of H1N1 influenza virus.

[0057] Experimental Example 2

[0058] Cell culture: Canine kidney epithelial MDCK cells and human kidney epithelial 293T cells were cultured in DMEM medium containing 5% and 10% (v / v) FBS, respectively, and placed in an incubator at 37°C and 5% CO2.

[0059] Quantum dot labeling of viruses: Canine kidney epithelial (MDCK) cells were incubated with DSPE-PEG amphiphilic polymers of different concentrations and chain lengths at room temperature for 1 hour, and the cells were washed with PBS to insert the amphiphilic polymers into the MDCK cell membrane. The H1N1 influenza virus was then adsorbed on the cells and labeled with quantum dots. First, 100 μL of H1N1 influenza virus was reacted with 10 μg Sulfo-NHS-SS-Biotin (Thermo) on a shaker at room temperature for 2 h, and the excess biotin was removed with a NAP-5 desalting column, and the agglomerated virus was removed with a 0.22 μm filter to obtain biotinylated H1N1 influenza virus, which was diluted to 1 mL with PBS. 100 μL of H1N1 influenza virus was incubated with the above-mentioned cells treated with different concentrations and chain lengths of DSPE-PEG amphiphilic polymers at 4°C for 15 min, and the excess virus was washed away with pre-cooled PBS, and then 100 μL of 2nM SA-QD 705 was added. After incubation at 4°C for 15 min, the excess quantum dots were washed away with PBS. At this point, the H1N1 influenza virus adsorbed on the cell surface has been labeled with quantum dots.

[0060] MDCK cell scanning electron microscopy (SEM): MDCK cells were incubated with 200 μM DSPE-PEG (molecular weight 20K) at room temperature for 1 h, and after washing away the excess DSPE-PEG, the cells were digested with trypsin, centrifuged, the supernatant was discarded, and the cells were fixed with 2.5% glutaraldehyde at room temperature for 2 h, centrifuged again, the supernatant was discarded, and finally dispersed in secondary water and vacuum dried for 48 h. The samples were imaged using a scanning electron microscope.

[0061] Figure 2 This is the experimental result of long-chain DSPE-PEG amphiphilic polymer inserted into the cell membrane. Figure 2 a is the result of the virus adsorption experiment on the cell membrane of the untreated cell and the cell membrane with the long PEG chain amphiphilic polymer inserted, as shown in Figure 2 As shown, the nanomicelles formed by the amphiphilic polymer (DSPE-PEGn) have the ability to insert into the cell membrane. At the cellular level, they may also affect the infectivity of the virus by affecting the binding of the virus to the cell surface receptors; Figure 2bc is the fluorescence image of quantum dot (QD) labeled H1N1 influenza virus on MDCK cell membrane without and with DSPE-PEGn (scale bar 10μm). Different concentrations of DSPE-PEGn were incubated with cells at room temperature for 1h, and then the H1N1 influenza virus labeled with SA-QD 705 was incubated with cells at 4℃ to observe the binding degree of H1N1 influenza virus to cell surface receptors. Confocal imaging showed that with the embedding of high concentration of long PEG chain DSPE-PEGn, the amount of virus bound to the cell membrane gradually decreased, which indicates that the insertion of long PEG chain amphiphilic polymer into the cell membrane affects the adsorption of virus on the cell membrane. Figure 2 (d) is the fluorescence intensity of H1N1 virus on normal cells and cell membranes inserted with DSPE-PEGn (n=50), the number of fluorescence intensity statistics is 50, and the statistical results show that embedding DSPE-PEG350 / 1K / 2K with low PEG chain length into the cell membrane will not affect the binding of the virus to the cell. However, DSPE-PEG5K embedded with high concentration of long PEG chain does affect the binding of the virus to the cell, and DSPE-PEG20K embedded with long PEG chain basically affects the binding of the virus to the cell; Figure 2 e is the fluorescence intensity heat map of H1N1 influenza virus binding to the cell membrane with different PEG chains inserted at different concentrations. Figure 2 The fluorescence intensity data of d are presented in the form of a heat map, which more intuitively illustrates that only the embedding of high-concentration long PEG chains can block the binding of the virus to the cell membrane surface receptors; Figure 2 f is the scanning electron micrograph of unanchored and anchored DSPE-PEG20K on MDCK cells (scale bar 5 μm), Figure 2 f Scanning electron microscopy (SEM) results show that when amphiphilic polymers (such as DSPE-PEG20K) are anchored on the cell membrane through hydrophobic interactions, they can change the cell surface structure, induce cell membrane swelling and enhance surface tension, thereby spatially inhibiting the virus from entering the cell; Figure 2 g is a heat map of the effects of viscosity and receptor binding of amphiphilic polymers on the prevention of viral infection; based on the comprehensive evaluation of viscosity and receptor binding, only high-concentration long-PEG chain amphiphilic polymers can effectively prevent viral infection. From the above, it can be seen that long-chain DSPE-PEG amphiphilic polymers can physically block the binding of viruses to cell membrane receptors.

[0062] Experimental Example 3

[0063] Immunofluorescence labeling of viral nucleoprotein: H1N1 influenza virus was incubated with MDCK cells at 4°C for 15 min. After washing away the unadsorbed H1N1 influenza virus with 1× PBS buffer, DPBS buffer was added and placed in a 37°C incubator to infect the cells with H1N1 influenza virus for 2 h. After washing the cells three times with PBS, the cells were fixed with 4% paraformaldehyde at room temperature for 20 min. The MDCK cell membrane was permeabilized with 0.1% Triton X-100 at room temperature for 15 min, and then incubated with 5% BSA in a 37°C incubator for 30 min to block nonspecific sites. After washing the cells with PBS, the antibody against viral nucleoprotein (NP) diluted with PBS (1:300) was added and incubated in a 37°C incubator for 1.5 h. After that, the cells were washed three times with PBS on a shaker for 5 min each time, and then incubated with a secondary antibody containing DyLight 649 labeled goat anti-rabbit (1:300) in a 37°C incubator for 1 h. The cells were washed with PBS three times for 5 min each time on a shaker in the dark, and then incubated with Hoechst 33342 for 10 min at room temperature.

