Compound for HBV (Hepatitis B Virus) related diseases and application thereof

Abstract

The present disclosure provides a compound comprising an oligonucleotide targeting hepatitis B virus (HBV) RNA, which oligonucleotide is capable of reducing the HBsAg level and / or HBeAg level of HBV. The invention also provides application of the compound in prevention and / or treatment of HBV-related diseases.

Description

Technical Field

[0001] The present disclosure relates to a compound and use thereof in preventing and / or treating diseases caused by hepatitis B virus infection. Background Art

[0002] Hepatitis B virus (HBV) is abbreviated as HBV. Hepatitis B is a potentially life-threatening liver infection caused by the HBV. It is a global health problem that can cause chronic infection. Most people do not have any symptoms at the beginning of infection. However, some people will develop acute symptoms that can last for weeks and include yellowing of the skin and eyes (jaundice), dark urine, extreme fatigue, nausea, vomiting, and abdominal pain. Patients with acute hepatitis will develop acute liver failure, which can lead to death. Chronic infection with HBV is one of the risk factors for advanced liver diseases such as cirrhosis and hepatocellular carcinoma. Early studies have shown that HBsAg in the patient's plasma may be involved in the suppression of the host immune system. A recent retrospective analysis of clinical data has shown that seroconversion of HBsAg can reduce the incidence of hepatocellular carcinoma. Therefore, it is of great clinical significance to eliminate (completely cure) or control (functionally cure) chronic infection with HBV. In addition to circular closed covalent DNA (cccDNA), HBsAg can also be produced by HBV integrated into the host genome. Clinical viral markers cannot distinguish the source of HBsAg. From the analysis of samples obtained through liver tissue puncture, HBsAg is relatively widely integrated in chronic hepatitis B patients.

[0003] The genome of type D HBV virus is about 3282 base pairs, which can transcribe five viral RNAs, namely preC RNA, pgRNA, 2.4kb preS1 RNA, 2.1kb preS2 / S RNA and 0.7kb RNA. Structurally, the coding regions of viral RNAs are highly overlapping, and their 3' ends terminate at the same position; functionally, the regulation of transcripts is relatively independent, especially the post-transcriptional regulation of 2.1kb preS2 / S RNA. 2.1kb preS2 / S RNA is the main RNA template encoding HBsAg, so it is very important to understand the regulatory mechanism of this transcript. According to studies, there are specific regulatory elements in the 2.1kb preS2 / S RNA sequence. The RNA secondary structure predicts that the regulatory element has a stable secondary structure, and a single point mutation in it will cause the 2.1kb preS2 / S RNA to disappear completely without affecting the other four transcripts. The mechanism by which this point mutation causes the disappearance of 2.1kb preS2 / S RNA has not yet been studied clearly.

[0004] Small nucleic acid drugs usually refer to nucleic acid drugs with less than 100 nt, including small interfering RNA (RNAi), antisense oligonucleotides (ASO) and aptamers. Both RNAi and ASO target RNA and regulate the metabolic pathway of RNA (including enhancing protein translation, correcting alternative splicing, degrading target RNA, activating transcription, etc.). The development of new small nucleic acid drugs for the prevention or treatment of HBV is of great significance. Summary of the invention

[0005] The present disclosure found that there is a special regulatory element on the RNA of HBV (SEQ ID NO: 1), and a single point mutation can specifically regulate the 2.1kb preS2 / S RNA. Using a placeholder ASO to target this sequence can specifically reduce the HBsAg level, while having almost no effect on HBeAg. This phenomenon strongly proves that this region can specifically regulate the 2.1kbpreS2 / S RNA; and using an ASO with a cutting mechanism to target this sequence can not only significantly reduce 2.1kb preS2 / SRNA and HBsAg, but also cut 3.5kb preC RNA and reduce HBeAg levels. This shows that using ASO to target this sequence can significantly reduce HBV RNA and antigen levels. At the same time, using a gapmer ASO to target this sequence can not only reduce HBsAg from cccDNA, but also reduce HBsAg from integration.

[0006] In a first aspect, the present disclosure provides a compound comprising an oligonucleotide molecule having a length of 8 to 50 linked nucleosides, wherein the oligonucleotide molecule is complementary to a portion of the sequence shown in SEQ ID NO:2, or is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% complementary to the sequence shown in SEQ ID NO:2.

[0007] Based on the study of HBV RNA metabolism, the present disclosure discovered that a specific region in the gene sequence of HBV encoding HBsAg has good targeting properties, and ASO designed for this region can prevent or treat HBV infection-related diseases.

[0008] In some embodiments, the oligonucleotide molecule has a nucleotide sequence of at least 20, preferably at least 21, more preferably at least 22 consecutive nucleobases.

[0009] In some embodiments, the oligonucleotide molecule has a nucleotide sequence of 20 to 30 consecutive nucleobases, for example, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 linked nucleosides.

[0010] In some embodiments, the oligonucleotide molecule is complementary to the following nucleotide sequence: the 5' end of the nucleotide sequence starts at positions 476 to 486 (for example, positions 476, 477, 478, 479, 480, 481, 482, 483, 484, 485 or 486) corresponding to the sequence shown in SEQ ID NO:1, preferably positions 476 to 483, and further preferably any one of positions 480 to 483, and the 3' end of the nucleotide sequence ends at positions 501 to 509 (for example, positions 501, 502, 503, 504, 505, 506, 507, 508 or 509) corresponding to the sequence shown in SEQ ID NO:1, preferably any one of positions 503 to 506.

[0011] In some embodiments, the oligonucleotide molecule has a nucleotide sequence of at least 8 consecutive nucleobases containing at least one of SEQ ID NOs:45-86, or a nucleotide sequence having 1, 2 or 3 nucleotides inserted, substituted or deleted compared to the nucleotide sequence shown in SEQ ID NOs:45-86.

[0012] In some embodiments, the oligonucleotide molecule may include one or more nucleotides containing modifications and / or modified internucleoside bonds.

[0013] In some embodiments, the oligonucleotide molecule may include one or more modified nucleotides or internucleoside bonds selected from the following: phosphorothioate internucleoside bonds, chiral phosphorothioate bonds, phosphorodithioate bonds, locked nucleic acids, alkoxy-modified nucleotides, C1-C5 alkyl-modified nucleotides, amino-modified nucleotides. In some embodiments, the modified oligonucleotide molecule may include one or more modified nucleotides or internucleoside bonds selected from the following: 2'-methoxyethyl-modified nucleotides, 2'-O-methyl-modified nucleotides, C1-C5 alkyl-modified nucleotides, terminal nucleotides connected to cholesterol derivatives, terminal nucleotides connected to dodecanoic acid didecamide groups, 2'-deoxy-2'-fluoro-modified nucleotides, 2'-deoxy-modified nucleotides, abasic nucleotides, deoxythymidine, reverse deoxythymidine, 2'-amino-modified nucleotides, 2'-alkyl-modified nucleotides, morpholino nucleotides, phosphoramidates, sugar mimetics, and nucleotides containing non-natural bases.

