Application of chimeric SFT2D2-TBX19 in diagnosis and treatment of prostatic cancer

Abstract

The invention provides an application of chimeric SFT2D2-TBX19 in diagnosis and treatment of prostatic cancer, and particularly relates to an application of the chimeric SFT2D2-TBX19 as a marker in diagnosis and treatment of prostatic cancer. The nucleotide sequence of the chimeric SFT2D2-TBX19 disclosed by the invention is as shown in SEQ ID NO.1. The overexpression of the chimeric SFT2D2-TBX19 promotes the proliferation, migration and invasion of prostate cancer cells; the chimeric SFT2D2-TBX19 is used for encoding the TBX19-202 protein, the TBX19-202 protein encoded by the chimeric SFT2D2-TBX19 has a carcinogenic effect similar to that of a parent TBX19 in the aspect of promoting the progress of prostatic cancer, and the amino acid sequence of the TBX19-202 protein is shown as SEQ ID NO. 4. Specific high expression of the chimeric SFT2D2-TBX19 in a neuroendocrine prostate cancer (NEPC) cell line is found for the first time, and a new target spot is provided for diagnosis and treatment of related diseases, so that a clinician is guided to provide a prevention method or a treatment scheme for a subject.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the application of chimeric SFT2D2-TBX19 in the diagnosis and treatment of prostate cancer. Background Art

[0002] Prostate cancer is one of the most common malignant tumors in men, and its incidence and mortality are on the rise worldwide. Traditional diagnostic methods include blood prostate cancer specific antigen (PSA) level detection, imaging examination, and prostate tissue biopsy. As an important detection method for the diagnosis and treatment of prostate cancer, blood PSA also has its limitations. Due to the progressive characteristics of prostate cancer from hormone sensitivity, castration resistance to neuroendocrine type, blood PSA level cannot represent the development period of the diagnosed prostate cancer. Imaging examination and prostate tissue biopsy are also unable to show the progression period of prostate cancer. Therefore, it is of great significance to find new diagnostic markers and therapeutic targets.

[0003] In recent years, the role of gene fusion and its resulting chimeric products in tumorigenesis and development has received extensive attention, providing new ideas for the diagnosis and treatment of prostate cancer. Specific gene fusion and its resulting fusion products, including chimeric RNA and chimeric proteins, have long been considered ideal tumor diagnostic markers and therapeutic targets. Chimeric RNA can mediate tumor cell plasticity, neuroendocrine processes, polarization of tumor-associated macrophages, and chemotherapy and immunotherapy resistance. However, the study of chimeric RNA in prostate cancer is still in its early stages. Therefore, chimeric RNA has very important significance and clinical value as a marker for the diagnosis of prostate cancer and a target for drug treatment. Summary of the invention

[0004] Based on this, the purpose of the present invention is to provide a chimeric SFT2D2-TBX19 for use in the diagnosis and treatment of prostate cancer. The chimeric SFT2D2-TBX19 and the TBX19-202 protein encoded by it can promote the proliferation, migration and invasion of prostate cancer cells, and are specifically highly expressed in neuroendocrine prostate cancer (NEPC) cell lines. Therefore, the chimeric SFT2D2-TBX19 can be used as a marker for the diagnosis and treatment of prostate cancer.

[0005] To achieve the above object, the present invention adopts the following technical solution.

[0006] A chimeric SFT2D2-TBX19 is used as a marker for diagnosing prostate cancer, wherein the chimeric SFT2D2-TBX19 contains a nucleotide sequence as shown in SEQ ID NO.1; or contains a nucleotide sequence as shown in SEQ ID NO.1 with one or more nucleotides replaced, deleted or added in the sequence, but has the same function.

[0007] Furthermore, it also includes a primer pair or probe for amplifying a specifically identified nucleotide sequence, wherein the primer pair or probe includes a nucleotide sequence generated according to the upstream gene nucleotide sequence and a nucleotide sequence generated according to the downstream gene nucleotide sequence; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3.

[0008] The present invention also provides a prostate cancer detection kit, which comprises a reagent for detecting the marker as claimed in claim 1 or 2, or the content of the protein expressed by the marker as claimed in claim 1 or 2.