[0064] Fluorescence imaging: Confocal imaging was performed using an inverted fluorescence microscope (IX83, Olympus) equipped with a spinning disk confocal unit and a live cell imaging chamber, and images were acquired using a 100x oil objective. For multichannel imaging, Hoechst 33342, CellMask Green Plasma Membrane, and DyLight 649 were imaged using 405, 488, and 640 nm lasers and 447 / 60, 525 / 50, and 685 / 40 nm emission filters, respectively. QD 705 was imaged using a 685 / 40 nm emission filter.

[0065] Figure 3 This is the experimental result of the nanoshield inserted into the cell membrane to inhibit the infection of influenza virus to MDCK cells. Figure 3 a is an experimental result diagram of the preparation of nanoshields that can effectively prevent viral infection by encapsulating Arbidol in nanomicelles, wherein Arbidol is a drug that inhibits viral replication by blocking the fusion between the viral envelope and the cell membrane; Figure 3 b is the UV absorption spectra of nanomicelles, Abidol drug and nanoshield, which confirms that the nanomicelles successfully encapsulate the drug through UV absorption; Figure 3 c is the encapsulation efficiency diagram of different ratios of nanoshield micelles and drugs. When the ratio of nanomicelles to drugs is 400:8 (m / m), it shows excellent encapsulation efficiency, up to 86.5%; Figure 3 d is the release curve of the drug Abidol within 48 hours (n=3), such as Figure 3As shown in d, the nanoshield can slowly release the drug in vitro, releasing 61.2% within 12 hours, 72.3% within 24 hours, and 84.9% within 48 hours; Figure 3 ef is the result diagram and flow chart of the Nanoshield triple prevention of virus infection experiment. In order to study the triple prevention effect of Nanoshield on viruses at the cellular level, the virus replication was evaluated by detecting the expression level of influenza virus NP protein in infected cells. First, the cells were incubated with Nanoshield, and then the virus infected the cells at 37°C for 2h. Subsequently, the cells were fixed, permeabilized and blocked, and then immunofluorescence staining was performed with influenza virus NP antibody to evaluate the ability of Nanoshield to inhibit virus replication. Figure 3 g is the immunofluorescence (scale 10μm) of MDCK cells treated with nanomicelles, Arbidol and Nanoshield at different time points (1h, 6h, 12h and 24h) after H1N1 influenza virus infects them. NP is labeled with Dylight 649 (magenta) and cell nuclei are labeled with Hoechst 33342 (cyan). Confocal imaging shows that under normal conditions, viral NP can replicate in large quantities in the cell nucleus. After the cells were incubated with nanomicelles, Arbidol and Nanoshield for 1h, no NP signal was observed in the cells, indicating that there was no significant difference in the preventive effect of nanomicelles, Arbidol and Nanoshield on the virus. Figure 3 hk is statistical analysis Figure 3 The average fluorescence intensity of the NP signal in each cell nucleus corresponding to the time point g (the total fluorescence intensity of the NP signal in the cell nucleus divided by the cell nucleus area), the number of cell nuclei counted n = 80, Figure 3 hk It can be seen that as the incubation time with cells increases, Nanoshield shows excellent antiviral effects compared with nanomicelles and Arbidol, which lasts for nearly 24 hours at the cellular level. These results show that the preventive effect of Nanoshield against viruses persists as the incubation time increases, and this advantage is particularly evident when the incubation time is extended. This may be attributed to the fact that Nanoshield only exerts a short-term preventive effect through the external DSPE-PEG20K amphiphilic polymer, while from the perspective of long-term prevention, the disassembly of the external nanomicelles leads to the release of the internal Arbidol drug, further inhibiting viral replication and preventing viral infection.

[0066] Experimental Example 4

[0067] Homogenization of lung tissue: Use a tissue homogenizer to lyse the virus-infected lung tissue, add 200 μL PBS solution to every 10 mg of lung tissue infected with H1N1 influenza virus, homogenize at 7000 rpm for 20 seconds, and then centrifuge at 4°C and 12000 g for 5 minutes. Collect the supernatant.

[0068] RT-qPCR: TaKaRa's MiniBEST Viral RNA / DNA Extraction Kit was used to extract H1N1 influenza virus RNA from the supernatant. Then, total tissue RNA was used as a template and reverse transcription was performed using a PrimeScript TM RT reagent Kit) was used to obtain viral genome cDNA by RT-PCR. The viral cDNA obtained by reverse transcription was used as a template, and the viral gene fragments were analyzed by fluorescence quantitative PCR using PR8 viral gene fragment-specific upstream and downstream primers (Table 1).

[0069] Table 1 Specific upstream and downstream primers for PR8 virus gene fragments

[0070] Primer 5’-3’ NP-F GGTCGGTTGCTCACAAGTCC NP-R CAAATGCGGCAGAATGGC IFN-β-F AGGACAGGATGAACTTTGAC IFN-β-R TGATAGACATTAGCCAGGAG

[0071] Near-infrared region II lead sulfide quantum dots labeling virus: 100 μL influenza virus and 10 μg Sulfo-NHS-SS-Biotin were reacted on a shaker at room temperature for 2 hours, excess biotin was removed with a NAP-5 desalting column, and agglomerated viruses were removed with a 0.22 μm filter. Biotinylated virus was obtained. Then, it was incubated with 2 nM streptavidin-modified lead sulfide quantum dots (SA-PbS QD) at room temperature for 1 hour to obtain virus labeled with near-infrared region II lead sulfide quantum dots.

[0072] In vivo fluorescence imaging of mice: NIR-II imaging was performed on a laser in vivo fluorescence imaging system (Guangyingmei) equipped with a thermoelectrically cooled InGaAs camera and external laser diodes emitting at 808 and 980 nm. The excitation light was provided by an 808 nm laser diode, and the emission light was filtered by a 1000 nm long pass filter. The excitation intensity of the 808 nm laser was approximately 50 mW / cm 2 During injection and imaging, mice were anesthetized using 2% isoflurane and 2 L / min oxygen flow. Mice were imaged at different time points after injection using the NIR-II fluorescence imaging system.

