Monoclonal antibody hybridoma cell strain for resisting novel duck reovirus, monoclonal antibody, reagent or kit and application

Abstract

The invention provides an anti-novel duck reovirus monoclonal antibody hybridoma cell strain, a monoclonal antibody, a reagent or a kit and application, and belongs to the technical field of novel duck reovirus detection. The monoclonal antibody hybridoma cell strain capable of resisting the novel duck reovirus is named as a hybridoma cell strain NDRV Mab-Sigma C-9, and the preservation number of the hybridoma cell strain NDRV Mab-Sigma C-9 is CCTCC (China Center for Type Culture Collection) NO: C2024284. An indirect immunofluorescence kit prepared from the monoclonal antibody secreted by the monoclonal antibody hybridoma cell strain for resisting the novel duck reovirus has good specificity and sensitivity. The kit not only can be used for detecting exogenous viruses of the NDRV in poultry virus live vaccines, but also can be used for clinical detection and epidemiological investigation of the NDRV.

Description

Technical Field

[0001] The invention belongs to the technical field of novel duck reovirus detection, and in particular relates to a monoclonal antibody hybridoma cell line, a monoclonal antibody, a reagent or a kit and an application thereof against the novel duck reovirus. Background Art

[0002] Novel duck reovirus disease is a new epidemic disease that has affected the duck farming industry in recent years. The disease mainly infects ducklings of various species, with spleen hemorrhage and necrosis as the main pathological features, and can cause immunosuppression and growth disorders, and is prone to secondary bacterial infection, resulting in weight loss of meat ducks, a significant decrease in the qualified rate of marketed ducks, and a decrease in the egg production rate of breeder ducks and the hatching rate of hatching eggs, causing serious economic losses to the duck farming industry. The disease is caused by novel duck reovirus (NDRV), which belongs to the genus Orthoreovirus of the family Reoviridae and is a segmented double-stranded RNA virus. It is different from the previously popular classic Muscovy duck reovirus (MDRV) in terms of serum, and there is currently no commercial vaccine or effective drug.

[0003] NDRV cannot agglutinate the red blood cells of chickens, ducks, geese, sheep, mice, and rabbits, but can proliferate in a variety of cells such as baby hamster kidney cells (BHK-21), chicken embryo fibroblasts (CEF), and chicken liver cancer cells (LMH), leading to cell lesions such as macrofusion and rounding. The total genome size of NDRV is 23.5kb, containing 10 fragments, 3 long fragments (L1, L2, L3), 3 medium fragments (M1, M2, M3) and 4 small fragments (S1, S2, S3, S4). The S1 gene is the largest gene in the small fragment genome, with the lowest homology with ARV and MDRV. It is the most important gene to distinguish between ARV and MDRV, and is one of the genes closely related to NDRV infection, pathogenicity, and immune protection.

[0004] There are many studies on the detection methods of NDRV, such as etiological detection methods, immunological detection methods and molecular biological detection methods, and the sensitivity of different detection methods also varies. Including agar diffusion test, serum neutralization test, enzyme-linked immunosorbent assay (ELISA), PCR method, fluorescent quantitative RT-PCR method, etc. However, the above methods all have disadvantages, such as the disadvantage of low sensitivity in agar diffusion test, the disadvantage of time-consuming and labor-intensive in neutralization test, and the problem of high time-consuming and costly in NDRV ELISA antibody detection. The basis for using ELISA to detect NDRV is to obtain monoclonal antibodies with high specificity and high sensitivity to NDRV. Therefore, there is an urgent need for a highly specific and highly sensitive anti-novel duck reovirus monoclonal antibody hybridoma cell line to achieve high-sensitivity detection of novel duck reovirus, and to establish a stable and efficient IFA method for detecting NDRV for quality detection of live poultry vaccines and diagnosis of NDRV diseases. Summary of the invention

[0005] In view of this, the purpose of the present invention is to provide a monoclonal antibody hybridoma cell line, monoclonal antibody, reagent or kit and application against the novel duck reovirus. The monoclonal antibody against the novel duck reovirus secreted by the hybridoma cell line has good specificity and sensitivity in detecting the novel duck reovirus.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The invention provides a novel duck reovirus monoclonal antibody hybridoma cell strain. The novel duck reovirus monoclonal antibody hybridoma cell strain is named as hybridoma cell strain NDRV Mab-Sigma C-9, and the deposit number of the hybridoma cell strain NDRV Mab-Sigma C-9 is CCTCCNO: C2024284.

[0008] The invention provides a monoclonal antibody against a novel duck reovirus, wherein the monoclonal antibody is obtained by secretion of the monoclonal antibody hybridoma cell strain against the novel duck reovirus or a passaged monoclonal antibody hybridoma cell strain thereof.

[0009] The invention provides a reagent or a kit for detecting a novel duck reovirus, comprising the above-mentioned monoclonal antibody.

[0010] The invention provides an indirect immunofluorescence kit, which comprises the above-mentioned monoclonal antibody and a goat anti-mouse antibody labeled with fluorescein.

[0011] Preferably, the fluorescein comprises FITC.

[0012] Preferably, the kit further comprises a sample diluent and a sample washing solution.

[0013] Preferably, the sample diluent comprises a 9-11 mM phosphate buffer having a pH value of 7.0-7.4; and the sample washing solution comprises a 9-11 mM phosphate buffer having a pH value of 7.0-7.4.