[0009] The present invention also provides the use of chimeric SFT2D2-TBX19 as a marker for diagnosing prostate cancer in the treatment of prostate cancer, including TBX19-202 protein, wherein the TBX19-202 contains the amino acid sequence shown in SEQ ID NO.4; or contains the amino acid sequence shown in SEQ ID NO.4 by replacing, deleting or adding one or more amino acids, and has a sequence with the same function.

[0010] The present invention also provides a prostate cancer diagnostic reagent, which comprises an antibody or antibody fragment that specifically recognizes a protein expressed by a chimeric SFT2D2-TBX19 and / or a TBX19-202 protein.

[0011] The present invention also provides a composition for diagnosing, detecting, monitoring or predicting the progression of prostate cancer, comprising a chimeric SFT2D2-TBX19, a TBX19-202 protein, a nucleic acid affinity ligand and / or a peptide affinity ligand for the TBX19-202 protein;

[0012] Preferably, the progression of prostate cancer includes at least proliferation, migration and invasion of cancer cells;

[0013] Preferably, the affinity ligand comprises at least an aptamer specific to the TBX19-202 protein, an antibody specific to the TBX19-202 protein and / or an antibody variant specific to the TBX19-202 protein.

[0014] The present invention also provides the use of a substance capable of inhibiting the expression and / or activity reduction of a chimeric SFT2D2-TBX19 and / or TBX19-202 protein in prostate cancer cells, wherein the use is at least one of the following (a')-(c'):

[0015] (a') inhibiting the proliferation of prostate cancer cells, or preparing a product for inhibiting the proliferation of prostate cancer cells;

[0016] (b') inhibiting the migration of prostate cancer cells, or preparing a product for inhibiting the migration of prostate cancer cells;

[0017] (c') inhibiting the invasion of prostate cancer cells, or preparing a product for inhibiting the invasion of prostate cancer cells.

[0018] The present invention also provides a pharmaceutical composition for treating or preventing prostate cancer, comprising chimeric RNA

[0019] A substance that reduces the expression and / or activity of SFT2D2-TBX19 and / or TBX19-202 protein.

[0020] Furthermore, the substances include TBX19-202-specific antibodies, RNA interference molecules or antisense oligonucleotides against chimeric SFT2D2-TBX19, small molecule inhibitors, and siRNA.

[0021] Furthermore, the pharmaceutical composition further comprises at least one or more pharmaceutically or food-acceptable excipients.

[0022] Preferably, the auxiliary materials include at least one of excipients, fillers, extenders, binders, humectants, disintegrants, solubilizers, adsorbents, diluents, solubilizers, emulsifiers, lubricants, wetting agents, suspending agents, flavoring agents and fragrances.

[0023] Preferably, the drug is a solid oral preparation, a liquid oral preparation or an injection.

[0024] Further preferably, the drug is a tablet, a dispersible tablet, an enteric-coated tablet, a chewable tablet, an orodisintegrating tablet, a capsule, a sugar-coated tablet, a granule, a dry powder, an oral solution, a small water injection for injection, a lyophilized powder injection for injection, a large infusion or a small infusion.

[0025] The present invention discovered for the first time that the transcription level of chimeric SFT2D2-TBX19 was highest in the neuroendocrine prostate cancer (NEPC) cell line NCI-H600, indicating that SFT2D2-TBX19 was closely related to the malignant progression of prostate cancer; and knockdown of chimeric SFT2D2-TBX19 inhibited the proliferation, cloning, migration and invasion of prostate cancer cells, suggesting that chimeric SFT2D2-TBX19 can be used for auxiliary diagnosis and prognosis evaluation of prostate cancer.