[0073] Figure 4 This is an experimental result showing that the Nano Shield inhibits the virus from reaching the lungs and reduces the virus's ability to infect the body. Figure 4 a is the experimental flow chart of intranasal injection of nanoshield, QD-H1N1 and NIR-II fluorescence imaging in mice. To investigate the in vivo antiviral activity of nanoshield, we used PbS quantum dots emitting in the near-infrared region II (NIR-II) to label the virus. Then, we pre-instilled nanoshield into the mice's nose and then infected the mice with the labeled H1N1 virus; Figure 4b is the in vivo imaging of mice in the control group and the nanoshield treatment group within 0.5-12 hours after infection with H1N1 influenza virus; Figure 4 c is Figure 4 Figure b shows the fluorescence intensity change of the circled area (n=3, n is 3 mice). The fluorescence images of the mouse lungs were recorded by in vivo imaging from 0.5h to 12h after virus infection. The results showed that the control group showed a strong fluorescence signal of QD-labeled virus, reaching the maximum intensity at 1h, while mice that had been given a nanoshield in the nose beforehand could prevent the virus from reaching the lungs. Statistical analysis showed that the nanoshield significantly reduced the fluorescence intensity of the virus in the lungs, indicating that the amount of virus reaching the lungs may be reduced; Figure 4 d is Figure 4 b Corresponding fluorescence imaging of lung tissue organs (ex vivo); Ex vivo organ fluorescence imaging showed that pre-drip of nanoshields could inhibit the entry of viruses into the lungs; Next, we homogenized the lung tissues and detected the viral load and expression of inflammatory factors by real-time fluorescence quantitative PCR (RT-qPCR), because viral load and tissue inflammation are direct evidence of viral infection. Figure 4 e is a graph showing the experimental results of H1N1 influenza virus infection in mice, and a graph showing the experimental results of real-time quantitative PCR (RT-qPCR) analysis of lung tissues of female BALB / c mice; Figure 4 fg is the expression level of viral nucleoprotein (NP) and inflammatory factor interferon-β (IFN-β) mRNA in the lungs of BALB / c mice 24 hours after influenza virus infection (n=3). Quantitative PCR results showed that compared with the control group, the instillation of NanoShield significantly inhibited the replication of the virus in the lungs and led to a downregulation of the level of inflammatory factor IFN-β. These results indicate that after inhaling NanoShield, mice can block the virus from entering the lungs, and NanoShield can effectively reduce the virus's ability to infect in vivo.

[0074] Experimental Example 5

[0075] Animal model: All animal procedures were performed in accordance with the Regulations on Laboratory Animal Management of China, and all procedures were approved by the Animal Experiment Committee of Nankai University (SYXK) (Jin) 2019-0003). Six-week-old female Balb / c mice were purchased from Charles River Laboratories and were free of any disease or infection at the time of the experiment. For viral infection, mice were anesthetized with 1.2% tribromoethanol (0.02 mL / g body weight, energy chemicals) by intraperitoneal injection and 10 5.25 The dose of TCID50 / mL was inoculated intranasally.

[0076] Fluorescent labeling of lung tissue: First, the mice were dripped with Nanoshield at different time points, and then the mice were infected with H1N1 influenza virus. After 24 hours, the mouse lung tissue was removed, washed with PBS, and the water was dried. Place it on a tissue support, lay the tissue flat, drip OCT embedding agent around it, and quickly freeze it on liquid nitrogen until the embedding agent and tissue freeze into a white ice body and then slice it. Adjust the thickness to be cut on the freezing slicer. The thickness of the lung tissue slice is generally between 5 and 10 μm. Attach the cut lung tissue to the slide. After washing the lung tissue slices with PBS, fix the lung tissue with 4% paraformaldehyde at room temperature for 30 minutes, permeabilize it with 0.1% Triton permeabilization solution at room temperature for 15 minutes, and then incubate it with 4% BSA at room temperature for 1 hour to seal the tissue. Add the antibody of viral nucleoprotein NP diluted with PBS (1:300), incubate overnight at 4°C, then wash the tissue sections 3 times with PBS, add DyLight 649 labeled goat anti-rabbit secondary antibody (1:300), incubate at room temperature for 1 hour in the dark, then wash the tissue 3 times with PBS, finally stain with DAPI at room temperature for 1 hour, and wash 3 times with 1% Tween. Use anti-fluorescence quencher to seal the slide, apply nail polish around the periphery to fix the cover glass, and image.

[0077] Histopathological staining: The tissues and organs of mice were fixed with 4% paraformaldehyde for more than 24 hours, dehydrated with gradient alcohol, immersed in wax, and embedded to make tissue wax blocks. The tissue wax blocks were sliced ​​and stained with hematoxylin-eosin (HE), and finally dehydrated and sealed. The tissues were observed under a microscope to see if there were any lesions, inflammation, or other symptoms.

[0078] Immunohistochemistry experiment: The tissue is dewaxed to water through paraffin sections, and then antigen repair, endogenous peroxidase blocking, and serum blocking are performed. The primary antibody (1:300) diluted with PBS is added to the sections, and the sections are placed flat in a humidified box and incubated overnight at 4°C (a small amount of water is added to the humidified box to prevent the antibody from evaporating). After that, the sections are placed in PBS and washed and soaked for 3 times, each time for 5 minutes. After the sections are slightly dried, the secondary antibody (HRP labeled) of the corresponding species to the primary antibody is added to the circle to cover the tissue and incubate at room temperature for 50 minutes. The sections are placed in PBS and washed and soaked for 3 times, each time for 5 minutes. After the sections are slightly dried, freshly prepared DAB color development solution is added to the circle. The color development time is controlled under a microscope. The positive is brown-yellow, and the sections are rinsed with tap water to stop the color development. Hematoxylin counterstaining is about 5-10 minutes, and finally dehydration and sealing are performed. Positive and negative signals are observed under a microscope.

[0079] Near-infrared region II lead sulfide quantum dots labeling virus: 100 μL influenza virus and 10 μg Sulfo-NHS-SS-Biotin were reacted on a shaker at room temperature for 2 hours, excess biotin was removed with a NAP-5 desalting column, and agglomerated viruses were removed with a 0.22 μm filter. Biotinylated virus was obtained. Then, it was incubated with 2 nM streptavidin-modified lead sulfide quantum dots (SA-PbS QD) at room temperature for 1 hour to obtain virus labeled with near-infrared region II lead sulfide quantum dots.

