Novel nitrilase and application thereof in nicotinic acid biosynthesis

Abstract

The invention relates to novel nitrilase and application thereof in nicotinic acid biosynthesis. The nucleotide sequence of the novel nitrilase disclosed by the invention is as shown in SEQ ID NO: 1, and the amino acid sequence of the novel nitrilase is as shown in SEQ ID NO: 2. The novel nitrilase can efficiently catalyze 3-cyanopyridine to generate nicotinic acid, especially the nitrilase activity of the nitrilase after promoter optimization is improved, the substrate conversion rate reaches 100%, the accumulated concentration of the product nicotinic acid can reach 123.11 g / L, and the novel nitrilase has important industrial application value for green and efficient preparation of nicotinic acid and derivatives thereof.

Description

Technical Field

[0001] The present invention relates to the field of biocatalysis technology, in particular to a novel nitrilase and application thereof in nicotinic acid biosynthesis. Background Art

[0002] Niacin is an essential nutrient for the human body, which can solve symptoms such as dermatitis, diarrhea, and dementia; it is also a vascular protector, which can prevent thrombosis and atherosclerosis. In addition, niacin can be used as a pharmaceutical and chemical synthesis intermediate, food and feed additive, etc., and the market demand is growing.

[0003] At present, the domestic nicotinic acid industry mainly adopts chemical synthesis. The existing production process is relatively backward, with high energy consumption, small production scale, serious three waste pollution, and the output is difficult to meet market demand. However, the biocatalytic method has received more and more attention due to its huge advantages, and related reports are increasing. Directly using 3-cyanopyridine as a raw material to hydrolyze nicotinic acid in the next step of nitrilase is also one of the hot spots of many studies. This method has the advantages of mild reaction conditions, easy control of the reaction process, few by-products, high conversion efficiency, and low environmental pollution. The specific reaction is as follows:

[0004]

[0005] The existing nitrilase biocatalytic production of nicotinic acid still has the disadvantages of few nitrilase-producing bacteria, weak tolerance to nitrile substrates, low catalytic activity, and poor thermal stability, which cannot meet the needs of modern industrialization. Therefore, it is of great industrial application value to improve the enzymatic activity of nitrilase by recombining nitrilase from Gordonia, develop efficient nitrilase with strong substrate tolerance, and prepare nicotinic acid in a green and efficient manner. Summary of the invention

[0006] In order to solve the above technical problems, the present invention provides a novel nitrilase and its application in nicotinic acid biosynthesis. The present invention provides a novel nitrilase derived from Gordonia, a nucleic acid molecule encoding it, a promoter expressing the highest enzyme activity of Gordonia nitrilase, a vector and a cell containing these nucleic acid molecules, and characterizes the catalytic properties of the constructed recombinant engineered bacteria to determine the optimal conversion conditions, solves the problems of low enzyme activity and low expression intensity in the existing technology of nitrilase catalytic synthesis of nicotinic acid and its derivatives, and improves its application value in nicotinic acid synthesis.

[0007] The present invention clones and amplifies a nitrilase gene GdNit from a plasmid carrying the nitrilase gene GdNit, wherein the amino acid sequence of the gene is shown in SEQ ID NO: 2, and the nucleotide sequence of the gene is shown in SEQ ID NO: 1; and further promoter modification is performed to obtain a recombinant nitrilase, wherein the promoter nucleotide sequence is shown in SEQ ID NO: 3, the expression intensity of the promoter is lower than that of the plasmid T7 promoter, and the enzyme activity is increased by about 1.7 times compared with the initial enzyme activity, reaching 17.35 U / mL.

[0008] The present invention is achieved through the following technical solutions:

[0009] The first object of the present invention is to provide a novel nitrilase, wherein the novel nitrilase is derived from Gordonia, and the amino acid sequence is shown in SEQ ID NO:2.

[0010] The second object of the present invention is to provide a gene encoding the novel nitrilase.

[0011] In one embodiment of the present invention, the nucleotide sequence of the gene is shown in SEQ ID NO:1.

[0012] The third object of the present invention is to provide an expression vector carrying the gene.

[0013] The fourth object of the present invention is to provide a recombinant bacterium expressing the novel nitrilase.

[0014] In one embodiment of the present invention, the recombinant bacterium regulates the expression of the novel nitrilase with a promoter sequence such as the nucleotide sequence shown in SEQ ID NO.3.

[0015] In one embodiment of the present invention, the host of the recombinant bacteria is Escherichia coli, Bacillus subtilis, Pichia pastoris or Corynebacterium glutamicum; preferably Escherichia coli BL21 (DE3).