[0014] In some embodiments, the oligonucleotide molecule may include one or more 5-methylcytosines. In some embodiments, the cytosines of the oligonucleotide molecule may all be 5-methylcytosines.

[0015] In some embodiments, the oligonucleotide molecule may include one or more phosphorothioate internucleoside bonds. In some embodiments, each internucleoside bond in the oligonucleotide molecule may be a phosphorothioate internucleoside bond.

[0016] In some embodiments, the oligonucleotide molecule can include one or more locked nucleic acids.

[0017] In some embodiments, the 5' and / or 3' end of the oligonucleotide molecule may include 2 to 3 consecutive locked nucleic acids.

[0018] In some embodiments, the oligonucleotide molecule may include interleaved locked nucleic acids and ribonucleotides / deoxyribonucleotides. In some embodiments, the oligonucleotide molecule may include 16 to 26 consecutive ribonucleotides or deoxyribonucleotides.

[0019] In some embodiments, the modified oligonucleotide contains phosphorothioate internucleoside linkages and 2'-methoxyethyl modified nucleotides.

[0020] In some embodiments, the oligonucleotide molecule has a nucleotide sequence containing at least one of SEQ ID NOs: 91-132, or a nucleotide sequence having 1, 2 or 3 nucleotides inserted, substituted or deleted compared to the nucleotide sequence shown in SEQ ID NOs: 91-132.

[0021] In some embodiments, the oligonucleotide is capable of reducing the level of HBsAg. In some embodiments, the oligonucleotide is capable of reducing the level of HBsAg and / or HBeAg.

[0022] In some embodiments, the compound is single-stranded or double-stranded.

[0023] In a second aspect, the present disclosure provides a pharmaceutical composition comprising the compound of the first aspect and a pharmaceutically acceptable carrier.

[0024] In some embodiments, the pharmaceutical composition is in the form of tablets, powders, granules, pills, injections, suspensions, powders, emulsions, aerosols, gels, eye drops, sustained release agents or sustained release implants. In some embodiments, the pharmaceutical composition can be formulated into an injectable formulation. In some embodiments, the formulation is suitable for intravitreal injection, subcutaneous, intradermal, intramuscular, intravenous, intrathecal or intraspinal administration.

[0025] In a third aspect, the present disclosure provides a kit comprising the compound of the first aspect and a container (eg, a vial, an ampoule, a bottle, a syringe and / or a dispersible package or other suitable container) containing the compound.

[0026] In some embodiments, the kit further comprises an additional therapeutic agent and a second container (eg, a vial, ampoule, bottle, syringe, and / or dispersible package or other suitable container) comprising the additional therapeutic agent.

[0027] In some embodiments, the kit may optionally further include a third container containing a pharmaceutically acceptable carrier for diluting or suspending the compound and / or other therapeutic agent.

[0028] In a fourth aspect, the present disclosure provides a pharmaceutical combination comprising the compound of the first aspect and a second therapeutic agent.

[0029] In some embodiments, the second therapeutic agent refers to a second therapeutic compound (eg, a second antisense oligonucleotide targeting HBV) and / or a non-HBV therapeutic compound.

[0030] In some embodiments, in the combination, the compound of the first aspect and the second therapeutic agent can be administered to the subject separately or together (simultaneously or sequentially).

[0031] In the fifth aspect, the present disclosure provides use of the compound described in the first aspect, the pharmaceutical composition described in the second aspect, the kit described in the third aspect, or the drug combination described in the fourth aspect in the preparation of a medicament for preventing and / or treating diseases related to hepatitis B virus infection.

[0032] In some embodiments, the hepatitis B virus infection-related disease is a disease caused by hepatitis B virus infection.

[0033] In some embodiments, the disease caused by hepatitis B virus infection includes at least one of chronic liver disease, inflammation, fibrosis, cirrhosis, serum hepatitis, jaundice, liver cancer, liver inflammation, liver fibrosis, cirrhosis, liver failure, diffuse hepatocellular inflammatory disease, hemophagocytic syndrome, HBV viremia, or transplantation associated with liver disease.

[0034] In a sixth aspect, the present disclosure also provides a method for preventing and / or treating diseases related to hepatitis B virus infection in a subject, comprising administering to the subject the compound described in the first aspect, the pharmaceutical composition described in the second aspect, or the drug combination described in the fourth aspect.

[0035] In some embodiments, the compound or the pharmaceutical composition is administered intravenously, intraperitoneally, nasally, orally, intramuscularly, subcutaneously, parenterally, or intratumorally. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 The HBsAg level after ASO molecules were transfected into HepAD38 cells according to one embodiment of the present disclosure is shown ( Figure 1 A- Figure 1 K).

[0037] Figure 2 The HBsAg( Figure 2 A) and HBeAg( Figure 2 B) level.

[0038] Figure 3 The HBsAg (A) and HBeAg (B) levels in the supernatant of HepAD38 cells transfected with an ASO molecule according to one embodiment of the present disclosure are shown.

[0039] Figure 4 The results of HBV RNA nucleic acid blot hybridization experiments of HepAD38 cells transfected with ASO molecules according to one embodiment of the present disclosure are shown.

[0040] Figure 5 The results of an in vitro RNaseH cleavage experiment of an ASO molecule according to one embodiment of the present disclosure are shown.

[0041] Figure 6 The HBsAg levels after HepAD38 cells were transfected with ASO88-ASO95 molecules according to one embodiment of the present disclosure are shown.

[0042] Figure 7 The HBsAg level after the ASO molecule transfected HepAD38 cells according to one embodiment of the present disclosure is shown. Figure 7 A shows the HBsAg level after ASO80-ASO83 molecules were transfected into HepAD38 cells; Figure 7 B shows the HBsAg level after ASO84-ASO87 molecules were transfected into HepAD38 cells.

[0043] Figure 8 HBV antigen levels after ASO molecules were transfected into HepAD38 cells according to one embodiment of the present disclosure are shown. Figure 8 A and Figure 8B shows the activity levels of HBeAg and HBsAg after ASO-48, ASO-81, ASO-91, ASO-92, and ASO-96 transfected HepAD38 cells, respectively; Figure 8 C shows the transcription level of HBsAg after ASO molecules were transfected into HepAD38 cells.