[0080] Figure 5 This is the experimental result showing that mice were protected from influenza virus infection after inhalation of nanoshield. Figure 5 a is a graph showing the results of a live virus infection experiment; in order to study the protective effect of the nanoshield on mice, the H1N1 influenza virus was intranasally injected into the mice 1h, 6h, 8h, 10h or 12h after inhalation of the nanoshield; Figure 5 b is the imaging image of lung tissue of mice infected with Cy5-labeled H1N1 influenza virus 1h, 6h, 8h, 10h or 12h after intranasal injection of Nanoshield; Figure 5 c is a statistical graph showing the infection rate of H1N1 influenza virus in mouse lung tissue at different time points after inhalation of NanoShield; Figure 5 d is a statistical graph of the antiviral efficiency of nanoshield at different time points after inhalation; Figure 5 The imaging results of b showed that pre-inhalation of nanoshield can block the retention of the virus in the lungs. The protection efficiency of pre-inhalation of nanoshield is 99.4% for 1 hour, 95.2% for 6 hours, 71.2% for 8 hours, 47.3% for 10 hours, and 19.1% for 12 hours. Figure 5 e is the immunofluorescence image of the lung tissue of mice infected with H1N1 influenza virus 8 hours after inhalation of Nanoshield (scale bar 10 μm). Figure 5 The red color in e represents the presence of virus particles in the lungs. Figure 5 e indicates that the nanoshield can provide long-lasting protection against influenza virus infection in the lungs; Figure 5 f is the immunohistochemical staining of nucleoprotein (NP) in lung tissue of mice infected with H1N1 virus 8 hours after inhalation of nanoshield (scale bar 50μm), Figure 5 f indicates that the NP protein immunolabeling experiment confirmed that the nanoshield can reduce the load of H1N1 influenza virus in lung tissue; Figure 5g is a graph of pathological changes in lung tissue at different time points after inhalation of Nanoshield (scale 50μm). The control group was only injected with PBS. The results of HE staining showed that inhalation of Nanoshield for 1h, 6h, and 8h did not cause lung tissue lesions in mice. However, at 10h after inhalation, slight inflammatory cell infiltration was observed in the lung tissue. At 12h after inhalation, nuclear aggregation and mild thickening of the alveolar wall appeared, indicating that Nanoshield provided at least 8h of protection in vivo. Therefore, pre-inhalation of Nanoshield can protect mice from influenza virus infection. Nanoshield can effectively prevent influenza virus infection and prevent the virus from entering the lungs for a certain period of time.

[0081] Experimental Example 6

[0082] First, amphiphilic polymers with different concentrations (10μM, 50μM, 100μM, 150μM and 200μM) and different PEG chain lengths (Mw=350, 1000, 2000, 5000 and 20000) were added to the mucus protein system, and then the movement of viruses in these systems was studied using quantum dot-based single virus tracing technology.

[0083] Imaging analysis: Imaging-Pro Plus was used to track and analyze the movement trajectory of the virus, and the fluorescence signal profile of the cell was obtained by processing. Matlab software was used to calculate and analyze the relationship between the mean square displacement (MSD) of the virus and the time interval (Δt). The movement mode was determined according to the fitting formula of MSD and Δt: MSD = 4DΔt + (VΔt)2 + constant (directional diffusion), MSD = 4DΔtα + constant (restricted diffusion) and MSD = 4DΔt + constant (free diffusion). D represents the diffusion coefficient, V represents the average velocity, and the exponent α is a constant less than 1. ImageJ software was used to reduce the image background, including adjusting the threshold / contrast, analyzing the fluorescence signal intensity, etc.

[0084] Figure 6 This is a diagram of the free diffusion movement of the virus in mucin and mucin fluid with different concentrations and different PEG chain lengths. Figure 6 ae is the relationship curve between the mean square displacement (MSD) of H1N1 influenza virus in mucin and the addition of different concentrations and different PEG chain lengths to mucin and the time interval (Δt). The curves are fitted with the formula MSD = 4DΔt, which is obtained by Figure 6 It can be seen that high concentrations of amphiphilic polymers with long PEG chains can reduce the free diffusion movement of viruses, which means that high concentrations of amphiphilic polymers with long PEG chains can reduce the infection efficiency of viruses.

[0085] Experimental Example 7

[0086] Cell labeling: MDCK cells were seeded into confocal dishes at a density of 50-60% one day in advance, and the cells were incubated with 60 μM DSPE-PEG2000-Biotin at room temperature for different times (0, 0.5, 1, 2, 3, 4 h), and the cells were washed with PBS and then added with 2 nM SA-QD 705 (705 quantum dots modified with streptavidin), incubated at room temperature for 15 min, and then the excess quantum dots (QD) were washed with PBS, and then the cells were incubated with 4% paraformaldehyde fixative at room temperature for 20 min. After that, a solution containing 0.1‰ CellMask green plasma membrane dye and 10 μg / mL Hoechst 33342 dye was incubated with the above MDCK cells at room temperature for 10 min, and the excess dye was washed with PBS to obtain cells whose plasma membranes were labeled with quantum dots and CellMask dyes and whose nuclei were labeled with Hoechst 33342.

[0087] Figure 7 This is a fluorescence imaging of DSPE-PEG2000-Biotin embedded in the plasma membrane of MDCK cells. The cell membrane and cell nucleus were labeled with CellMask (green) and Hoechst 33342 (blue), respectively (scale bar 10μm). Biotinylated DSPE-PEGn was incubated with MDCK cells at room temperature for different times, and then the cell membrane was labeled with streptavidin-modified quantum dots (SA-QD) to prove that DSPE-PEG2000-Biotin can be embedded in the plasma membrane of the cell. The time for DSPE-PEGn to be embedded in the cell lipid membrane was optimized by confocal imaging. When the cells were incubated with biotinylated DSPE-PEGn for 0.5h, SA-QD could be specifically bound to the cell membrane through the interaction between biotin and streptavidin, and the QD signal increased with the extension of the incubation time. In order to ensure that DSPE-PEGn can be completely embedded in the cell lipid membrane, 1h was selected as the optimal time for DSPE-PEGn to be incubated with cells.