[0016] The fifth object of the present invention is to provide a method for preparing the recombinant bacteria, comprising the following steps:

[0017] (1) using the Escherichia coli genome as a template, amplifying the promoter sequence to obtain a promoter sequence having a nucleotide sequence as shown in SEQ ID NO.3;

[0018] (2) recovering the promoter fragment of step (1) and constructing it into a plasmid carrying a nitrilase gene to obtain a recombinant plasmid;

[0019] (3) Transforming the recombinant plasmid of step (2) into a host bacterium to obtain a recombinant bacterium.

[0020] The sixth object of the present invention is to provide the use of the recombinant bacteria in nicotinic acid biosynthesis.

[0021] In one embodiment of the present invention, the method of application is:

[0022] 100mM-300mM 3-cyanopyridine was used as substrate and 3g·L -1 ~5g·L -1 The cells of the recombinant bacteria are used as whole-cell catalytic biocatalysts to generate nicotinic acid through bioconversion in batch conversion or continuous batch fed conversion. The recombinant bacteria is the recombinant Escherichia coli of the novel nitrilase.

[0023] The sixth object of the present invention is to provide a promoter, which is a promoter of a novel nitrilase gene, and the nucleotide sequence of the promoter is shown in SEQ ID NO:3.

[0024] The seventh object of the present invention is to provide an expression vector containing the promoter.

[0025] The eighth object of the present invention is to provide a recombinant bacterium expressing a novel nitrilase, comprising the promoter.

[0026] The ninth objective of the present invention is the use of the promoter in promoting the expression of novel nitrilase.

[0027] The above technical solution of the present invention has the following advantages compared with the prior art:

[0028] The present invention provides a novel nitrilase and its application in nicotinic acid biosynthesis. The Gordonia novel nitrilase provided by the present invention can efficiently catalyze 3-cyanopyridine to produce nicotinic acid, especially the nitrilase substrate conversion rate after promoter optimization reaches 100%, and the production efficiency of nicotinic acid is as high as 123.11 g / L, which has important industrial application value for green and efficient preparation of nicotinic acid and its derivatives. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to make the content of the present invention more clearly understood, the present invention is further described in detail below according to specific embodiments of the present invention in conjunction with the accompanying drawings, wherein:

[0030] Figure 1 It is the result of double enzyme digestion of pET-3b-GdNit in the E. coli BL21 (DE3) expression host of the present invention;

[0031] Figure 2 This is the fermentation process curve of the recombinant bacteria E.coliBL21(DE3)-GdNit in the present invention;

[0032] Figure 3The SDS-PAGE of the recombinant Escherichia coli production of the novel nitrilase of the present invention;

[0033] Figure 4 It is a comparison of the expression intensity and enzyme activity of the recombinant strains transformed with different promoters in the present invention;

[0034] Figure 5 This is the reaction process of the present invention of continuously converting 3-cyanopyridine into nicotinic acid in batch feed. DETAILED DESCRIPTION

[0035] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0036] In a first aspect, the present invention provides a Gordonia nitrilase (novel nitrilase), the amino acid sequence of which is shown in SEQ ID NO: 2, which can catalyze the hydrolysis of 3-cyanopyridine to prepare nicotinic acid.

[0037] Furthermore, the novel nitrilase is a recombinant expression plasmid containing the Gordonia nitrilase gene constructed by PCR amplification and gene recombination expression technology, and is transformed into an engineered bacterium Escherichia coli BL21 (DE3) host for heterologous expression.

[0038] In a second aspect, the present invention provides a nucleic acid molecule encoding the novel nitrilase, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0039] The nucleic acid molecules provided by the present invention can usually be obtained by amplification using a PCR instrument or artificial synthesis.

[0040] In a third aspect, the present invention provides the above-mentioned novel nitrilase optimized promoter P rpoH , whose amino acid sequence is shown in SEQ ID NO: 3. Compared with the original T7 promoter, the use of P rpoH The expression level of the recombinant nitrilase was optimal, and its enzyme activity in catalyzing nicotinic acid production was significantly improved.

[0041] In a fourth aspect, the present invention provides a recombinant vector comprising the above-mentioned nucleic acid molecule.

[0042] Furthermore, the recombinant vector is pET-3b-GdNit, which is obtained by replacing the sequence between the Nde I and BamHI restriction sites of pET-3b with the nucleic acid molecule encoding the novel nitrilase, while keeping the other sequences unchanged.