[0014] The present invention provides an application of the above-mentioned monoclonal antibody hybridoma cell line, monoclonal antibody, reagent or kit or indirect immunofluorescence kit against novel duck reovirus in detecting the safety of live avian virus vaccines.

[0015] The present invention provides an application of the above-mentioned monoclonal antibody hybridoma cell line or monoclonal antibody against novel duck reovirus in preparing a product for detecting novel duck reovirus.

[0016] Preferably, the product comprises a reagent or a kit.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] The present invention provides a monoclonal antibody hybridoma cell line against a novel duck reovirus, a monoclonal antibody, a reagent or a kit and an application thereof. The monoclonal antibody secreted by the monoclonal antibody hybridoma cell line against a novel duck reovirus of the present invention can simultaneously identify different strains of NDRV, and does not cross-react with viruses such as chicken egg drop syndrome virus, avian leukosis virus, infectious laryngotracheitis virus, avian reovirus, and Muscovy duck reovirus. The minimum detection limit of the novel duck reovirus detected by the monoclonal antibody is 10TCID 50 Therefore, the indirect immunofluorescence kit prepared by using the monoclonal antibody secreted by the hybridoma cell line of the anti-novel duck reovirus monoclonal antibody of the present invention has good specificity and sensitivity. The kit can be used not only for the detection of exogenous viruses of NDRV in avian virus live vaccines, but also for clinical detection and epidemiological investigation of NDRV.

[0019] Biological Deposit Certificate

[0020] The anti-novel duck reovirus monoclonal antibody hybridoma cell line is named hybridoma cell line NDRVMab-Sigma C-9, which was deposited in the China Center for Type Culture Collection (CCTCC) on August 26, 2024, with a deposit number of CCTCC NO: C2024284. The address of the deposit unit is: Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1This is a graph of the small-scale expression of Sigma-C protein, where 1 is the marker; 2 is the result of inducing the expression of Sigma-C protein;

[0022] Figure 2 The diagram shows the massive expression of Sigma-C protein. 1 is the marker; 2 is the expression result of Sigma-C protein in the supernatant after ultrasonic centrifugation; 3 is the expression result of Sigma-C protein in the precipitate after ultrasonic centrifugation;

[0023] Figure 3 The figure is a protein purification diagram of Sigma-C protein in Example 1, 1 is a marker; 2-3 are SDS-PAGE electrophoresis diagrams of the purified Sigma-C protein;

[0024] Figure 4 This is a graph showing the specific detection results of the indirect immunofluorescence kit for NDRV virus GX2022 strain in Example 3;

[0025] Figure 5 This is a graph showing the specific detection results of NDRV (RPVA1301-Z strain) using the indirect immunofluorescence kit in Example 3;

[0026] Figure 6 This is a graph showing the specific detection results of EDSV (127 strains) using the indirect immunofluorescence kit in Example 3;

[0027] Figure 7 This is a graph showing the specific detection result of ALV (RAV-1 strain) by the indirect immunofluorescence kit of Example 3;

[0028] Figure 8 This is a graph showing the specific detection result of ILTV (ILT / 13 strain) by the indirect immunofluorescence kit in Example 3;

[0029] Fig. 9 This is a graph showing the specific detection results of ARV (Reo1133 strain) using the indirect immunofluorescence kit in Example 3. DETAILED DESCRIPTION

[0030] The invention provides a novel duck reovirus monoclonal antibody hybridoma cell strain. The novel duck reovirus monoclonal antibody hybridoma cell strain is named as hybridoma cell strain NDRV Mab-Sigma C-9, and the deposit number of the hybridoma cell strain NDRV Mab-Sigma C-9 is CCTCCNO: C2024284.

[0031] In the present invention, the monoclonal antibody hybridoma cell strain against the novel duck reovirus is prepared based on Sigma-C protein. Sigma-C protein is an important immunogenic protein of NDRV and is highly conserved between different strains of NDRV. The screening method of the monoclonal antibody hybridoma cell strain against the novel duck reovirus preferably includes: constructing a recombinant expression plasmid with the coding gene of the novel duck reovirus Sigma-C protein to obtain Sigma-C protein; immunizing mice with the Sigma-C protein to obtain an immunized mouse spleen cell suspension; fusing the immunized mouse spleen cell suspension with SP2 / 0 cells, culturing and screening to obtain a hybridoma cell strain.

[0032] The present invention constructs a recombinant expression plasmid with the coding gene of the novel duck reovirus Sigma-C protein to obtain the Sigma-C protein. In the present invention, the nucleotide sequence of the recombinant epitope of the novel duck reovirus Sigma-C protein is shown in SEQ ID NO: 1. The original vector used in the construction of the recombinant expression plasmid of the present invention includes pET30a. The present invention preferably obtains a first enzyme digestion product after the coding gene of the Sigma-C protein is recombined with the gene sequence of the enzyme cutting sites BamHI and XhoI, and then digested with restriction endonucleases BamHI and XhoI, purified and recovered; preferably, the original vector pET30a is digested with restriction endonucleases BamHI and XhoI to obtain a second enzyme digestion product; the present invention preferably obtains a recombinant expression plasmid after the first enzyme digestion product and the second enzyme digestion product are connected with DNA Ligation Kit.