[0026] Furthermore, the inventors also found that the chimeric SFT2D2-TBX19 can encode a protein TBX19-202. The TBX19-202 protein has similar carcinogenic effects as the parent TBX19 in promoting the progression of prostate cancer. Overexpression in prostate cancer cells significantly promotes the proliferation, cloning, migration and invasion of prostate cancer. In addition, the chimeric SFT2D2-TBX19 can also act as a lncRNA to enhance the phosphorylation of ATP synthase F1 subunit ATP5F1A through TNK2 / ACK1, thereby stabilizing the interaction with ATP5F1B. This stable interaction protects the mitochondrial structure and promotes the production of ATP, thereby promoting the proliferation, migration and invasion of prostate cancer cells. Therefore, chimeric SFT2D2-TBX19 can be used as a marker for the diagnosis of prostate cancer and a target for drug treatment. Intervention targeting the multiple mechanisms of action of chimeric SFT2D2-TBX19 and its encoded protein TBX19-202 can effectively inhibit the growth and progression of prostate cancer without obvious damage to normal tissues. It ensures good anti-tumor properties while making up for the shortcomings of traditional chemotherapy drugs with many side effects, and has good prospects for clinical transformation. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 Figure 2 is the result of the identification of chimeric SFT2D2-TBX19 as a novel oncogenic chimeric RNA; A: the process of discovering and validating chimeric RNA from the CPGEA database; B: the distribution of 58 differentially expressed chimeric RNAs in four prostate cancer cell lines (36 chimeric RNAs are listed here); C: survival probability analysis; D: primer design, PCR identification and analysis to verify the full length of SFT2D2-TBX19 (green and red modules represent exons, black lines represent introns or intergenic regions, and arrows indicate forward and reverse primers for PCR amplification); E: Sanger sequencing results; F: schematic diagram of the cis-splicing between adjacent genes (cis-SAGe) experiment (green and red modules represent exons, black lines represent introns or intergenic regions, and arrows indicate oligonucleotide primers used for reverse transcription); G: (left) RNA reverse transcription and PCR amplification results, (right) Sanger sequencing; H: clone formation experiment; I: migration and invasion analysis (the scale bar in the lower left corner represents 200 μm). C: COX risk regression model analysis; H, I: Data are expressed as mean ± SD (n is 3 replicates), t test, *p < 0.05, **p < 0.01, ***p < 0.001.

[0028] Figure 2The chimeric SFT2D2-TBX19 can encode TBX19-202 protein and functional research results; (A): clone formation experiment; (B): migration and invasion analysis (the scale bar in the lower left corner represents 200μm); (C): nude mouse subcutaneous tumor formation experiment; (D): RNA fluorescence in situ hybridization (the scale bar in the lower left corner represents 20μm); (E): RT-qPCR analysis and agarose gel verification; (F): PCR amplification after ribosomal RNA extraction; (G): sequence comparison on the UCSC website; (H): plasmid construction and prediction; (I): RT-qPCR evaluation of overexpression; (JL) blotting and immunoprecipitation experiments (the location of the marker protein is shown in red). Data are expressed as mean ± SD; A, B, I: n is 3 replicates, t test; C: n is 5 replicates, t test, **p<0.01, ***p<0.001.

[0029] Figure 3 The figure shows the research results of the relationship between parental TBX19 and prostate cancer; among them, (A): cloning experiment; (B): migration and invasion analysis (the scale bar in the lower left corner represents 200μm); (CD): prognosis analysis in the TCGA database; (EH): expression analysis in the TCGA database; (I): siRNA design for TBX19 knockdown; (JK): cell function analysis after TBX19 knockdown; (LM): cell function analysis after TBX19 overexpression (the scale bar in the lower left corner represents 200μm); (N): molecular function enrichment analysis; (O): cell function analysis of ATG mutant SFT2D2-TBX19 (the scale bar in the lower left corner represents 200μm). Data are expressed as mean ± SD; A, B, IM, O: n is 3 replicates, t test; C, D: COX risk regression model analysis; EH: Kruskal-Wallis test, *p < 0.05, **p < 0.01, ***p < 0.001.

[0030] Figure 4 The results of the study on the interaction between chimeric SFT2D2-TBX19 and ATP synthase are shown in Figure 1. (A): Cell migration, invasion phenotype and statistical analysis (the scale bar in the lower left corner represents 200 μm); (B): Cell viability test and proliferation rate analysis; (C): RNA pulldown and mass spectrometry sequencing; (D): Western blot analysis; (E) Immunofluorescence colocalization (the scale bar in the lower left corner represents 20 μm); (F): Immunoprecipitation and RT-qPCR, agarose gel electrophoresis analysis; (GH) RNA sequencing and molecular function enrichment analysis. Data are expressed as mean ± SD; B, F: n is 3 replicates, Fisher's LSD comparison between groups in one-way ANOVA, *p<0.05, **p<0.01, ***p<0.001.