[0088] Experimental Example 8

[0089] Cytotoxicity experiment: The CCK-8 method was used to investigate the cytotoxicity of amphiphilic polymers with different concentrations and different PEG chain lengths. 4 The cells were inoculated at a density of 100 μL in a 96-well plate, and the edge wells were filled with sterile PBS. The plates were cultured overnight at 37°C and 5% CO2. Then, different concentrations of amphiphilic polymer samples were added. The culture medium wells containing cells or the cell wells without the test samples were used as controls. The plates were cultured in an incubator at 37°C and 5% CO2 for a certain period of time. Then, 10 μL of CCK-8 solution was added to each well. After continuing to culture for 0.5h-4h, the absorbance at 450nm was detected with an enzyme-labeled instrument. Figure 8The figure is a cell viability graph of MDCK cells treated with amphiphilic polymers of different concentrations and different PEG chain lengths (n=5), and then the cytotoxicity of DSPE-PEGn of different concentrations and different PEG chain lengths was detected using the CCK-8 test. The results showed that at a concentration of up to 200 μM, the cell activity of cells treated with DSPE-PEGn remained above 95%, indicating that amphiphilic polymers of different concentrations and different PEG chain lengths do not affect the cell viability of MDCK cells, DSPE-PEGn is almost non-toxic to cells and has good biocompatibility, laying a good foundation for subsequent applications.

[0090] Experimental Example 9

[0091] 100 μL of wild-type H1N1 influenza virus and biotinylated virus were incubated with MDCK cells at 4°C for 15 min. Unbiotinylated and biotinylated viruses were adsorbed on MDCK cells. Excess viruses were washed off with pre-cooled PBS, and 100 μL of 2 nM SA-QD 705 was added to label the viruses with SA-QD 705. Excess quantum dots were washed off with PBS after incubation at 4°C for 15 min. Cell nuclei were labeled with Hoechst 33342. Fig. 9 This is the experimental result of SA-QD without nonspecific adsorption - confocal imaging (scale 10μm); Fig. 9 Combination Figure 2 d shows that embedding DSPE-PEG350 / 1K / 2K with low PEG chain length into the cell membrane will not affect the binding of the virus to the cell. However, embedding DSPE-PEG5K with high concentration of long PEG chain does affect the binding of the virus to the cell, and embedding DSPE-PEG20K with long PEG chain basically affects the binding of the virus to the cell.

[0092] Experimental Example 10

[0093] To prove that this blocking effect is not limited by virus mutations, we further studied other subtypes of influenza A virus H9N2. Statistical analysis: GraphPad Prism software was used to perform t-test analysis of statistical results. Significant differences were defined as (****p<0.0001).

[0094] Fig.10 It is a graph showing the effect of the insertion of long PEG chain amphiphilic polymers into the MDCK cell membrane on the adsorption of H9N2 virus; Fig.10 a is the fluorescence image of H9N2 virus labeled with QD 705 adsorbed on MDCK cell membrane without and with long PEG chain amphiphilic polymer, respectively. Fig.10 a The cell nucleus was stained with Hoechst 33342 (bar 10 μm); Fig.10b is the fluorescence intensity diagram of H9N2 virus labeled with QD 705 adsorbed on MDCK cell membrane without and with long PEG chain amphiphilic polymer inserted (n=30), Fig.10 It can be seen that long PEG chains embedded in the cell membrane will also inhibit the binding of H9N2 virus to the cell membrane. Long PEG chain amphiphilic polymers can effectively block the binding of different subtypes of influenza viruses to cell surface receptors. This also verifies that when amphiphilic polymers are embedded in the cell membrane, the binding of the virus to the receptors on the cell membrane can be blocked.

[0095] Experimental Example 11

[0096] Immunofluorescence labeling of viral nucleoprotein: Same as Example 3

[0097] Titer determination: 24 h in advance, MDCK cells were plated at 3 × 10 4 The cells were inoculated in a 96-well plate at a density of 10 cells / mL. The cell culture medium in the well plate was aspirated and washed three times with sterile 1× PBS. The virus was half-log diluted with H1N1 influenza virus growth medium, and 100 μL of H1N1 influenza virus dilution solution was added to each well of the 96-well plate. The dilution ratio of H1N1 influenza virus in the first to eleventh columns was 10 -2 , 10 -2.5 , 10 -3 , 10 -3.5 , 10 -4 ……10 -7 , only H1N1 influenza virus growth solution was added to the cells in the twelfth column as a negative control. H1N1 influenza virus and cells were incubated in a 37°C incubator for 1 hour (shaking the well plate once every 15 minutes). Then the H1N1 influenza virus solution was aspirated and washed once with 1×PBS buffer, and 100 μL of new virus growth solution was added to each well, and the cells were placed in a 37°C cell incubator for further culture for 48 to 72 hours. Fresh 1% chicken blood red blood cells were used to detect the red blood cell agglutination effect of the supernatant in the 96-well plate. The specific steps are as follows: take out the cell supernatant in the 96-well plate at 40 μL / well, add it to the 96V-type well plate in turn, then add freshly prepared 1% (v / v) chicken blood red blood cell solution at 40 μL / well, mix thoroughly, let it stand at 37°C for 15 to 30 minutes, pick up the well plate vertically and observe from the back of the well plate whether the chicken red blood cells are agglutinated, and finally calculate the virus titer (TCID50 / mL) using the Reed-Muench method.