[0033] After obtaining the recombinant expression plasmid, the present invention preferably transforms the recombinant expression plasmid into the BL21 strain for induced expression to obtain an expression product; the expression product is purified to obtain the Sigma-C protein. The present invention has no special limitation on the method for purifying the expression product, and a conventional method can be used. The concentration of the Sigma-C protein prepared by the present invention is greater than 0.5 mg / mL, and the purity is greater than 85%, and can be used as an immunogen for the preparation of a novel duck reovirus monoclonal antibody. In the present invention, the novel duck reovirus Sigma-C protein is an immunogen, and the nucleotide sequence length of the gene encoding the novel duck reovirus Sigma-C protein is 963 bp, which is highly conservative, thereby improving the sensitivity of the indirect immunofluorescence kit for detecting the novel duck reovirus.

[0034] After obtaining the Sigma-C protein, the present invention immunizes mice with the Sigma-C protein to obtain an immunized mouse spleen cell suspension. The Sigma-C protein of the present invention is preferably emulsified with Freund's complete adjuvant to immunize mice. The immunization of mice of the present invention preferably includes sequentially performing primary immunization, secondary immunization, tertiary immunization, fourth immunization and shock immunization on mice. The dosage of the Sigma-C protein immunized mice of the present invention is preferably 55-65 μg per mouse, more preferably 60 μg. In the present invention, the time interval between the primary immunization, the second immunization, the third immunization and the fourth immunization is preferably 14d, and the time interval between shock immunization and cell fusion is preferably 3-5d, more preferably 3d. The shock immunization of the present invention is preferably intraperitoneal injection of the immunogen Sigma-C protein.

[0035] After obtaining the immunized mice, the present invention separates spleen cells from the immunized mice to prepare a spleen cell suspension. The present invention fuses the spleen cell suspension of the immunized mice with myeloma cells (SP2 / 0 cells) to obtain fused cells. The ratio of the number of cells of the spleen cell suspension and myeloma cells described in the present invention is (1-2): (1-2), more preferably 1:1. The present invention preferably uses the 50% PEG method for fusion. The setting of the ratio of the number of cells of the spleen cell suspension and myeloma cells during the fusion described in the present invention can improve the efficiency of cell fusion.

[0036] After obtaining the fusion cells, the present invention cultured and screened the fusion cells to obtain hybridoma cell strains. The fusion cells of the present invention are preferably cultured in HAT culture medium and then screened using ELISA plates for hybridoma cell strains that secrete monoclonal antibodies against the novel duck reovirus. After obtaining the hybridoma cell strains that secrete monoclonal antibodies against the novel duck reovirus, the present invention preferably uses indirect immunofluorescence detection to screen and obtain hybridoma cell strains that secrete monoclonal antibodies against the novel duck reovirus that have good reactivity with the whole virus of different strains of NDRV. The present invention preferably secretes hybridoma cell strains that have good reactivity with the whole virus of different strains of NDRV for subcloning culture and freezing.

[0037] The invention provides a monoclonal antibody against a novel duck reovirus, wherein the monoclonal antibody is obtained by secretion of the monoclonal antibody hybridoma cell strain against the novel duck reovirus or a passaged monoclonal antibody hybridoma cell strain thereof.

[0038] The invention provides a reagent or a kit for detecting a novel duck reovirus, comprising the above-mentioned monoclonal antibody.

[0039] After obtaining the hybridoma cell line, the present invention preferably uses the hybridoma cell line to inject into the peritoneal cavity of mice, collects ascites, and uses Protein-A affinity purification to obtain NDRV monoclonal antibodies. The monoclonal antibody secreted by the hybridoma cell line NDRVMab-Sigma C-1 of the present invention has the highest titer.

[0040] The invention provides an indirect immunofluorescence kit, which comprises the above-mentioned monoclonal antibody and a goat anti-mouse antibody labeled with fluorescein.

[0041] In the present invention, the fluorescein includes FITC. There is no special limitation on the source of the FITC-labeled goat anti-mouse antibody, and conventional products can be used. In an embodiment of the present invention, the FITC-labeled goat anti-mouse antibody is preferably purchased from Sigma. The kit also includes a sample diluent and a sample washing solution. The sample diluent includes a 9-11mM phosphate buffer with a pH value of 7.0-7.4, and more preferably a 10mM phosphate buffer with a pH value of 7.2; the sample washing solution includes a 9-11mM phosphate buffer with a pH value of 7.0-7.4, and more preferably a 10mM phosphate buffer with a pH value of 7.2.

[0042] In the present invention, the indirect immunofluorescence kit has a minimum detection limit of 10TCID50 for detecting novel duck reovirus samples. In the present invention, the monoclonal antibody against novel duck reovirus simultaneously recognizes different strains of NDRV, and does not cross-react with viruses such as egg drop syndrome virus, avian leukosis virus, infectious laryngotracheitis virus, avian orthoreovirus, and Muscovy duck reovirus, and has good specificity.

[0043] The present invention provides an application of the above-mentioned monoclonal antibody hybridoma cell line, monoclonal antibody, reagent or kit or indirect immunofluorescence kit against novel duck reovirus in detecting the safety of live avian virus vaccines.

[0044] The present invention provides an application of the above-mentioned monoclonal antibody hybridoma cell line or monoclonal antibody against novel duck reovirus in preparing a product for detecting novel duck reovirus.

[0045] In the present invention, the product includes a reagent or a kit.

[0046] In the present invention, unless otherwise specified, all raw material components are commercially available products well known to those skilled in the art.