[0031] Figure 5 The results of the study on the mechanism of chimeric SFT2D2-TBX19 regulating ATP synthase; (A): Western blot of ATP5F1A and ATP5F1B; (BC): Protein degradation analysis of ATP5F1A and ATP5F1B; (D): Phosphorylation analysis of ATP5F1A; (E): Immunoprecipitation analysis of TNK2 / ACK1; (FG): Immunoprecipitation analysis of ATP5F1B and ATP5F1A; (H): Immunofluorescence co-localization (the scale bar in the lower left corner represents 20 μm); (I): Analysis of mitochondrial oxygen consumption and ATP production. Data are expressed as mean ± SD, n is 3 replicates, t test, ***p < 0.001; (J): Analysis of ATP synthase activity.

[0032] Figure 6 The results of the effect of chimeric SFT2D2-TBX19 on mitochondrial function under docetaxel are shown in the figure; wherein, (A): IC50 analysis after docetaxel treatment; (B): ATP5F1A phosphorylation analysis; (C): phosphokinase TNK2 / ACK1 immunoprecipitation analysis; (DE): ATP5F1A / B immunoprecipitation analysis; (F): Immunofluorescence co-localization analysis (the scale bar in the lower left corner represents 20 μm); (GH): mitochondrial membrane potential analysis (the scale bar in the lower left corner represents 100 μm); (IJ): mitochondrial ultramorphology analysis (the scale bar in the lower left corner represents 500 nm); (K): RT-qPCR analysis of mtDNA and HBB levels (HBB is used as a mitochondrial internal reference gene); (L): mitochondrial stress and ATP production analysis. Data are expressed as mean ± SD; I, J: n is 2 replicates, t-test; K: n is 3 replicates, Fisher's LSD comparison among groups by one-way ANOVA; L: n is 5 replicates, t-test, *p<0.05, **p<0.01, ***p<0.001.

[0033] Figure 7The results of determining the key domains of chimeric SFT2D2-TBX19 and ATP5F1A; (A): SFT2D2-TBX19 truncation and its agarose gel identification; (BC): Pulldown and its analysis; (DE): Domain division of ATP5F1A and its western blot verification; (FG): RIP and its immunoprecipitation analysis; (H): ATP5F1A and ATP5F1B knockdown verification; (IJ): Cloning analysis; (KL): Migration and invasion analysis. Data are expressed as mean ± SD. G: n is 3 replicates, t test; J, L: n is 3 replicates, Fisher's LSD comparison between groups in one-way ANOVA, ns-no significant difference, *p<0.05, **p<0.01 compared with oe S-T+siNC; #p<0.05, compared with vector+siNC.

[0034] Figure S1 Figure 1 shows the results of chimeric RNA supplementary validation and SFT2D2-TBX19 expression analysis; (A): 36 chimeric RNAs validated by agarose gel electrophoresis; (B): Validation of the other 22 chimeric RNAs in various cell lines; (C): Relationship between ERV3-1-ZNF506 expression and survival probability; (D): SFT2D2-TBX19 transcription levels in tumors and adjacent tissues; (E): Relative levels of SFT2D2-TBX19 transcripts in various cell lines; (F) Effects of SFT2D2-TBX19 overexpression on PC3 cell migration and invasion (the scale bar in the lower left corner represents 200 μm). Data are expressed as mean ± SD. D: n is 21 replicates, paired t test; F, n is 3 replicates, t test, *p<0.05, ***p<0.001.

[0035] Figure S2 The results of the chimeric SFT2D2-TBX19 knockdown supplement experiment are shown in Figure 1. (A): RT-qPCR analysis of the RNA levels of chimeric SFT2D2-TBX19, parental SFT2D2, and TBX19; (B): Western blot analysis of the protein levels of parental SFT2D2 and TBX19; (C): Cell viability test; (D): Migration and invasion analysis (the scale bar in the lower left corner represents 200 μm); (EF): Scratch test and statistical analysis (the scale bar in the lower left corner represents 200 μm). Data are expressed as mean ± SD, n is 3 replicates, t test, ns-no significant difference, *p<0.05, **p<0.01, ***p<0.001.