[0098] Fig.11 This is an experimental result diagram showing that the insertion of long PEG chain amphiphilic polymers into the cell membrane significantly reduces the infectivity of the H1N1 virus; Fig.11a is a 1% chicken red blood cell-induced influenza virus hemagglutination test. The control group was cells without any treatment, and the experimental group was cells treated with long PEG chain amphiphilic polymers. The yellow circle represents the presence of H1N1 particles; Fig.11 b is the titer determination of MDCK cells treated with H1N1 virus control and long PEG chain amphiphilic polymer for 72h (n=3); Fig.11 a and Fig.11 As shown in (b), the ability of many antiviral drugs to inhibit intracellular viral infection is verified by measuring viral titers and nucleoprotein (NP) expression levels. Fig.11 a and Fig.11 b The inhibitory effect of the amphiphilic polymers on H1N1 virus-induced 1% chicken erythrocyte aggregation was evaluated using the hemagglutination inhibition assay; Fig.11 c is the immunofluorescence of MDCK cells treated with control and long PEG chain amphiphilic polymers after H1N1 virus infection for 2 h, using DyLight 649 (magenta) to label NPs and Hoechst 33342 (cyan) to label cell nuclei (bar 10 μm); Fig.11 d is the average fluorescence intensity of NP in the nucleus (the total fluorescence intensity of NP signal in the nucleus divided by the nucleus area) Statistical analysis (n = 70); Fig.11 c and Fig.11 As shown in Figure d, when cells were treated with amphiphilic polymers (DSPE-PEG5K and DSPE-PEG20K), the virus titer was significantly reduced compared with the control group. Immunostaining experiments also confirmed that amphiphilic polymers also inhibited the NP expression level of influenza virus. The in vitro simulation results preliminarily showed that the insertion of long PEG chain amphiphilic polymers into the cell membrane significantly reduced the infection ability of H1N1 virus. The introduction of nanomicelles with high concentrations of long PEG chains as the main framework of the nanoshield can slow down the free diffusion of virus particles by increasing the concentration of mucus, which may cause the virus to be retained in the mucus and unable to reach the surface of epithelial cells.

[0099] Experimental Example 12

[0100] Titer determination: Same as Example 11

[0101] Immunofluorescence labeling of viral nucleoprotein: Same as Example 3

[0102] Fig.12 This is the experimental result showing that the insertion of long PEG chain amphiphilic polymers into the cell membrane significantly reduces the infectivity of the H9N2 influenza virus. Fig.12 a is a hemagglutination test of H9N2 influenza virus induced by 1% chicken red blood cells. The control group was cells without any treatment, and the experimental group was cells treated with long PEG chain amphiphilic polymers. The yellow circle represents the presence of H9N2 particles; Fig.12b is the titer determination of MDCK cells treated with H9N2 virus infection control and long PEG chain amphiphilic polymer for 72 h (n=3); Fig.12 c is an immunofluorescence image of MDCK cells treated with control and long PEG chain amphiphilic polymers after H9N2 virus infection for 2 h, in which NPs were labeled with DyLight 649 (magenta) and cell nuclei were labeled with Hoechst 33342 (cyan) (scale bar 10 μm); Fig.12 d is the statistical graph of the average fluorescence intensity of NP in the cell nucleus (the total fluorescence intensity of NP signal in the cell nucleus divided by the cell nucleus area) (n=70); Fig.12 It can be seen that amphiphilic polymers embedded with long PEG chains on the cell membrane can also inhibit the infection of other subtypes of influenza viruses (such as H9N2) in a similar way to H1N1, that is, by reducing the viral titer and affecting the expression of NP in the cell nucleus; therefore, DSPE-PEG20K was selected to prepare the nanoshield, which can not only increase the viscosity in the surrounding environment and provide an effect similar to that of a physical barrier nasal spray, but also play a role similar to that of antibodies or drugs by blocking the binding of viruses to receptors, thereby preventing viruses from infecting cells and playing a dual preventive role against viral infection.

[0103] Experimental Example 13

[0104] The linear relationship between the ultraviolet absorption and concentration of Arbidol at 310 nm was verified by UV-visible absorption spectrum experiments of Arbidol at different concentrations. Fig.13 This is the UV-visible absorption spectrum of Abidol at different concentrations. Fig.13 a is the UV-visible absorption spectra of drugs at different concentrations; Fig.13 b is the linear relationship between the ultraviolet absorption of the drug Arbidol at 310 nm and its concentration (n=3), which indicates that as the concentration of the drug Arbidol increases, its ultraviolet absorption increases.

[0105] Experimental Example 14

[0106] Immunofluorescence labeling of viral nucleoprotein: Same as Experiment 3

[0107] Experimental Example 14 also studied the preventive effect of Nanoshield on other subtypes of influenza viruses (such as H9N2) and the new coronavirus pseudovirus SARS-CoV-2. Fig.14 This is a graph showing the experimental results of nano-shields inserted into cell membranes to inhibit infection by H9N2 virus and new coronavirus pseudovirus. Fig.14 a is the immunofluorescence of MDCK cells in the control group and the nanoshield-treated group 2 h after H9N2 virus infection, with Dylight 649 (magenta) labeling NP and Hoechst 33342 (cyan) labeling cell nuclei (bar 10 μm); Fig.14 b is the statistical analysis of the average fluorescence intensity of the NP signal in each cell nucleus (the total fluorescence intensity of the NP signal in the cell nucleus divided by the cell nucleus area) (n = 70); Fig.14 c is the fluorescence image of 293T-ACE2 cells infected with the new coronavirus pseudovirus control and treated with nanoshield. Scale bar, 20 μm; Fig.14 d is the fluorescence intensity of GFP in 293T-ACE2 cells after infection with different treatments of the new coronavirus pseudovirus (n=50); Fig.14 It can be seen that when incubated with cells, the nanoshield inserted into the cell membrane inhibited the infection of H9N2 virus and new coronavirus pseudovirus.

[0108] Experimental Example 15

[0109] Cytotoxicity experiment: CCK-8 method was used to investigate the cytotoxicity of different concentrations of arbidol. 4 The cells were inoculated in a 96-well plate at a density of 100 cells, and the edge wells were filled with sterile PBS. Cultured overnight at 37°C and 5% CO2. Then, different concentrations of samples were added, and the culture medium wells containing cells or the cell wells without the test samples were used as controls. Cultured in an incubator at 37°C and 5% CO2 for a certain period of time, and then 10 μL of CCK-8 solution was added to each well. After continuing to culture for 0.5h-4h, the absorbance at 450nm was detected using an enzyme marker.

[0110] Fig.15 is a comparison chart of cell activity after MDCK cells were incubated with different concentrations of Abidol (0-400 μg / mL) for 24 hours; Fig.15 It can be seen that after incubating MDCK cells with Abidor (0-400 μg / mL) for 24 hours, the cell viability remained above 95%, which shows that different concentrations of Abidor do not affect the cell activity of MDCK cells, and the cytotoxic effect of Abidor is extremely small. This also shows that the nanoshield can prevent viral infection for a long time and lays the foundation for future in vivo antiviral research.