[0047] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0048] Example 1 Preparation of anti-novel duck reovirus monoclonal antibody hybridoma cell line

[0049] 1.1 NDRV Sigma-C protein sequence analysis

[0050] Different NDRV strains have only one serotype. The reference sequences of different NDRV strains were downloaded from NCBI. Through analysis, it was found that the Sigma-C protein has a high homology in different strains and can be used as an alternative fragment for protein expression. According to the secondary structure analysis and antigenicity of the protein sequence, the Sigma-C protein was selected as the immunogen. According to the protein structure analysis, the nucleotide fragment (963bp) of the full-length Sigma-C protein was selected for sequence synthesis, and the sequence after adding the restriction site was synthesized at Beijing Liuhe BGI Protein Research and Development Center Co., Ltd. to obtain the NDRV Sigma-C protein recombinant epitope sequence (SEQ ID NO: 1).

[0051] The nucleotide sequence of the recombinant epitope of NDRV Sigma-C protein is as follows:

[0052] GGATCC ATGGACCGTAACGAAGTAATCCGTCTGATTCTGTCTCTGCTG

[0053] CCGTACCAGTCTTCTGACGTAGACCACCTGACCACTCAGATCAAATCTCTG

[0054] CAAAGCGCAGTTGACTCTCTGAAAGAATCTCAGGTTGTTGTTCTGCGTCGT

[0055] CTGACCACTATCACCTCTACCGTTGCTGACCTTCAGTCCACTACCGAACTG

[0056] CTGACTTCTCAGGTAGCGGGTCTGTCTAGCCGTGTTGCTTCTGTTACCGAC

[0057] GAAGTTGTGCGTGTTGATTCTGTGATCGGTTCCACCATCACCAACCTGGAC

[0058] AACGTACGTTCTGAACTGTCCAGCCTGTCTTCTCAGGTTTCTAGCCAGACC

[0059] TCTACCTTGACCAACCTGACCTCCACCGTTAGCTCTCAGTCTCTGTCTATCT

[0060] CCGACCTTCAGCAGCGTGTTACCGCGCTGGAACGTTCTGGTGGTGTACTG

[0061] ACTCGTTTCGAAGCGCCGCTGCAACTCCAGAACGGTGTTGTTTCTCTTCAG

[0062] GCTTCTCCGTCTTTCTGCTCTCTGAGCCCGATCTTGTCTGGTCCGACCGAC

[0063] GCGGCTGTGTTCAAAGTGGGCGAATGGCTGGGCACCGTTATCTCCGGTCA

[0064] GTCTCAGTCTAGCGCTATCATGAACGTTCGTATCCACTCTTTCGGTCAGCGT

[0065] ACCATGCTGCTGATGAGCTCTCAGAACGTGTTCACTATCCCGCCAGGTTCT

[0066] GGTGCGTCTCTGCAACTGGATGTTAACCGTATCACTACTCCGGCTATCGAC

[0067] GTTGCTATGGTTACTCCATCCGCTGCGTTCGCATCTGCGAGCTTCATGGCGG

[0068] ACATCGCTTTCAAAGACAGCAAAACTGGCGAAGTTCACGCGCTGCACACT

[0069] ACCGGTAGCTTCCGTTCTCCAAGTTTCTCCATCGCATGGGTTCCGGTTGCG

[0070] TCTGAAACTCGTAACTACCAGATCATGGCGTTGCGTTTCACCGTTGCTACC

[0071] GGT CTCGAG (SEQ ID NO:1).

[0072] Note: The sequences marked with underlines are the sequence information after adding BamHI and XhoI restriction sites.

[0073] 1.2 Construction and purification of recombinant expression plasmid

[0074] Ⅰ. Construction of recombinant expression plasmid vector

[0075] The restriction endonucleases BamHI and XhoI were used to double-digest SEQ ID NO: 1 and the plasmid expression vector pET30a after adding the restriction sites BamHI and XhoI, respectively. The purified and recovered Sigma-C protein nucleotide fragment and the restriction product of the expression vector pET30a were connected with DNA Ligation Kit and transformed into competent cells (BL21).

[0076] II. Small-scale expression of recombinant proteins

[0077] Pick the BL21 obtained in step I that is positive by PCR, clone the BL21 into 1.5 mL of LB liquid medium containing kanamycin resistance, and culture at 37°C and 200 r / min. Culture until OD 600 The value is 0.6-0.8. The mass concentration of kanamycin in LB liquid culture medium is 50μg / mL. Add IPTG to the bacterial solution obtained by accurate culture for induction. The final concentration of IPTG in the bacterial solution obtained by culture is 0.5mM, the induction temperature is 37°C, the induction speed is 200r / min, and the induction time is 2h. Take 1mL of the induced bacterial solution, centrifuge it at a speed of 12000r / min for 1min, discard the supernatant, blow off the precipitate with pH 8.0100μL Tris-HCl buffer, add 2× loading buffer with the same volume as the buffer, keep it at a temperature of 100°C for 5min, and then perform electrophoresis detection. The electrophoresis detection results are shown in Figure 1 .

[0078] according to Figure 1 It can be seen that a specific target band of the recombinant Sigma-C protein appeared at a size of about 38KD, indicating that the Sigma-C protein was successfully expressed.