[0044] Fig. 9 The activity of the ASO molecule according to one embodiment of the present disclosure in the PLC / PRF / 5 cell line is shown. Fig. 9 A shows the levels of HBsAg antigen after ASO-48, ASO-81, ASO-91, ASO-92, and ASO-96 transfection into PLC / PRF / 5 cells; Fig. 9 B shows the transcription level of HBsAg after ASO-48, ASO-81, ASO-91, ASO-92, and ASO-96 were transfected into PLC / PRF / 5 cells. DETAILED DESCRIPTION

[0045] HBV is short for hepatitis B virus. It is a DNA virus belonging to the family Hepadnavividae. The outer shell of the hepatitis B virus contains the surface antigen, namely the hepatitis B surface antigen (HBsAg), and the core contains the core antigen, namely the hepatitis B E antigen (HBeAg), and the deoxyribonucleic acid of the hepatitis B virus, namely HBV-DNA, and the deoxyribonucleic acid polymerase, namely DNA-P. After a person is infected with the hepatitis B virus, a large amount of surface antigen often remains in the blood, forming surface antigenemia. HBsAg itself is not a complete hepatitis B virus, but the outer shell of the hepatitis B virus. It is not contagious but has antigenicity. It is one of the signs of hepatitis B virus infection.

[0046] The five transcripts produced by the HBV genome encode seven proteins. The 3.5kb preC RNA encodes HBeAg, the pgRNA encodes the core protein core and polymerase P, the 2.4kb preS1 RNA encodes the large membrane protein LHBs, the 2.1kb preS2 / S RNA encodes the medium membrane protein MHBs and the small membrane protein SHBs, and the 0.7kb RNA encodes the non-structural protein X. The HBV genome is compact, and the coding regions of the transcripts are highly overlapping. The regulatory elements in the 2.1kb preS2 / S RNA also exist in the 3.5kbpreC RNA sequence. Studies have shown that single-point mutations in regulatory elements can cause the disappearance of 2.1kb preS2 / S RNA and HBsAg, with little effect on the levels of 3.5kb preC RNA and HBeAg.

[0047] Thermodynamic analysis of the primary sequence of the regulatory element by bioinformatics revealed that the GC content and overall energy value of the sequence were higher than those of the S coding region sequence, suggesting that the binding of the oligonucleotide to the sequence was unstable. In addition, secondary structure prediction revealed that the region had a stable secondary structure.

[0048] ASO is a single-stranded molecule composed of 16 to 30 consecutive deoxyribonucleic acids or ribonucleic acids, with two structures: DNA backbone or RNA backbone. ASO with DNA backbone (i.e. gapmer ASO) binds to target RNA through complementary base pairing, and the formed DNA-RNA hybrid chain can recruit and activate endogenous RNaseH to achieve the cleavage of target RNA; while ASO with RNA backbone (i.e. place-occupying ASO) forms RNA-RNA hybrid chain with target RNA that cannot activate RNaseH and cannot cleave target RNA. Place-occupying ASO binds to target RNA with high affinity, which can affect the spatial structure of target RNA or the binding of protein complexes, thereby regulating the metabolism of target RNA.

[0049] Based on the study of the 2.1kb preS2 / S RNA regulatory element, the inventors designed a locked nucleic acid modified placeholder ASO with strong binding force, covered the entire regulatory element for ASO screening, and found that 2 placeholder ASOs (a total of 24) can specifically reduce the levels of 2.1kb preS2 / S RNA and HBsAg, but have almost no effect on preC RNA and HBeAg. Keeping the sequence of the placeholder ASO unchanged, by performing gapmer chemical modification on the ASO, it was found that gapmer ASO can not only cut 2.1kbpreS2 / S RNA, but also reduce the levels of preC RNA, pgRNA and 2.4kb preS1 RNA.

[0050] Therefore, the present disclosure discovered that a regulatory element on the HBsAg encoding gene sequence of HBV genotype D has a significant effect on HBsAg. The present disclosure designed ASO-20 that targets the placeholder effect of the active center of the sequence, and found that ASO-20 can significantly inhibit the production of HBsAg without affecting HBeAg. ASO-20 was displaced by -3nt to obtain ASO-19, which almost lost the activity of reducing HBsAg. Similarly, ASO-28 was displaced by -3nt to obtain ASO-19, which also lost its biological activity. Using the sequence of ASO-20 as the parent sequence, gapmer chemical modification was performed to obtain ASO-48 and ASO-96, which still have the strongest biological activity. Therefore, in the present disclosure, regardless of using placeholder ASO or gapmer ASO, the present disclosure discovered the active center in the regulatory element sequence, and using ASO to target the center can exert a significant antiviral effect.

[0051] In a specific embodiment, the present disclosure designs the ASO sequences shown in Table 1 below.

[0052] Table 1

[0053]

[0054]

[0055]

[0056] In order to make the purpose, technical scheme and advantages of the present disclosure clearer, the present disclosure is further described in detail below in conjunction with the embodiments. The specific embodiments described herein are only used to explain the present disclosure and are not intended to constitute any limitation to the present disclosure. In addition, in the following description, the description of the well-known structures and technologies is omitted to avoid unnecessary confusion of the concepts of the present disclosure. Such structures and technologies are also described in many publications.

[0057] Unless otherwise defined, all technical and scientific terms used in this disclosure have the same meaning as commonly used in the field to which this disclosure belongs. For the purpose of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural form, and vice versa.

[0058] Unless the context clearly dictates otherwise, the expressions "a", "an" and "an" as used herein include plural references. For example, reference to "a cell" includes a plurality of such cells and equivalents thereof known to those skilled in the art, and so forth.

[0059] As used herein, the term "about" refers to a range of ±20% of the value that follows. In some embodiments, the term "about" refers to a range of ±10% of the value that follows. In some embodiments, the term "about" refers to a range of ±5% of the value that follows.

[0060] The term "HBV antigen" as used herein refers to any hepatitis B virus antigen or protein, including core proteins, such as hepatitis B core antigen (HBcAg or HBcAG) and hepatitis B E antigen (HBeAg or HBeAG), and envelope proteins, such as HBV surface antigen (HBsAg or HBsAG). "Hepatitis B E antigen" is a secreted non-microparticle form of HBV core protein. HBeAg and HBcAg share a major amino acid sequence and therefore exhibit cross-reactivity at the T cell level. HBeAg is not required for viral assembly or replication, but studies have shown that it may be required for chronic infection. "HBV surface antigen" is an envelope protein of infectious HBV virions, but is also secreted as non-infectious particles, and its serum level is 1000 times higher than that of HBV virions.

[0061] During the replication of the hepatitis B virus, the viral DNA enters the host cell nucleus. Under the action of DNA polymerase, the gaps in the two chains are filled to form a supercoiled covalent, closed, circular DNA molecule (covalently closed circular DNA, cccDNA). Extracellular hepatitis B virus DNA is a relaxed circular double-stranded DNA (relaxed circular DNA, rcDNA) molecule. cccDNA is the original template for the replication of the hepatitis B virus pregenomic RNA. Although its content is relatively low, with only about 5 to 50 copies in each liver cell, it is of great significance to the replication of the hepatitis B virus and the establishment of the infection state. Only by clearing the cccDNA in the cell nucleus can the virus-carrying state of hepatitis B patients be completely eliminated, which is the goal of antiviral treatment.