[0043] In a fifth aspect, the present invention provides a recombinant cell comprising the above-mentioned recombinant vector.

[0044] Further, the recombinant cells are recombinant bacteria E. coli BL21 (DE3) and recombinant bacteria E. coli BL21 (DE3), and the recombinant cells can be recombinant genetically engineered bacteria. The culture medium used when the recombinant genetically engineered bacteria express the novel nitrilase can be a culture medium in the art that can grow the recombinant genetically engineered bacteria and express the nitrilase of the present invention, such as LB culture medium.

[0045] There are no special requirements for the culture method and culture conditions, as long as the recombinant genetic engineering strain grows normally and is induced to express Gordonia nitrilase under appropriate temperature conditions. The preferred culture method is: inoculate the recombinant bacteria E.coli BL21 (DE3) / pET-3b-GdNit into LB liquid culture medium containing ampicillin, culture at 37°C and 220rpm for 12 hours, transfer to 30mL LB culture medium with corresponding resistance at a 1% (v / v) inoculation amount, culture at 37°C and 220rpm, centrifuge the culture solution, collect the bacterial precipitate, wash with physiological saline, and obtain recombinant cells.

[0046] More specifically, the method for constructing the above-mentioned recombinant cell may comprise the following steps:

[0047] (1) Amplification of the Gordonia nitrilase gene GdNit;

[0048] (2) Construction of recombinant expression plasmid pET-3b-GdNit;

[0049] (3) The recombinant expression plasmid pET-3b-GdNit was transformed into the host cell E. coli BL21 (DE3);

[0050] (4) The positive clone strains were screened using LB solid plate resistance culture medium containing ampicillin.

[0051] In a sixth aspect, the present invention provides use of the nitrilase, the nucleic acid molecule, the promoter, the recombinant vector, the recombinant cell and / or the nitrilase prepared by the method in preparing nicotinic acid.

[0052] Further, the temperature of the hydrolysis reaction is 20°C to 40°C, for example, 20°C, 30°C, 40°C, or a value or range between any two of these values, preferably 30°C; the pH value of the hydrolysis reaction is 5 to 9, for example, 5, 6, 7, 8, or a value or range between any two of these values, preferably pH 7.5 (PBS sodium phosphate buffer);

[0053] The final concentration of 3-cyanopyridine is 25 mM to 200 mM, for example, 25 mM, 50 mM, 75 mM, 100 mM, 125 mM, 150 mM, 175 mM, 200 mM, or a value or range between any two of these values, preferably 50 mM.

[0054] In one embodiment of the present invention, nicotinic acid is prepared by catalyzing the hydrolysis reaction of 3-cyanopyridine using any of the above-mentioned recombinant cells;

[0055] The Gordonia nitrilase of the present invention can be used in the form of engineered bacteria whole cells, in the form of unpurified crude enzymes, or in the form of partially purified or completely purified enzymes. The Gordonia nitrilase of the present invention can also be prepared into a catalyst in the form of an immobilized enzyme or immobilized cells using immobilization techniques known in the art.

[0056] Furthermore, the hydrolysis reaction is carried out under stirring or shaking, for example, under stirring at 100 rpm to 500 rpm.

[0057] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods, and the materials, reagents, etc. used are all available from commercial sources unless otherwise specified.

[0058] (1) Method for determining enzyme activity:

[0059] ① Take 200 μL of bacterial solution, centrifuge at 12000×g for 1 min, discard the supernatant, then suspend the bacteria with 100 mM PBS at pH 7.2 and wash 2 to 3 times to remove the residual culture solution. Finally, add the same PBS to 0.9 mL to obtain a bacterial resuspension of this volume (as blank).

[0060] ② Place the above bacterial resuspension in a metal bath at 30°C and 1500rpm for 5 minutes to allow the bacteria to adapt to the next transformation temperature in advance.

[0061] ③Conversion reaction process: add 100 μL of 500 mM substrate 3-cyanopyridine to the above bacterial heavy suspension to make the total reaction volume 1 mL, and place the reaction system in a metal bath at 30°C and 1500 rpm for 10 min.

[0062] ④After the conversion reaction is completed, quickly centrifuge at 12000×g for 1 min to terminate the reaction.

[0063] ⑤ Color development reaction process: Take 10 μL of the supernatant of the conversion solution and put it into a 10 mL clean and dry centrifuge tube, add 1.0 mL of sodium phenol solution, 1.5 mL of sodium nitrosoferricyanide solution, and 1.5 mL of sodium hypochlorite solution respectively, and add ammonia-free water to make up to 5 mL volume (990 μL), react in a 27°C water bath for 15 minutes to obtain a blue soluble substance, and detect the absorbance at 630 nm.