[0079] III. Large-scale expression of recombinant proteins

[0080] (1) Culture and IPTG induction

[0081] The BL21 obtained in step I was identified by PCR, and the positive BL21 was cultured. The BL21 cultured was transferred to 250 mL of kanamycin-resistant LB liquid culture medium at a volume ratio of 1:50, and the culture was shaken at a temperature of 37°C and a speed of 200 r / min. The mass concentration of kanamycin in the LB liquid culture medium is 50 μg / mL. The LB liquid culture medium was cultured to an OD of 600After the value reaches 0.6-0.8, IPTG is added to the LB liquid medium obtained by shaking culture for induction. The final concentration of IPTG in the LB liquid medium obtained by culture is 0.5mM, the induction temperature is 37°C, and the induction time is 3h. The induced product is centrifuged to collect bacteria, the centrifugal speed is 8000r / min, and the centrifugal time is 6min. After centrifugation, the supernatant is discarded to obtain the bacterial precipitate, and the obtained bacteria are ultrasonically broken. The specific process of ultrasonic breaking is: the obtained bacterial precipitate is blown away with 20-30mL 10mM Tris-HCl (pH8.0) buffer solution to obtain the bacterial suspension for ultrasonic breaking (power 500W, 180 times, 5s each time, interval 5s).

[0082] (2) Electrophoresis detection

[0083] After the ultrasonic disruption was completed, 100 μL of the bacterial suspension after ultrasonication was taken and centrifuged at a speed of 12000 r / min for 10 min. After centrifugation, 50 μL of the supernatant and the obtained precipitate were retained. The obtained precipitate was blown off with 50 μL of 10 mM Tris-HCl (pH 8.0) buffer solution. The retained supernatant and the solution obtained after the precipitate was blown off were respectively taken for SDS-PAGE detection. The results are shown in Figure 2 .

[0084] Figure 2 The results showed that a large amount of target protein was detected in the precipitate, indicating that the expression form of the recombinant bacteria was inclusion body expression.

[0085] (3) Purification of recombinant protein

[0086] The Sigma-C protein expressed in the bacterial precipitate in step (2) was purified as follows: 20 mL 10 mM Tris-HCl (pH 8.0) solution was used to resuspend the precipitate obtained by ultrasonic centrifugation in step (2), and the mixture was allowed to stand for 10 min; the mixture was centrifuged at 12000 r / min for 10 min, and the supernatant was transferred to another tube for storage. For the precipitate, 20 mL 10 mM Tris-HCl (pH 8.0) solution was used to resuspend the precipitate obtained by centrifugation, and the mixture was allowed to stand for 10 min; the mixture was centrifuged at 12000 r / min for 10 min, and the supernatant was discarded to obtain the first precipitate. Repeat the above resuspension and centrifugation steps once for the first precipitate obtained to obtain a second precipitate; first add a small amount of 10mM Tris-HCl (pH8.0) solution to the second precipitate to resuspend the precipitate, then add 5mL of 10mM Tris-HCl (pH8.0) solution containing 8M urea to dissolve the protein, centrifuge at 12000r / min for 10min, collect the supernatant, and take 50μL sample for SDS-PAGE electrophoresis detection ( Figure 3 ).

[0087] Figure 3The results showed that the purified protein concentration was estimated to be >0.5 mg / mL and the purity was >85% by SDS-PAGE gel scanning analysis using BSA (bovine serum albumin) as the standard, and was named NDRV-Sigma-C.

[0088] 1.3 Preparation of monoclonal antibodies

[0089] 1.3.1 Immunization of mice

[0090] After emulsifying the purified NDRV-Sigma-C protein prepared in step 1.2 with Freund's complete adjuvant at a volume ratio of 1:1, 4 SPF BALB / c female mice were subcutaneously injected with 60 μg of purified NDRV-Sigma-C protein per mouse (i.e., the first immunization). At 2 weeks, 4 weeks, and 6 weeks after the first immunization, subcutaneous injections were given to boost immunizations, with an immunization dose of 30 μg of purified NDRV-Sigma-C protein per mouse. The interval between the first immunization and the first booster immunization was 14 days, the interval between the first booster immunization and the second booster immunization was 14 days, and the interval between the second booster immunization and the third booster immunization was 14 days. 10 days after the third booster immunization, blood was collected from the orbits and the serum titer was measured by indirect ELISA. Mice with high serum titer (ELISA antibody titer of 1:102400) were selected and immunized once with 50 μg of the immunogen (NDRV-Sigma-C purified protein) by intraperitoneal injection. Cell fusion was performed 3 days after immunization.

[0091] 1.3.2 Cell fusion experiment

[0092] Aseptically take the spleen of the mouse immunized in step 1.3.1, prepare a spleen cell suspension, and take an equal volume of the immune spleen cell suspension and SP2 / 0 cells for cell fusion. The cell fusion adopts the conventional 50% PEG method. The cells after cell fusion are divided into 5 96-well plates and selectively cultured with HAT culture medium (purchased from Sigma).

[0093] 1.3.3 Cloning and screening of hybridoma cells

[0094] The culture in the above 96-well plate was screened by ELISA plate coated with NDRV-Sigma-C protein and His tag protein. The screening method is as follows:

[0095] (1) Coating ELISA plate. Dilute the purified NDRV-Sigma-C protein in step 1.2 with sodium carbonate-sodium bicarbonate buffer at pH 9.6 to a final concentration of 2 μg / mL. Add 100 μL of the diluted purified NDRV-Sigma-C protein solution to each well of the ELISA plate and incubate overnight at 4°C; then wash three times with PBST (PBS buffer containing 0.05% Tween-20).