[0062] The term "hepatitis B virus infection-related disease" as used herein refers to any disease, biological condition, medical condition or event caused by, associated with or attributable to hepatitis B virus infection, exposure or disease. Hepatitis B disease-related conditions herein include chronic liver disease, serum hepatitis, jaundice, liver cancer, liver inflammation, liver fibrosis, cirrhosis, liver failure, diffuse hepatocellular inflammatory disease, hemophagocytic syndrome, serum hepatitis, HBV viremia, transplantation associated with liver disease, and, in conjunction with a positive test for the presence of hepatitis B virus, hepatitis B virus antigens, or a positive test for the presence of antibodies specific for hepatitis B virus antigens, a condition with symptoms that may include any or all of the following: influenza-like illness, weakness, pain, headache, fever, loss of appetite, diarrhea, nausea and vomiting, pain in the liver area of ​​the body, clay-colored or gray stools, general itching, and dark urine.

[0063] The term "antisense oligonucleotide (ASO)" used herein is a chemically synthesized oligonucleotide, which refers to a single-stranded oligonucleotide having a nucleic acid base sequence that allows hybridization with the corresponding region or segment of the target nucleic acid. Oligonucleotides are usually composed of 16-30nt short-chain nucleotides (deoxyribonucleotides or ribonucleotides), which can achieve very high selectivity by pairing with DNA, mRNA or pre-mRNA through the Watson-Crick base complementary pairing principle, accurately inhibiting certain genes, and keeping abnormally encoded genes silent, thereby preventing many erroneous protein expressions. Depending on the gapmer design structure of antisense oligonucleotides, antisense oligonucleotides can have the function of RNaseH-dependent degradation of target RNA. In addition, depending on the RNA backbone structure of antisense oligonucleotides, antisense oligonucleotides can also have a steric hindrance effect, play RNA shearing regulation, and prevent ribosome scanning (ribosome scanning) and other functions.

[0064] The term "base complementarity" as used herein refers to the ability of a nucleic acid base to base pair with another nucleic acid base. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In some embodiments, complementary nucleic acid bases refer to nucleic acid bases in antisense compounds that can base pair with nucleic acid bases of their target nucleic acids. For example, if a nucleic acid base at a certain position of an antisense compound can hydrogen bond with a nucleic acid base at a certain position of a target nucleic acid, the hydrogen bonding position between the oligonucleotide and the target nucleic acid at the nucleic acid base pair is considered to be complementary.

[0065] As used herein, the term "mismatch" or "non-complementary nucleobase" refers to a condition where a nucleobase of a first nucleic acid is unable to pair with a corresponding nucleobase of a second or target nucleic acid.

[0066] The term "modified oligonucleotide" as used herein refers to an oligonucleotide comprising at least one modified internucleoside bond, modified sugar and / or modified nucleic acid base. "Modified nucleic acid base" refers to any nucleic acid base other than adenine (A), cytosine (C), guanine (G), thymine (T) or uracil (U). "Modified nucleoside" refers to a nucleoside independently having a modified sugar moiety and / or a modified nucleic acid base. "Modified nucleotide" refers to a nucleotide independently having a modified sugar moiety, a modified internucleoside bond or a modified nucleic acid base. "Modified sugar" refers to the presence of substitution and / or any change compared to a natural sugar moiety.

[0067] The term "locked nucleic acid (LNA)" as used herein is an oligonucleotide derivative, in particular a modified RNA nucleoside analog. Locked nucleic acid has a similar phosphate backbone to DNA and RNA, and its ribose 2'O atom and 4'C are connected by a methylene bridge through a shrinkage effect, thereby forming a bicyclic sugar structure. In addition, due to the different shrinkage effects, a thiomethylene bridge or an aminemethylene bridge can also be formed. This type of structure can lock the N configuration of the furanose C3'-endo type, reduce the flexibility of the ribose structure, and thus enhance the stability of the local structure of the phosphate backbone. Examples of the bicyclic sugar include, but are not limited to, (A) α-L-methyleneoxy (4'-CH2-O-2') LNA; (B) β-D-methyleneoxy (4'-CH2-O-2') LNA; (C) ethyleneoxy (4'-(CH2)2-O-2') LNA; (D) aminooxy (4'-CH2-ON (R3)-2') LNA; and (E) oxyamino (4'-CH2-N (R3)-O-2') LNA, as described below. Also included within the definition of LNA herein is LNA in which the 2'-hydroxyl of the ribosyl sugar ring is connected to the 4' carbon atom of the sugar ring, thereby forming a methyleneoxy (4'-CH2-O-2') bridge to form a bicyclic sugar moiety. The bridge group can also be a methylene group (-CH2-) connecting the 2' oxygen atom and the 4' carbon atom, for which the term methyleneoxy (4'-CH2-O-2') LNA is used. In addition, in the case of a bicyclic sugar moiety with an ethylene bridging group at this position, the term ethyleneoxy (4'-CH2CH2-O-2') LNA is used. Also encompassed within the definition of LNA used herein is α-L-methyleneoxy (4'-CH2-O-2'), which is an isomer of methyleneoxy (4'-CH2-O-2') LNA.

[0068] As used herein, the term "internucleoside linkage" refers to the chemical bond between nucleosides.

[0069] The term "phosphorothioate bond modification" or "phosphorothioate internucleoside bond" used herein refers to replacing the phosphate bond (PO) between nucleosides on the nucleotide backbone with a phosphorothioate (PS), that is, replacing a non-bridging oxygen atom in the original phosphate bond with a sulfur atom. This replacement actually changes the overall chemical properties of the oligonucleotide. This modification usually increases the stability of the nucleic acid to nucleases. Although PS may reduce the affinity of nucleic acids and target genes, the PS modification is more hydrophobic and stable, which makes this modified bond very useful in generating antisense oligonucleotides. When antisense oligonucleotides are introduced into cells or biological matrices, they can interact with target nucleic acids to silence the expression of specific transcripts. Oligonucleotides containing phosphorothioate bonds achieve this function by directly blocking the translation process or by an RNase H-mediated mechanism to achieve enzymatic degradation of target transcripts. In some embodiments, the nucleotides modified with phosphorothioate bonds herein have the following structure:

[0070]

[0071] As used herein, the term "2'-methoxyethyl" (also 2'-O-methoxyethyl, 2'-MOE and 2'-O(CH2)2-OCH3) refers to an O-methoxy-ethyl modification at the 2' position of the furanose ring.

[0072] As used herein, the term "animal" refers to human or non-human animals, including but not limited to mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including but not limited to monkeys and chimpanzees.

[0073] The term "pharmaceutically acceptable" as used herein means that it is used to prepare a pharmaceutical composition that is generally safe, non-toxic and neither biologically nor otherwise undesirable, and includes that it is acceptable for human pharmaceutical use. The pharmaceutically acceptable carrier used herein refers to a non-toxic carrier, adjuvant or medium that does not destroy the pharmacological activity of the compound formulated together. Pharmaceutically acceptable carriers, adjuvants or media that can be used herein include, but are not limited to: ion exchangers, alumina, aluminum stearate, lecithin, serum proteins (such as human serum albumin), buffer substances (such as phosphates), glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes (such as protamine sulfate), disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, silica gel, magnesium trisilicate, polyvinyl pyrrolidone, cellulose-based substances, polyethylene glycol, sodium carboxymethyl cellulose, polyacrylates, waxes, polyethylene-polyoxypropylene-block polymers, polyethylene glycol and lanolin, etc.