[0064] (2) Enzyme activity calculation method: Under standard conditions, the amount of enzyme required to produce 1 μmol of niacin or ammonia per minute.

[0065] (3) The culture medium used in the embodiments of the present invention is as follows:

[0066] LB liquid medium (g / L): peptone 10, yeast powder 5, NaCl 10, pH 7.0. Used for strain fermentation and seed activation

[0067] LB solid medium (g / L): peptone 10, yeast powder 5, NaCl 10, agar powder 18-20 (added to solid medium), pH 7.0.

[0068] Example 1: Obtaining the nitrilase gene sequence from Gordonia

[0069] A plasmid carrying the nitrilase gene GdNit was used as a template and 3b-GdNit-F and 3b-GdNit-R were used as primers to perform PCR amplification to obtain the nitrilase gene GdNit from Gordonia, wherein the nucleotide sequence of the Gordonia nitrilase gene is shown in SEQ ID NO: 1, and the amino acid sequence of the nitrilase encoded by the gene is shown in SEQ ID NO: 2.

[0070] 3b-GdNit-F:

[0071] ACTTTAAGAAGGAGATATACATATGATGGTGAACTACACTAATAA

[0072] 3b-GdNit-R:

[0073] TTGTTAGCAGCCGGATCCTTAACGGTCAGAAGACATATCC

[0074] Example 2: Construction of pET-3b-GdNit recombinant plasmid

[0075] The fragment containing the Gordonia nitrilase gene obtained in Example 1 was double-digested with Nde I and BamHI to obtain a gene fragment; pET-3b was double-digested with QuickCutNde I and QuickCutBamHI to obtain a vector fragment; the gene fragment and the vector fragment were connected to obtain a recombinant expression plasmid, which was named pET-3b-GdNit. The double-digestion results of pET-3b-GdNit in the E. coli BL21 (DE3) expression host are shown in FIG. Figure 1 The plasmid was sent for sequencing, and the result was consistent with the expectation.

[0076] Example 3: Heterologous expression of Gordonia nitrilase in E. coli BL21(DE3)

[0077] The recombinant expression plasmid pET-3b-GdNit obtained in Example 2 was transferred into the expression host E. coli BL21 (DE3) by heat shock transformation, and LB solid medium containing 50 μg / mL ampicillin was applied for screening to obtain the recombinant bacteria E. coli BL21 (DE3) / pET3b-GdNit expressing Gordonia nitrilase.

[0078] The constructed nitrilase recombinant expression strain E. coli BL21 (DE3)-GdNit was fermented to produce enzyme. During the fermentation process, the growth of the recombinant bacteria (OD600) and the enzyme activity were detected. The results are shown in Figure 2 As shown, it was found that the recombinant bacteria reached the highest enzyme activity of 10.53 U / mL when it just entered the growth stable phase (8h).

[0079] Afterwards, the recombinant E. coli that had been fermented for 8 h was collected and ultrasonically disrupted. After centrifugation, the supernatant was taken for SDS-PAGE analysis. Figure 3 The results showed that there was an obvious target protein band at about 39 kDa, which was consistent with the theoretical molecular weight of Gordonia nitrilase. Therefore, it can be concluded that the recombinant E. coli BL21 (DE3)-GdNit was successfully constructed and Gordonia nitrilase was recombinantly expressed in E. coli.

[0080] Example 4: Promoter screening

[0081] In this example, six endogenous promoters of Escherichia coli (P asnB , P alsR , P rpoH , P fnr , P gapA , P ssrA), and the expression intensity was characterized together with the plasmid T7 promoter. In the experiment, the green fluorescent protein gene (EGFP) was used as a reporter gene, and the fluorescence intensity of the recombinant green fluorescent protein was used as an indicator to measure the expression level (such as Figure 4 ). According to the promoter characterization results, it can be seen that promoter intervals of different strengths were constructed in the experiment, and the difference in expression intensity was about 10 times.