[0096] (2) Blocking: After coating the ELISA plate, block it with PBS buffer containing 2% milk at a mass concentration of 200 μL / well, incubate at 37°C for 2 h, and then wash it three times with PBST (PBS containing 0.05% Tween-20).

[0097] (3) Incubation with primary antibody. After blocking, add the hybridoma cell culture supernatant obtained after cell fusion in step 1.3.2 (treatment group), negative control (SP2 / 0 culture supernatant), blank control (PBS buffer), and positive control (NDRV positive serum diluted 1000 times with PBS buffer) as primary antibodies, all at 100 μL / well, incubate at 37°C for 1 h.

[0098] (4) Washing: After incubation with the primary antibody, wash the ELISA plate prepared in step (3) with PBST (PBS containing 0.05% Tween-20) for a total of 3 times.

[0099] (5) Incubation with secondary antibody: After washing, goat anti-mouse IgG / HRP diluted 20,000 times with PBS buffer was added to the ELISA plate as a secondary antibody at 100 μL / well and incubated at 37°C for 1 h.

[0100] (6) Washing: Wash three times with PBST (PBS containing 0.05% Tween-20).

[0101] (7) Color development. Add 100 μL / well of color development solution (citrate buffer containing 1% solution A and 10% solution B, solution A: TMB prepared with DMSO to a 1% mass concentration; solution B: H2O2 aqueous solution with a mass concentration of 0.1%), and the color development time is about 5 min.

[0102] (8) Add 50 μL of stop solution (containing 2 M sulfuric acid) to each well to stop the reaction.

[0103] (9) Readings. Measure the absorbance at dual wavelengths (450nm, 630nm) and record the data.

[0104] After testing, three ELISA-positive hybridoma cell lines, No. 9, No. 19, and No. 32, were screened for further screening. The test results are shown in Table 1. High absorbance values ​​for the target protein and low absorbance values ​​for the tag protein indicate that the hybridoma cell line has a high titer.

[0105] According to Table 1, hybridoma cell line No. 9 has the highest titer and is named hybridoma cell line NDRV MabSigma C-9, with a deposit number of CCTCC NO: C2024284.

[0106] Table 1 ELISA screening results of hybridoma cell lines

[0107]

[0108] Example 2 Preparation of monoclonal antibodies against novel duck reovirus

[0109] 2.1 Indirect immunofluorescence assay (IFA)

[0110] The supernatants of the three positive hybridoma cell lines (No. 9, No. 19 and No. 32) obtained by ELISA screening in step 1.3.3 of Example 1 were respectively used as primary antibodies, and a cell line with good reactivity to the whole virus of different strains of NDRV was screened by indirect immunofluorescence method. The cell line was named NDRV Sigma-C protein hybridoma cell Mab-Sigma C-9. The cell line positive for immunofluorescence detection was selected and subcloned by limiting dilution method until the cell clone antibody positive rate reached 100%. The positive cell line with a positive rate of 100% after the above subcloning was expanded and cultured and stored in liquid nitrogen. The indirect immunofluorescence detection method is as follows:

[0111] (1) Preparation of positive virus plates. Virus solutions of different NDRV strains (see Table 2) were diluted to 100 TCID 50 / 0.1mL, inoculate a 96-well plate with a well-grown chicken liver cancer cell monolayer. Inoculate 4 wells with each strain in Table 2, 100μL / well. At the same time, set up a blank control of chicken liver cancer cells, and inoculate the control virus in Table 2 with an accurate blank control of chicken liver cancer cells. The control virus solution was diluted to 100TCID with DF12 culture medium containing 2% newborn calf serum. 50 / 0.1mL, each strain was inoculated into 4 wells, 100μL / well, and then placed in an incubator at 37°C with 5% CO2 for 5 days, and then fluorescent staining was performed.

[0112] Table 2 Information of different NDRV strains and control strains

[0113]

[0114] The above virus strains with numbers beginning with AV are from the National Center for Veterinary Microbiology and Virus Collection (China Veterinary Drug Administration); those with numbers beginning with C are from the China Center for Type Culture Collection (Wuhan University); the new duck reovirus (RPVA1301-Z strain) strain was published in the article: "Study on the Effect of Refined Yolk Antibodies on New Duck Reovirus", Chinese Journal of Animal Husbandry and Veterinary Medicine, 2021(10): 16-19.

[0115] (2) Dyeing

[0116] ① Fixation. After the positive virus plate is prepared, discard the cell culture medium in the 96-well plate, add about 250 μL of DF12 culture medium containing 2% newborn calf serum to each well, gently wash the cell surface once, discard the DF12 culture medium as much as possible, then add 100 μL of cold methanol to each well, fix at room temperature for 10 to 15 minutes, discard the methanol, and dry naturally for 5 minutes.

[0117] ②Add primary antibody (monoclonal antibody). Wash the cell surface once with PBS buffer (pH 7.2), dilute the supernatant of the hybridoma cell line producing monoclonal antibodies to be tested 10 times with PBS buffer, add to the NDRV virus-positive cell plate (washed once with PBS before use), 50 μL per well, and incubate at 37°C in the dark for 1 hour.

[0118] ③ Washing. Discard the monoclonal antibody in the wells and wash with PBS buffer for 5 times, adding 0.3 mL of BS buffer to each well each time and washing with slight shaking.