[0074] The term "administering" as used herein refers to providing an agent to an individual. "Co-administering" refers to administering two or more agents to an individual. The two or more agents may be in a single pharmaceutical composition, or may be in separate pharmaceutical compositions. The two or more agents may each be administered via the same or different routes of administration. Co-administration encompasses concurrent or sequential administration. "Simultaneous administration" refers to the co-administration of two agents in any manner such that the pharmacological effects of both agents are manifested simultaneously in the patient. Simultaneous administration does not require that the two agents be administered in a single pharmaceutical composition, in the same dosage form, or by the same route of administration. The effects of the two agents themselves do not need to manifest simultaneously. These effects need only overlap for a period of time without being extended together.

[0075] The compound or pharmaceutical composition herein can be administered by many routes, including but not limited to: oral administration, parenteral administration, inhalation administration, topical administration, rectal administration, nasal administration, oral administration, vaginal administration, administration by implant or other modes of administration. For example, parenteral administration used herein includes subcutaneous administration, intradermal administration, intravenous administration, intramuscular administration, intraarticular administration, intraarterial administration, intrasynovial cavity administration, intrasternal administration, intrathecal administration, intralesional administration, and intracranial injection or infusion techniques.

[0076] The term "effective amount" as used herein, in the context of modulating an activity or treating or preventing a condition, refers to the amount of active ingredient that is administered to a subject in need of such modulation, treatment or prevention in the form of a single dose or a portion of a series of doses to effectively modulate the effect, or treat or prevent or improve the condition. The effective amount will vary depending on the following factors: the health and physical condition of the subject being treated, the taxonomic group of the subject being treated, the formulation of the composition, the assessment of the medical condition, and other relevant factors.

[0077] When used to prevent the conditions described in the present disclosure, the compounds provided herein are administered to a subject at risk of developing the condition, typically based on the advice of a physician and under the supervision of a physician, at dosage levels as described above. Subjects at risk of developing a specific condition typically include those with a family history of the condition, or those identified by genetic testing or screening as being particularly susceptible to developing the condition.

[0078] Examples and drawings are provided below to help understand the present disclosure. However, it should be understood that these examples and drawings are only used to illustrate the present disclosure and do not constitute any limitation. The actual scope of protection of the present disclosure is set forth in the claims. It should be understood that any modifications and changes can be made without departing from the spirit of the present disclosure.

[0079] Materials and methods

[0080] Experimental Materials:

[0081] HepAD38 cells were provided by Huahui Anjian (Beijing) Biotechnology Co., Ltd., HepG2 cells overexpressing NTCP (HepG2-NTCP cells) were provided by Li Wenhui's laboratory at Beijing Institute of Life Sciences, and PLC / PRF / 5 cells were purchased from Shanghai Fuheng Biotechnology Co., Ltd. (FH0064).

[0082] INTERFERin siRNA / miRNA in vitro transfection reagent was purchased from Polyplus (101000028), Opti-MEM TM I reduced serum medium was purchased from ThermoFisher (31985062), DMEM medium was purchased from Vivacell (06-1055-57-1ACS), primary hepatocyte maintenance medium, EMEM medium was purchased from Avantor (30-2003), ExCell Bio-FBS was purchased from Shanghai Jitai Yikesai Biotechnology Co., Ltd. (FND500), RNaseH was purchased from NEB Beijing (#M0297), in vitro transcription kit HiScribe TM T7 ARCA mRNA Kit was purchased from NEB Beijing (#E2060S), and ASO was synthesized by GenScript Biotech Co., Ltd. and Suzhou Ouli Biopharmaceutical Technology Co., Ltd. GSK836 was produced by GenScript Biotech Co., Ltd.

[0083] method:

[0084] (1) Dilution and storage of ASO

[0085] Powdered ASO was dissolved in RNase-free water to a concentration of 200 μM and stored in 5 μL aliquots at -80°C.

[0086] (2) ASO transfection of HepAD38 cells

[0087] Take a 200μM 5μL ASO and add 20μL RNase-free water to make the ASO concentration 40μM. Dilute the ASO to the desired concentration and prepare for transfection. Dilute 0.5μL ASO to 5μL reduced serum medium Opti-MEM and incubate for 5 minutes. Mix with 0.2μL transfection reagent INTERFERin. After standing for 20 minutes, take 10μL and add it to 90μL cell suspension (cell count is about 4.4×10 5 / mL). Place in a cell culture incubator and replace with fresh culture medium after 24 hours. Collect cell culture supernatant or cell RNA at a specified time.

[0088] (3) HepAD38 cell toxin production

[0089] HepAD38 cells were maintained in 10% tet serum-free DMEM medium supplemented with 500 ng / μL of G418, double antibodies (penicillin and streptomycin) and glutamine. HepAD38 cells were plated in 10 cm medium at a density of 1×10 7 Cells; the next day, after the cells adhered to the wall, they were replaced with 5% tet serum-free DMEM medium and 500ng / μL of G418, double antibody and glutamine were added. Every two days, the cell culture supernatant was collected and cell debris or impurities were removed using a 0.45μM filter. The titer of HBV was quantitatively detected using qPCR and stored in aliquots at -80°C.

[0090] (4) Hepatitis B virus (HBV) infection of HepG2-NTCP cells

[0091] HepG2-NTCP cells were cultured in DMEM medium with 10% serum. 3.5 × 10 6 After cell plating, treat with primary hepatocyte maintenance medium for 20 hours. Dilute HBV viral supernatant produced by HepAD38 cells by 2 times, mix with PEG at a final concentration of 5%, and add to the cells. Shake the plate at room temperature for 4 hours and transfer to a cell culture incubator. After 24 hours, remove the viral supernatant, wash the cells with PBS, and add primary hepatocyte maintenance medium for culture. Four days after infection, transfect ASO. The dilution steps and transfection process are the same as before.

[0092] (5) ASO transfection of PLC / PRF / 5 cells

[0093] Use MEM medium with 10% serum to maintain the growth of PLC / PRF / 5 cells, and subculture once every two days at a ratio of 1:3. For the ASO transfection method, take a 24-well plate as an example. Dilute 2.5μL ASO in 25μL reduced serum medium and let it stand for 5 minutes. Add 1μL transfection reagent INTERFERin, mix well and let it stand for 20 minutes; prepare a PLC / PRF / 5 cell suspension of 2.4×10 5 / ml. Mix 450μL cell suspension and 50μL transfection mixture and add to 24-well plate. After 24 hours, replace with fresh 10% serum MEM medium. Collect cell culture supernatant or cell RNA at designated time.