[0111] Experimental Example 16

[0112] The mice toxicity test was conducted using nano-micelles and nano-shield. After intranasal injection at a dose of 20 mg / kg, the morbidity (weight change) and mortality (survival rate) of the mice were monitored every day for three consecutive days. The control group was only injected with PBS. Fig.16 This is a statistical graph of female BALB / c mice injected intranasally with 20 mg / kg nano-micelles and nano-shields. Fig.16 It can be seen that there is no difference between the nasal drops of nanomicelles and nanoshield and the control group, which indicates that nasal drops of nanomicelles and nanoshield do not affect the weight changes and survival rate of mice.

[0113] Experimental Example 17

[0114] Histopathological staining: The tissues and organs of mice were fixed with 4% paraformaldehyde for more than 24 hours, dehydrated with gradient alcohol, immersed in wax, and embedded to make tissue wax blocks. The tissue wax blocks were sliced ​​and stained with hematoxylin-eosin (HE), and finally dehydrated and sealed. The tissues were observed under a microscope to see if there were any lesions, inflammation, or other symptoms. Fig.17 These are the hematoxylin and eosin (H&E) staining images of the main organs of mice after different treatments (PBS, nanomicelles or nanoshields) (scale bar 200μm); the hematoxylin and eosin (H&E) staining images show that there is no obvious tissue damage in the heart, liver, spleen, lungs and kidneys of the mice, which indicates that the nanomicelles and nanoshields will not cause tissue damage in mice, and both the nanomicelles and nanoshields have good biocompatibility and biosafety in vivo.

[0115] Experimental Example 18

[0116] Fluorescent labeling of lung tissue: Infect mice with viruses labeled with quantum dots by intranasal dripping. After 24 hours, remove the mouse lung tissue, clean it with PBS, and dry it. Place it on a tissue support, lay the tissue flat, drip OCT embedding agent around it, and quickly freeze it on liquid nitrogen until the embedding agent and tissue freeze into a white ice body before slicing. Adjust the thickness to be cut on the freezing slicer. Depending on the different tissues, the lung tissue is generally between 5 and 10 μm. Attach the cut lung tissue to the slide. After washing the tissue slices with PBS, fix the tissue with 4% paraformaldehyde at room temperature for 30 minutes, permeabilize it with 0.1% Triton permeabilization solution at room temperature for 15 minutes, and then incubate it with 4% BSA at room temperature for 1 hour to seal the tissue. Add the antibody of viral nucleoprotein NP diluted with PBS (1:300), incubate overnight at 4°C, then wash the tissue sections 3 times with PBS, add DyLight 649 labeled goat anti-rabbit secondary antibody (1:300), incubate at room temperature for 1 hour in the dark, then wash the tissue 3 times with PBS, finally stain with DAPI at room temperature for 1 hour, and wash 3 times with 1% Tween. Use anti-fluorescence quencher to seal the slide, apply nail polish around the periphery to fix the cover glass, and image. Fig.18 is the lung tissue imaging of mice (scale bar 10μm); Fig.18 Immunostaining imaging results showed that the QD signal co-localized with the viral NP signal, indicating that the quantum dot-labeled virus was able to reach the lung tissue and the QD signal represented the signal of most viruses.

[0117] Experimental Example 19

[0118] Experimental Example 19 verified that in vitro, pre-inhalation of nanoshield can block the virus from entering the lungs. Fig.19This is the in vitro near-infrared fluorescence image of various tissues and organs of mice one day after infection with H1N1 influenza virus. The control group was only injected with QD-labeled H1N1; Fig.19 Combination Figure 4 d, the in vitro organ fluorescence imaging shows that pre-instillation of nanoshield can inhibit the entry of the virus into the lungs.

[0119] Experimental Example 20

[0120] Cy5-labeled nanoshields were inhaled at a dose of 20 mg / kg via nasal drops to detect their retention time in the body. Fig. 20 In vitro imaging of major tissues and organs at different time points after intranasal injection of nanoshield in mice. Fig. 20 The left picture represents the heart, liver, spleen, lungs and kidneys from right to left. Fig. 20 The right picture is a graph showing the change in fluorescence intensity of lung tissue at the corresponding time points; after a single inhalation of 1h, 6h, and 8h, the signal of the nanoshield remained stable in the lungs, but starting from 10h, the signal in the lungs gradually weakened and reached a minimum at 12h, indicating that the nanoshield will gradually be metabolized and cleared in the body. This result reveals the amphiphilic polymer pathways in the upper respiratory tract (nose, pharynx, and larynx) and the lower respiratory tract (trachea, bronchi, and lungs). Since there are virus receptors on the surface of nasal mucosa and lung epithelial cells, if the amphiphilic polymer is embedded in the cell surface, it will affect the binding of the virus to the cell surface receptors. Therefore, the nanoshield can block viral infection from multiple sites, including nasal mucosa and lung epithelial cells.

[0121] Experimental Example 21

[0122] Fluorescence labeling and histopathological staining of lung tissue: Same as Experimental Example 5

[0123] Experimental Example 21: Study the protective effect of Nanoshield on H9N2 virus in vivo. Fig.21 This is an experimental result showing that inhalation of nanoshield can protect mice from infection with H9N2 influenza virus. Fig.21 a is an imaging image of lung tissue of a living subject infected with Cy5-labeled H9N2 influenza virus after nasal injection of H9N2 virus 1h, 6h, 8h, 10h or 12h after inhalation of the nanoshield; Fig.21 b is a confocal image of the lung tissue of mice infected with H9N2 influenza virus 8 hours after the mice inhaled nanoshield (scale bar 10 μm); Fig.21 c is the H&E staining image of lung tissue of mice 8 hours after inhalation of nanoshield and 24 hours after infection with H9N2 virus (scale bar 50μm). The control group (control) was injected with PBS only; Fig.21As shown, pre-inhalation of Nanoshield can block the retention of H9N2 virus in the lungs. Confocal imaging showed that Nanoshield reduced the load of H9N2 virus in lung tissue. In addition, HE staining results showed that pre-inhalation of Nanoshield did not cause lung tissue lesions in mice. Therefore, inhalation of Nanoshield can protect mice from infection with H9N2 influenza virus.