[0119] ④ Fluorescent secondary antibody staining. Discard the washing solution as much as possible, add 50 μL of fluorescently labeled goat anti-mouse IgG diluted appropriately (1:100-1:200) with PBS buffer to each well, and incubate at 37°C in the dark for 1 hour.

[0120] ⑤Washing. The method is the same as ③.

[0121] ⑥Observation and result determination. Observe with blue excitation light (wavelength 490nm) under a fluorescent inverted microscope, and the cells have complete cell morphology. When specific green fluorescence appears in the field of view of the inoculated well, when magnified to 200-400 times, the nucleus and cytoplasm of the infected cells are stained, the NDRV test of the well is determined to be positive. When no specific green fluorescence appears in the inoculated well, the field of view is dark, proving that the cells are not infected, and the NDRV test of the well is determined to be negative.

[0122] 2.2 Identification of hybridoma cells

[0123] (1) Culture characteristics

[0124] Use DF12 culture medium containing 10% to 15% fetal bovine serum, culture in a 37°C, 5% CO2 incubator, and examine the cell morphology of the hybridoma cell strain under a microscope. The morphology of the hybridoma cells should be consistent. The consistent morphology of the hybridoma cells indicates that the hybridoma cells are in good condition.

[0125] (2) Purity test

[0126] Sterility test, mycoplasma test and exogenous virus test were carried out according to the appendix methods of the current "Chinese Pharmacopoeia of Veterinary Medicine" (compiled by the Chinese Pharmacopoeia Committee, Pharmacopoeia of Veterinary Medicine of the People's Republic of China, 2020 edition, China Agriculture Press, 2020, referred to as "Chinese Pharmacopoeia" in this invention), and the results were in compliance with the regulations.

[0127] (3) Cytological examination

[0128] The chromosome number of hybridoma cells cultured for 24 hours was examined by colchicine method to observe whether the chromosome characteristics were consistent with the staining characteristics of hybridoma cells. The results were in line with expectations.

[0129] (4) Preparation of ascites. 8- to 10-week-old BALB / C mice were intraperitoneally injected with 0.5 mL of pristane per mouse. Ten days later, the mice were intraperitoneally injected with the hybridoma cell line NDRVMab Sigma C-919×10 6 After 10 days, observe the state of the mice. When the abdomen of the mice is obviously swollen and the mice have difficulty in moving, extract the ascites of the mice. Centrifuge the ascites at a speed of 3000r / min for 10min, take the supernatant, and store it at -40℃. If ascites occurs again after an interval of 2 to 3 days, it can be collected again. This ascites is purified by Protein-A affinity to obtain mouse anti-NDRV monoclonal antibody.

[0130] (5) Ascites titer determination

[0131] The ascites of each monoclonal antibody was diluted from 1:100 to 1:102400, and the fluorescent antibody titer of the ascites was measured according to "2.1 Indirect Immunofluorescence Detection Method" of this example to be 1:2000.

[0132] Example 3 Assembly and application of indirect immunofluorescence kit for detecting NDRV

[0133] The kit components are the anti-NDRV monoclonal antibody prepared in Example 2, commercial FITC-labeled goat anti-mouse antibody (purchased from Sigma, item number F9006), sample diluent and washing solution; the sample diluent and washing solution are both 10mM pH 7.2 phosphate buffer (PBS).

[0134] The steps and criteria for detecting the novel duck reovirus using this kit are as follows:

[0135] 1. Inoculation of samples to be tested

[0136] 100 μL of the sample to be tested was inoculated into a monolayer of primary chicken bursal cells covering a 96-well plate, incubated at 37°C for 1 hour, and then 100 μL of DF12 culture medium containing 3% bovine serum was added to each well and cultured at 37°C for 5 days.

[0137] 2. Fluorescence staining and result determination

[0138] (1) Fixation. Discard the cell culture medium in the 96-well plate, add about 0.3 mL of PBS buffer (pH 7.2) to each well and gently wash the cell surface once, discard as much PBS as possible, then add 0.2 mL of cold methanol to each well, fix at room temperature for 15 min, discard the methanol, and let it dry naturally for 5 min.

[0139] (2) Adding primary antibody. After natural drying, wash the cell surface once with PBS buffer (pH 7.2), then add 50 μL of NDRV monoclonal antibody diluted 1:200 with PBS buffer (pH 7.2-7.4) to each well and incubate at 37°C for 1 h.

[0140] (3) Washing. Discard the NDRV monoclonal antibody and wash five times with PBS buffer (pH 7.2), adding 0.3 mL of washing solution to each well each time and gently shaking the wells for washing.

[0141] (4) Fluorescent secondary antibody staining. Discard the washing solution as much as possible, add 50 μL of FITC-labeled goat anti-mouse IgG diluted 1:1000 in PBS buffer (pH 7.2-7.4) to each well, and incubate at 37°C for 1 h.

[0142] (5) Washing: The method is the same as (3).

[0143] (6) Observation and judgment. When observed under a fluorescent inverted microscope with blue excitation light (wavelength 490nm), the cells have complete cell morphology. When specific green fluorescence appears in the field of view of the inoculated well and the nucleus and cytoplasm of the infected cells are stained when magnified to 200-400 times, the NDRV test of the well is judged to be positive. When the specific green fluorescence does not appear in the inoculated well, the field of view is dark, proving that the cells are not infected, and the NDRV test of the well is judged to be negative.