[0094] (6) Enzyme-linked immunosorbent assay for human hepatitis B virus core antigen (HBeAg) and surface antigen (HBsAg)

[0095] Commercial HBeAg and HBsAg kits (Beijing Wantai Biopharmaceutical Co., Ltd.) were used to detect HBeAg and HBsAg secreted in the cell supernatant after HBV infection. The specific operation process refers to the product manual. A brief description is: dilute the HepAD38 cell culture supernatant 20 times with fresh culture medium and add it to a 96-well microplate; add 20 μL of sample diluent and place it in a cell culture incubator for 30 minutes; add 50 μL of enzyme labeling reagent and continue incubation for 30 minutes; wash 5 times with washing buffer, discard the remaining liquid, add 50 μL of substrate A solution and B solution each, and color for 30 minutes. Use an enzyme reader with a wavelength of 450nm for detection.

[0096] (7) In vitro transcription of target RNA

[0097] The target RNA (about 300 bp) was amplified based on the following PCR primer pair:

[0098] IVT-GC-F:5'-GAAATTAATACGACTCACTATAGGGAGGCCACTCATCCTCAGGCCATGCAG-3' (SEQ ID NO:87);

[0099] IVT-R: 5'-GTAGCTCCAAATTCTTTATAAGGGTCGATGTCCATG-3' (SEQ ID NO: 88).

[0100] The reaction system is shown in Table 2:

[0101] Table 2

[0102]

[0103]

[0104] The reaction conditions are shown in Table 3:

[0105] Table 3

[0106]

[0107] The PCR products were recovered from gel, the concentration was determined, and the products were aliquoted and stored.

[0108] Using HiScribe TM T7 ARCA mRNA Kit (with tailing) was used for in vitro transcription as follows: Prepare the reaction solution according to the system shown in Table 4 below, and add each component at room temperature. Mix thoroughly and centrifuge, and incubate at 37°C for 30 minutes. Add 2 μL DNase I to the reaction, mix thoroughly, and incubate at 37°C for 15 minutes.

[0109] Table 4

[0110] Components volume Nuclease-free water Up to 20 μL 2×ARCA / NTP mixture 10μL 5mCTP, 100mM 0.25μL Pseudo-UTP, 100 mM 0.25μL Template DNA 1 μg T7 RNA Polymerase Mix 2μL Total reaction volume 20μL

[0111] Add a polyadenylic acid tail to the in vitro transcription product, prepare the reaction according to Table 5 below, mix thoroughly and centrifuge, and incubate at 37°C for 30 minutes. Precipitate and purify the mature transcription product, add 25μL of lithium chloride solution, and mix thoroughly. Incubate at -20°C for 30 minutes. Centrifuge at low temperature for 15 minutes, centrifuge at a maximum speed of 12000rpm to precipitate RNA, carefully remove the supernatant, wash the precipitate with 500μL of cooled 70% ethanol, centrifuge at low temperature for 10 minutes, remove the supernatant, and carefully remove the remaining supernatant. Air-dry the precipitate and resuspend the RNA with 50μL of 0.1mM EDTA. Heat at 65°C for 10 minutes until the RNA is completely dissolved. Store at -20°C.

[0112] Table 5

[0113]

[0114]

[0115] (8) In vitro RNaseH cleavage of target RNA:

[0116] Prepare the hybridization reaction between target RNA and ASO. Add 600ng of target RNA to 10μL system and add ASO at a ratio of 20:1. Anneal at 95℃ in PBS solution for 5 minutes and slowly cool to 25℃ in PCR instrument for more than 2 hours to generate RNA-ASO hybrid chains. Add 2μL of RNaseH reaction buffer to 10μL reaction solution, dilute RNaseH to 0.05U and add 1μL, and make up to 20μL with nuclease-free water. React at 37℃ for 20 minutes and terminate the reaction with 0.5M EDTA. Mix 20μL reaction solution with 20μL of RNA loading dye, heat at 80℃ for 10 minutes to anneal RNA sample and prepare for loading. Use 5% TBE-urea PAGE denaturing gel and electrophoresed in 1×TBE buffer, first run at 80V for 10 minutes; then 150V for 35 minutes. The gel was washed once with DEPC water for 2 minutes, and then RNA was labeled with M5 Hipure Gel Red Nucleic Acid Stain. The gel was washed twice with ultrapure water for 5 minutes each time and imaged.

[0117] (9) Extraction of total cell RNA

[0118] Wash the cells twice with PBS. Take a 24-well plate as an example. Add 500 μL of Trizol to completely lyse the cells and transfer to a 1.5 ml EP tube. Add one-fifth of the volume of chloroform, shake vigorously for 15 seconds, let stand at room temperature for 10 minutes, centrifuge at 12,000 rpm and 4°C for 15 minutes to separate the liquid phase. Carefully aspirate the upper aqueous phase and transfer it to a new EP tube. Add an equal volume of isopropanol and mix well. Incubate at room temperature for 10 minutes and centrifuge at 12,000 rpm and 4°C for 15 minutes. Remove the supernatant and keep the precipitate. Wash the precipitate twice with 75% ethanol, dry it, dissolve it with RNase-free water, and store it.

[0119] (10) Nucleic acid imprint hybridization experiment (Northern hybridization experiment)

[0120] Soak the gel plate, gel tank and comb in 3% hydrogen peroxide solution for 30 minutes, then wash with DEPC water for 3 times; prepare 1.2% formaldehyde denatured gel, weigh 1.44g agarose gel, add 102mL DEPC water, melt by microwave heating, then add 12mL 10×MOPS buffer and 6mL formaldehyde, mix well and pour into the gel tank, solidify at room temperature for 1-2 hours; add appropriate amount of 5× RNA loading buffer to RNA sample, mix well, heat at 65℃ for 5 minutes, and immediately transfer to ice for 5 minutes; spot sample, set voltage to 70V, and electrophoresed for 4 hours. After electrophoresis, wash the gel with 50mL DEPC water for 3 times, 10 minutes each time; transfer DNA in the gel to positively charged nylon membrane (Hybond-N+Membrane, Amersham) by capillary transfer with 20×SSC as medium, and the transfer time is not less than 20 hours. After the transfer, place the nylon membrane face up on the filter paper and heat at 120 mJ / cm 2Energy, UV cross-linking DNA and nylon membrane. The cross-linked nylon membrane was washed once with deionized water, air-dried at room temperature and transferred to a hybridization tube, 5 mL of preheated DIG Easy Hyb hybridization solution was added, and the hybridization tube was placed in a 50°C hybridization oven for pre-hybridization for 1 to 2 hours. Take 400 μL of DIGEasy Hyb hybridization solution, add 2 μL of digoxigenin-labeled full-length HBV probe, heat in a boiling water bath for 5 minutes, cool on ice for 5 minutes, and then transfer it to 4.6 mL of DIG Easy Hyb hybridization solution, mix well, and prepare probe hybridization solution. Discard the pre-hybridization solution, add the probe hybridization solution, and hybridize overnight at 50°C. Discard the hybridization solution, add 50 mL of 0.1% SDS 2×SSC solution, place on a horizontal shaker, wash the membrane at a low speed (60-100 rpm) for 15 minutes, and repeat twice. Add 50mL of 0.1% SDS in 0.5×SSC solution, place in a 65℃ water bath shaker, wash the membrane at low speed (60-100rpm) for 15min, repeat twice. Rinse the nylon membrane with membrane washing buffer, add 50mL of 1× blocking solution, place in a horizontal shaker, and incubate at room temperature at low speed (60-100rpm) for 30min. Transfer the nylon membrane to a hybridization tube, add 5mL of DIG-AP antibody (1:10000) diluted in 1× blocking solution, place in a hybridization oven, and incubate at room temperature for 30min. Add 50mL of membrane washing buffer, wash the membrane at low speed (60-100rpm) for 15min on a horizontal shaker, repeat twice. Add 50mL of detection buffer, place in a horizontal shaker, and incubate at low speed (60-100rpm) for 5min. Add 500 μL CSPD developer and incubate with the nylon membrane at room temperature for 5 min, incubate with medical X-ray film at 37°C for 2 h, and expose and develop the color using the ECL chemiluminescence method.