[0082] Previous studies have found that too high an expression level of recombinant nitrilase can significantly reduce the enzymatic activity of the nitrilase. Therefore, it is necessary to regulate the expression level and expression intensity of the nitrilase to ensure that the expression level of the nitrilase is maintained at the most appropriate level in order to obtain the highest enzyme activity level. To this end, the present invention introduces the nitrilase gene GdNit into expression cassettes controlled by promoters of different strengths for expression. After the recombinant Escherichia coli of the promoter nitrilase of different strengths is fermented, it is known according to the enzyme activity assay results (as shown above) Figure 4 As shown in Figure 2, for Gordonia nitrilase, the promoter with the most suitable recombinant expression strength is P rpoH The expression intensity of the promoter was lower than that of the plasmid T7 promoter, and the enzyme activity was increased by about 1.7 times compared with the initial enzyme activity, reaching 17.35 U / mL. The results of the present invention can once again verify the inferred conclusion that excessive expression of nitrilase may lead to decreased enzyme activity.

[0083] Example 5: Construction of promoter-modified recombinant strains

[0084] 1. Use a bacterial genomic DNA extraction kit (Shanghai Jierui Bioengineering Co., Ltd., GK1071) to extract the Escherichia coli BL21 (DE3) genome as a template for promoter sequence amplification, and use the designed primers to PCR amplify the DNA fragment of the promoter rpoH. The amino acid sequence is shown in SEQ ID NO: 3.

[0085] 2. Mix the pET-3b vector and the PCR recovered product, transform them into the expression host E. coli BL21 (DE3) competent cells, and spread them on the LB solid plate containing ampicillin. Invert and culture them in a 37°C biochemical incubator for about 12 hours. After colonies grow, screen the positive transformants for colony PCR verification, and then verify them by sequencing after colony PCR verification.

[0086] 3b-P rpoH -F:

[0087] GGCTCTAAGGGCATCGGTCGACTAAAAGCGTGTTATACTC

[0088] 3b-P rpoH -R:

[0089] CGTATTAATTTCGCGGGATCGAGATCTTCAAATCCTCTCAATCGATATCExample 6: Preparation of Nicotinic Acid Using Gordonia Nitrilase as Biocatalyst

[0090] Take 50mL of bacterial solution and centrifuge to discard the supernatant, add an equal volume of PBS buffer to prepare a resting cell suspension, incubate in a shaker at 30°C and 220rpm for 5min, add 3-cyanopyridine with a final concentration of 200mM to the transformation system in batches, and at the same time, take 500μL of bacterial solution and centrifuge to take the supernatant, pass the membrane, and use HPLC to detect the residual amount of substrate 3-cyanopyridine and the amount of product nicotinic acid in the reaction system. The biotransformation results are shown in Figure 2. Figure 5 shown by Figure 5 It can be seen that the resting cells were able to completely convert 5 batches of substrate within 150 min, and the accumulated niacin concentration was about 1000 mM, that is, the yield was 123.11 g / L.

[0091] Obviously, the above embodiments are merely examples for clear explanation and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived from these are still within the protection scope of the invention.

Claims

1. A novel nitrilase, characterized in that: The novel nitrilase is derived from Gordonia, and its amino acid sequence is shown in SEQ ID NO:

2.

2. A gene encoding the novel nitrilase according to claim 1.

3. The gene according to claim 2, characterized in that The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

4. An expression vector carrying the gene according to claim 2 or 3.

5. A recombinant bacterium expressing the novel nitrilase according to claim 1.

6. The recombinant bacterium according to claim 5, characterized in that The recombinant bacteria regulates the expression of the novel nitrilase with a promoter sequence such as the nucleotide sequence shown in SEQ ID NO.

3.

7. The recombinant bacterium according to claim 5, characterized in that The host of the recombinant bacteria is Escherichia coli, Bacillus subtilis, Pichia pastoris or Corynebacterium glutamicum.

8. The method for preparing the recombinant bacteria according to any one of claims 5 to 7, characterized in that: The following steps are involved: (1) using the Escherichia coli genome as a template, amplifying the promoter sequence to obtain a promoter sequence having a nucleotide sequence as shown in SEQ ID NO.3; (2) recovering the promoter fragment of step (1) and constructing it into a plasmid carrying the novel nitrilase gene to obtain a recombinant plasmid; (3) Transforming the recombinant plasmid of step (2) into a host bacterium to obtain a recombinant bacterium.

9. Use of the recombinant bacteria according to claim 5 or 6 in nicotinic acid biosynthesis.

10. The use according to claim 9, characterized in that: The method of application is: 100mM-300mM 3-cyanopyridine was used as substrate and 3g·L -1 ~5g·L -1 The cells of the recombinant bacteria are used as whole-cell catalytic biocatalysts to generate nicotinic acid through bioconversion in a batch conversion or continuous batch fed conversion manner.

Images