[0144] Example 4

[0145] 1. Specificity test of the kit

[0146] The detection was performed according to the steps and criteria for detecting the novel duck reovirus in "1. Inoculation of samples to be detected" and "2. Fluorescence staining and result determination" in Example 3. The indirect immunofluorescence kit of Example 3 was used to detect different NDRV strains, egg drop syndrome virus (EDSV), avian leukosis virus (ALV), infectious laryngotracheitis virus (ILTV), avian reovirus (ARV) and Muscovy duck reovirus (MDRV) in Table 2, and the staining of cells infected with the virus was observed to determine the specificity of the indirect immunofluorescence method.

[0147] Figures 4 to 9 The test results show that the present invention can specifically identify and detect different NDRV strains using anti-NDRV monoclonal antibodies (see Figure 4-5 ) were positive, and compared with EDSV (see Figure 6 )、ALV(see Figure 7 ), ILTV (see Figure 8 ) and ARV (see Fig. 9 ) reactions were all negative, demonstrating that the kit established with the anti-NDRV monoclonal antibody of the present invention has good specificity for detecting NDRV, and the indirect immunofluorescence kit can be applied to the specific detection of NDRV.

[0148] 2. Sensitivity test of the kit

[0149] Dilute NDRV (GX2022 strain) to 100 TCID 50 / 80μL, based on this, double dilution to 40TCID 50 / 100μL, 20TCID 50 / 100μL, 10TCID 50 / 100μL, 5TCID 50 / 100μL, 2.5TCID 50 / 100μL, 1.25TCID 50 / 100μL, 0.625TCID 50 / 100 μL. The above 8 dilution samples were inoculated into chicken liver cancer cells that were covered with a monolayer, 100 μL / well, and 4 replicates were performed for each sample. At the same time, only DF12 culture medium was added as a negative control. The detection was performed according to the steps and criteria for detecting NDRV in "1. Inoculation of samples to be detected" and "2. Fluorescence staining and result determination" in Example 3.

[0150] Results: The NDRV test results of each dose gradient were as follows: when the infection dose was greater than or equal to 10 TCID 50 The above results show that the minimum detection limit of the NDRV sample of the virus to be detected by the kit is 10TCID 50.

[0151] 3. Preliminary application of the kit

[0152] This kit is applied to the detection of exogenous viruses in live vaccines of poultry viruses. In this test, 10 key varieties of live vaccines for poultry produced by domestic manufacturers were selected. NDRV detection was performed according to the kit of Example 3 of the present invention, and the detection was performed according to the steps and judgment criteria for detecting the new duck reovirus in "1. Inoculation of samples to be tested" and "2. Fluorescent staining and result determination" in Example 3. And according to the third volume of the 2020 edition of the Chinese Pharmacopoeia of Veterinary Medicine, the selected live vaccines for poultry diseases were subjected to serological tests for NDRV contamination. At the same time, the PBS group was set as a negative control, and the group infected with NDRV (GX2022 strain) was set as a positive control.

[0153] The results are shown in Table 3. The results of serological tests and the test results of this kit are consistent. The selected poultry live vaccines are not contaminated with NDRV. The negative control is negative for NDRV test, and the positive control is positive for NDRV test.

[0154] Table 3 Test results of vaccines from domestic and foreign enterprises using the kit of the present invention

[0155]

[0156]

[0157] In summary, the indirect immunofluorescence kit prepared by the present invention can be used to detect NDRV virus without cross-reaction to other viruses, is convenient and efficient, has strong operability, and has high specificity and sensitivity.

[0158] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A monoclonal antibody hybridoma cell line against a novel duck reovirus, characterized in that: The anti-novel duck reovirus monoclonal antibody hybridoma cell strain is named as hybridoma cell strain NDRV Mab-Sigma C-9, and the deposit number of the hybridoma cell strain NDRV Mab-Sigma C-9 is CCTCCNO: C2024284.

2. A monoclonal antibody against a novel duck reovirus, characterized in that: The monoclonal antibody is obtained by secreting the monoclonal antibody hybridoma cell line against the novel duck reovirus according to claim 1 or its passaged monoclonal antibody hybridoma cell line.

3. A reagent or kit for detecting a novel duck reovirus, characterized in that: Comprising the monoclonal antibody according to claim 2.

4. An indirect immunofluorescence kit, characterized in that: The kit comprises the monoclonal antibody according to claim 2 and a fluorescein-labeled goat anti-mouse antibody.

5. The indirect immunofluorescence kit according to claim 4, characterized in that: The fluorescein includes FITC.

6. The indirect immunofluorescence kit according to claim 4, characterized in that: The kit also includes a sample diluent and a sample washing solution.

7. The indirect immunofluorescence kit according to claim 6, characterized in that: The sample diluent comprises a 9-11 mM phosphate buffer with a pH value of 7.0-7.4; the sample washing solution comprises a 9-11 mM phosphate buffer with a pH value of 7.0-7.

4.

8. Use of the monoclonal antibody hybridoma cell line against novel duck reovirus according to claim 1, the monoclonal antibody according to claim 2, the reagent or kit according to claim 3, or the indirect immunofluorescence kit according to any one of claims 4 to 7 in detecting the safety of live avian virus vaccines.

9. Use of the anti-novel duck reovirus monoclonal antibody hybridoma cell line according to claim 1 or the monoclonal antibody according to claim 2 in the preparation of a product for detecting novel duck reovirus.

10. The use according to claim 9, characterized in that: The product comprises a reagent or a kit.

Images