[0121] (11) Detect HBV RNA transcripts at PLC / PRF / 5 by qPCR using the following primer pair:

[0122] Forward primer (5'-3'): TGTTGCCCGTTTGTCCTCTA (SEQ ID NO: 89),

[0123] Reverse primer (5'-3'): GGGATGGGAATACAGGTGCA (SEQ ID NO: 90).

[0124] Example 1. Sequence screening of the 60 nt region of HBsAg

[0125] The 60nt sequence (SEQ ID NO: 2) of nucleotides 455 to 514 in the transcript sequence (SEQ ID NO: 1) encoding HBsAg of HBV genotype D was selected as the targeting region. Oligonucleotide ASOs of different lengths were designed (Table 6 below). The ASO is designed as a crossover design of LNA and DNA, with 2 to 3 consecutive locked nucleic acids at the 5' and 3' ends, and a crossover arrangement of LNA and DNA in the middle. This designed ASO occupies the target RNA through base complementary pairing, and does not cause RNaseH-dependent cutting of the target RNA. The ASO drug GSK836 (Nanjing GenScript Biotechnology Co., Ltd.) was used as a positive control.

[0126] Table 6

[0127]

[0128]

[0129] Note: “!” represents locked nucleic acid modification; * represents phosphorothioate internucleoside linkage.

[0130] Each ASO in Table 6 was transfected into HepAD38 cells, and the cell culture supernatant was collected 48 hours after transfection for HBsAg detection. Figure 1 A- Figure 1 K. The results showed that both 24nt ASO-20 and 30nt ASO-28 showed activity in reducing HBsAg, while 18nt ASOs were inactive. By comparing the sequences of ASO-20 and ASO-28, it was found that the 3' ends of the two ASOs were located at the same position.

[0131] In addition, the effects of ASO-19, ASO-20, ASO-27 and ASO-28 on two antigens, HBsAg and HBeAg, were also tested after they were transfected into HepAD38 cells. Figure 2 A and Figure 2 As shown in Figure B. The results showed that ASO-20 and ASO-28 could specifically reduce HBsAg but did not affect the level of HBeAg. This phenomenon indicates that the regions targeted by ASO-20 and ASO-28 can specifically regulate the production of HBsAg.

[0132] Example 2. Gapmer-designed ASO-48 is capable of degrading HBV RNA

[0133] In this example, the sequence of ASO-20 was kept unchanged, and ASO-48 (Table 7) was designed using a gapmer ASO modified with a locked nucleic acid. In theory, the continuous DNA sequence in the middle of the gapmer ASO binds to the target RNA and can activate RNaseH to cleave the target RNA.

[0134] Table 7

[0135]

[0136] Note: “!” represents locked nucleic acid modification; * represents phosphorothioate internucleoside linkage.

[0137] ASO-48 was transfected into HepAD38 cells, and the cell culture supernatant was collected for 48 hours to detect HBsAg and HBeAg. Figure 3 A and Figure 3 As shown in B. In the HepAD38 cell line, transfection with ASO-48 can effectively reduce the levels of HBeAg and HBsAg, while the space-occupying ASO-20 can reduce HBsAg and has almost no effect on HBeAg. Analysis of intracellular HBV RNA found that ASO-48 reduced the level of HBV RNA, while ASO-20 had almost no effect on 3.5kb RNA, but significantly reduced the level of 2.1kb preS2 / S RNA ( Figure 4 ). It is worth noting that in HepAD38 cells, ASO-48 was significantly more effective than GSK836 in reducing HBeAg, while its effect on HBsAg was similar.

[0138] To further verify the target RNA cleavage function of ASO-48, a 300nt sequence in a 2.1kb RNA was transcribed in vitro. Through an in vitro RNaseH cleavage experiment, it was found that ASO-48 could activate RNaseH to cleave the target RNA, while ASO-20, which was a placeholder, did not activate RNaseH to cleave the target RNA ( Figure 5 ).

[0139] Example 3. Antiviral activity of the second generation modified ASO

[0140] In this example, the sequence of ASO-48 was kept unchanged, and ASO96 was obtained by second-generation modification, and a series of ASO88 to ASO95 of the same length were designed (as shown in Table 8). Different ASOs were transfected into HepAD38 cells, and the cell culture supernatant was collected for 48 hours to detect HBsAg. The results are shown in Figure 6 As shown. The results showed that the second-generation modified ASO96 showed the strongest biological activity, while the biological activity of ASOs with -1nt and +1nt shifts gradually decreased, but still had significant biological activity. ASO88 with -4nt shift and ASO93 with +2nt differed from ASO96 by about 20% at a concentration of 100nM.

[0141] In order to verify the effect of shortening the length of ASO on activity, ASO96 was gradually shortened by 1 nt from the 5' end to obtain ASO80~ASO83 (see Table 8); ASO84~ASO87 were gradually shortened by 1 nt from the 3' end (see Table 8). Different ASOs were transfected into HepAD38 cells, and the cell culture supernatant was collected for 48 hours to detect HBsAg. The results are shown in Figure 7 A and Figure 7 As shown in Figure B, the results show that when ASO is shortened to 22 nt, ASO81 maintains its activity, while ASO82 and ASO83 almost lose their biological activity. ASO86 and ASO87 with shortened 3' ends obviously lose their biological activity. This result also shows that using ASO to target nucleotides 455 to 514 in the transcript sequence encoding HBsAg (SEQ ID NO: 1), especially targeting nucleotides 482 to 505, can significantly reduce HBV RNA and antigen levels.