[0124] Experimental Example 22

[0125] Lung tissue fluorescent labeling, histopathological staining and immunohistochemistry experiments: Same as Experimental Example 5

[0126] Fig. 22 This is a picture of nano-micelles protecting mice from influenza virus infection in a short period of time. Fig. 22 a is an imaging image of lung tissue of living mice infected with Cy5-labeled H1N1 influenza virus 1h, 6h, 8h, 10h or 12h after intranasal injection of nanomicelles; Fig. 22 b is the virus infection rate of mouse lung tissue at different time points after inhalation of nanomicelles; Fig. 22 c is the antiviral efficiency at different time points of nanomicelle inhalation; Fig. 22 d is a confocal image of the lung tissue of mice infected with H1N1 virus 1 h after inhalation of nanomicelles (scale bar 10 μm); Fig. 22 e is the IHC staining image of nucleoprotein (NP) in lung tissue of mice infected with H1N1 virus 1 hour after inhalation of nanomicelles (scale bar 50 μm); Fig. 22 f is the H&E staining image of lung tissue of mice infected with H1N1 virus 24 hours after inhalation of nano-micelles for 1 hour (scale bar 50 μm); the control group (control) was injected with PBS only; Fig. 22 As shown, nanomicelles can protect mice from influenza virus infection in a short time, and the prevention time of nanoshield on mice is longer than that of nanomicelles, which indicates that nanoshield not only achieves dual prevention effect through external amphiphilic polymers, but also further blocks viral infection through the release of internal drugs.

[0127] Experimental Example 24

[0128] Compare the viscosity values ​​of nanoshields with different chain lengths and concentrations. Fig.24 is a graph of the viscosity values ​​of amphiphilic polymers with different PEG chain lengths and different PEG concentrations. Fig.24 As shown, the viscosity of PEG with a nanoshield concentration of 10-200 μm and a chain length of 20K is the highest, at 1.75 mPa.s.

[0129] Therefore, the present application provides a nanoshield that can effectively prevent influenza A virus infection in the lungs, such as Fig.23As shown, the nanoshield is formed by the self-assembly of (1,2-distearoyl-sn-glycero-3-phosphoacetamide-N-[methoxy(polyethylene glycol) (DSPE-PEG)) amphiphilic polymers, and the influenza preventive antiviral drug Abidol is encapsulated inside. By optimizing the chain length of PEG in the amphiphilic polymer, high viscosity in the respiratory system is screened to physically prevent virus entry. After entering the body fluid system, under the action of body fluid shear force and protein, the nanoshield can be disassembled into DSPE-PEG molecules and release Abidol drugs. Then, DSPE-PEG molecules can be inserted into the surface of epithelial cells through hydrophilic and hydrophobic interactions, and the hydration layer formed by PEG can block the interaction between viruses and cells. At the same time, Abidol can further inhibit the fusion of the viral envelope and the cell membrane and block the release of viral nucleic acids. Therefore, the nanoshield has a triple role in preventing influenza virus infection, which is expected to overcome the limitations of current methods for preventing and treating viral infections and provide an effective method for virus prevention.

[0130] The above description is only a preferred embodiment of the present application and is not intended to limit the present application. Any modifications, equivalent substitutions, etc. made within the spirit and principles of the present application shall be included in the protection scope of the present application.

Claims

1. A nanoshield capable of preventing respiratory viral infection, characterized in that: The nano-shield is a spherical structure formed by self-assembly of a DSPE-PEG amphiphilic polymer with drugs wrapped inside. The DSPE-PEG amphiphilic polymer can be inserted into the surface of epithelial cells to block viruses from entering the surface of epithelial cells. The nano-shield can be disassembled into DSPE-PEG molecules in the body and release the arbidol drug. The released arbidol drug inhibits viral replication, thereby preventing viral infection.

2. The nanoshield according to claim 1, characterized in that: The particle size of the nano shield is 8-40 nm; the viscosity of the nano shield is 1.75 mPa.s.

3. The method for preparing the nanoshield capable of preventing respiratory viral infection according to claims 1-2, characterized in that: DSPE-PEG amphiphilic polymer and arbidol drug were weighed in different mass ratios, dissolved with chloroform, and crushed under ultrasonic conditions at 4°C for 20-30 minutes. After ultrasonic crushing, the chloroform was removed by a rotary evaporator, the resulting solution was dissolved in PBS buffer solution, and the free arbidol drug was removed using a NAP-5 desalting column to obtain a nanoshield.

4. The method for preparing the nanoshield capable of preventing respiratory viral infection according to claim 3, characterized in that: The mass ratio of the DSPE-PEG amphiphilic polymer to the arbidol drug is 400:(1-16); preferably, the mass ratio of the DSPE-PEG amphiphilic polymer to the arbidol drug is 400:

8.

5. The method for preparing the nanoshield capable of preventing respiratory viral infection according to claim 3, characterized in that: The DSPE-PEG amphiphilic polymer is self-assembled in an aqueous solution by using a lipid molecule DSPE as one end of the amphiphilicity and a skeleton PEG as the other end of the amphiphilicity.

6. The method for preparing the nanoshield capable of preventing respiratory viral infection according to claim 5, characterized in that: The molecular weight of the DSPE-PEG amphiphilic polymer is 350-20000; the chain length of the DSPE-PEG amphiphilic polymer is 0.35K-20K; preferably, the concentration of the DSPE-PEG amphiphilic polymer is 10 μM-200 μM.

7. The nanoshield prepared by the preparation method according to any one of claims 3 to 6, characterized in that: The nanoshield prevents viral infection by blocking the entry of viruses into the epithelial cell surface and inhibiting viral replication.

8. The use of the nanoshield according to claims 1-2 in preventing respiratory viral infection, characterized in that: The nano shield is used to prevent viral infection.

9. The drug for preventing respiratory viral infection prepared by the nanoshield according to claims 1-2, characterized in that: The medicine for preventing respiratory viral infection includes nasal drop spray, injection, oral preparation and granule containing the nano shield.

Images