[0142] Table 8

[0143]

[0144]

[0145] Note: * represents phosphorothioate internucleoside bond; i2MOE represents 2'-methoxyethyl; i5Me-C represents 5-methylcytosine; d represents deoxyribonucleotide; r represents ribonucleotide.

[0146] Example 4 Verification of ASO activity in HepG2-NTCP infection system

[0147] According to the results of Example 3, ASO-48, ASO-81, ASO-91, ASO-92, and ASO-96 were selected as lead ASOs to further verify their functions.

[0148] The HepG2-NTCP infected cell line is a suitable model for studying cccDNA-derived HBV RNA. After HBV infection of HepG2-NTCP cells for 72 hours to establish cccDNA, the lead ASO-48, ASO-81, ASO-91, ASO-92, and ASO-96 were transfected to detect biological activity. The results are shown in Figure 8 A and Figure 8 B shows that the results show that the lead ASO-48, ASO-81, ASO-91, ASO-92, and ASO-96 all have the activity of reducing HBeAg and HBsAg. The HBV RNA level is consistent with the antigen level, such as Figure 8 C.

[0149] Example 5 Activity of ASO-48 on PLC / PRF / 5 integrated cell line

[0150] PLC / PRF / 5 cells are a cell line isolated and cloned from liver cancer patients, which can stably express HBsAg antigen. There are many HBV genome integrations in PLC / PRF / 5 cells, so it is a suitable in vitro model for studying ASO targeted integration of HBsAg.

[0151] The lead ASO-48, ASO-81, ASO-91, ASO-92, and ASO-96 of Example 3 were transfected into PLC / PRF / 5 cells, and then the level of S antigen was detected. Fig. 9 In addition, the biological activity of these ASOs was tested by detecting the transcription level of 2.1kb preS2 / S RNA. Fig. 9 As shown in B. Fig. 9 A and Fig. 9 From the results of B, it can be seen that locked nucleic acid-modified ASO-48 and second-generation modified ASO-81, ASO-91, ASO-92, and ASO-96 can significantly reduce the levels of integrated HBsAg and 2.1kb preS2 / S RNA.

[0152] The specific sequence of SEQ ID NO: 1 involved in the present disclosure is as follows:

[0153]

[0154] The specific sequence of SEQ ID NO: 2 involved in the present disclosure is as follows:

[0155] TCTTCTTGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCCGTTTGTCCTCTAATTCC AG (SEQ ID NO: 2).

[0156] The technical solution of the present disclosure is not limited to the above-mentioned specific embodiments, and all technical variations made according to the technical solution of the present disclosure fall within the protection scope of the present disclosure.

Claims

1. A compound, characterized in that The compound includes an oligonucleotide molecule with a length of 8 to 50 linked nucleosides, which is complementary to a portion of the sequence shown in SEQ ID NO: 2, or is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% complementary to the sequence shown in SEQ ID NO:

2.

2. The compound according to claim 1, characterized in that The oligonucleotide molecule has a nucleotide sequence of at least 20, preferably at least 21, more preferably at least 22 consecutive nucleobases, Preferably, the oligonucleotide molecule has a nucleotide sequence of 20 to 30 consecutive nucleobases.

3. The compound according to claim 1, characterized in that The oligonucleotide molecule is complementary to the following nucleotide sequence: the 5' end of the nucleotide sequence starts at any one of positions 476 to 486, preferably 476 to 483 of the sequence shown in SEQ ID NO: 1, and the 3' end ends at any one of positions 501 to 509, preferably 503 to 506 of the sequence shown in SEQ ID NO:

1.

4. The compound according to claim 1, characterized in that The oligonucleotide molecule has a nucleotide sequence comprising at least 8 consecutive nucleobases of at least one of SEQ ID NOs: 45 to 86; and / or The oligonucleotide molecule has a nucleotide sequence containing at least one of SEQ ID NOs: 45 to 86, or a nucleotide sequence having 1, 2 or 3 nucleotides inserted, substituted or deleted compared to the nucleotide sequence shown in SEQ ID NOs: 45 to 86.

5. The compound according to claim 1, characterized in that The oligonucleotide molecule comprises one or more locked nucleotides, modified nucleotides and / or modified locked nucleotides, Preferably, the oligonucleotide molecule comprises one or more modified internucleoside linkages selected from phosphorothioate internucleoside linkages, chiral phosphorothioate linkages and phosphorodithioate linkages.

6. The compound according to claim 5, characterized in that The modified oligonucleotide contains at least one modified nucleotide or internucleoside bond selected from the group consisting of phosphorothioate internucleoside bonds, chiral phosphorothioate bonds and phosphorodithioate locked nucleic acids, 2'-methoxyethyl modified nucleotides, 2'-O-methyl modified nucleotides, C1 to C5 alkyl modified nucleotides, terminal nucleotides linked to a cholesterol derivative, terminal nucleotides linked to a dodecanoic acid didecylamide group, 2'-deoxy-2'-fluoro modified nucleotides, 2'-deoxy modified nucleotides, abasic nucleotides, deoxythymidine, inverted deoxythymidine, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, phosphoramidates, sugar mimetics, and nucleotides containing non-natural bases.

7. The compound according to claim 1, characterized in that The oligonucleotide molecule has a nucleotide sequence containing at least one of SEQ ID NOs: 91-132, or a nucleotide sequence having 1, 2 or 3 nucleotides inserted, substituted or deleted compared to the nucleotide sequence shown in SEQ ID NOs: 91-132.

8. The compound according to claim 1, characterized in that The compounds are capable of reducing the levels of HBsAg and / or HBeAg.

9. The compound according to claim 1, characterized in that The compound is single-stranded or double-stranded.

10. A pharmaceutical composition comprising the compound according to any one of claims 1 to 9, and a pharmaceutically acceptable carrier.

11. A kit comprising the compound according to any one of claims 1 to 9, and a container containing the compound.

12. A pharmaceutical combination comprising a compound according to any one of claims 1 to 9, and a second therapeutic agent.

13. Use of the compound according to any one of claims 1 to 9, the pharmaceutical composition according to claim 10, the kit according to claim 11 or the pharmaceutical combination according to claim 12 in the preparation of a medicament for preventing and / or treating hepatitis B virus-related diseases.

14. The use according to claim 13, characterized in that The hepatitis B virus-related disease is a disease caused by hepatitis B virus infection, preferably including at least one of chronic liver disease, inflammation, fibrosis, cirrhosis, liver cancer, serum hepatitis, jaundice, liver cancer, liver inflammation, liver fibrosis, cirrhosis, liver failure, diffuse hepatocellular inflammatory disease, hemophagocytic syndrome, serum hepatitis, HBV viremia or transplantation related to liver disease.

15. A method for preventing and / or treating a hepatitis B virus-related disease in a subject, comprising administering to the subject the compound of any one of claims 1 to 9, the pharmaceutical composition of claim 10, or the pharmaceutical combination of claim 12.

Images