[0036] Figure S3Supplementary experimental results for the chimeric SFT2D2-TBX19 encoded protein; wherein, (A): RNA fluorescence in situ hybridization; (B): ORF comparison of TBX19 and TBX19-202; (C): Changes in TBX19-202 protein; (D): RT-qPCR verification of TBX19-202 overexpression; (E): Cell viability test; (F): Migration and invasion analysis (the scale bar in the lower left corner represents 200 μm); (GH): Scratch recovery and its analysis (the scale bar in the lower left corner represents 200 μm), data are expressed as mean ± SD, n is 3 replicates, t-test, *p<0.05, **p<0.01, ***p<0.001.

[0037] Figure S4 Supplementary experimental results for knockdown and overexpression of parental TBX19; (A): cell viability test (TBX19 knockdown); (B): migration and invasion analysis (TBX19 knockdown, the scale bar in the lower left corner represents 200 μm); (CD): scratch recovery and analysis (TBX19 knockdown, the scale bar in the lower left corner represents 200 μm); (E): RT-qPCR analysis; (F): Western blot analysis (TBX19 overexpression); (G): cell viability test (TBX19 overexpression); (H): migration and invasion analysis (TBX19 overexpression, the scale bar in the lower left corner represents 200 μm); (IJ): scratch recovery and analysis (TBX19 overexpression, the scale bar in the lower left corner represents 200 μm). Data are expressed as mean ± SD, n is 3 replicates, t test, *p < 0.05, **p < 0.01, ***p < 0.001.

[0038] Figure S5 The results of the study on the relationship between SFT2D2 lncRNA and prostate cancer are shown in Figure 1. (A): survival probability analysis; (B): RT-qPCR analysis; (C): cell viability test; (D): migration and invasion analysis (the scale bar in the lower left corner represents 200 μm). Data are expressed as mean ± SD, n is 3 replicates, t test, ***p < 0.001.

[0039] Figure S6 Supplementary analysis results for chimeric SFT2D2-TBX19; (AF): relative levels of chimeric SFT2D2-TBX19 and parental TBX19 transcripts (red arrows point to the corresponding amplification curves); (G): RT-qPCR analysis of SFT2D2-TBX19 (ATGmut) transcripts; (H) cell viability test; (I) migration and invasion analysis (the scale bar in the lower left corner represents 200 μm). Data are expressed as mean ± SD, n is 3 replicates, t test, *p < 0.05, **p < 0.01, ***p < 0.001.

[0040] Figure S7 for Figure 4 Figures of the relevant supplementary experimental results; (A): Detection of TBX19 and TBX19-202 proteins; (B): Relative transcription levels of chimeric SFT2D2-TBX19 or SFT2D2-TBX19 (ATGmut); (C): Migration and invasion analysis (the scale bar in the lower left corner represents 200 μm); (D): Cell viability test and proliferation rate analysis. Data are expressed as mean ± SD; B, D: n is 3 replicates, Fisher's LSD comparison between groups in one-way ANOVA, ns-no significant difference, *p<0.05, **p<0.01, ***p<0.001.

[0041] Figure S8 for Figure 5 and Figure 6 Related supplementary experimental results; (A) co-immunoprecipitation analysis; (BC) protein degradation analysis after cyclohexamide treatment; (DE) fluorescence intensity assessment of cellular reactive oxygen species (ROS); (F) mitochondrial reactive oxygen species detection; (G) Pulldown Western blot analysis; (H) relative levels of chimeric SFT2D2-TBX19 and parental TBX19 transcripts in mitochondria (red arrows point to the corresponding amplification curves ST and parental TBX19); (I) ATP synthase activity analysis. Data are expressed as mean ± SD; E: n is 3 replicates, Fisher's LSD comparison between groups by one-way ANOVA; F, n is 3 replicates, t-test, **p<0.01, ***p<0.001.

[0042] Figure S9 Other related supplementary experimental results; (A): Effects of ATP5F1A and ATP5F1B knockdown on protein levels; (BC): Migration and invasion analysis; (DE): Scratch recovery analysis (the scale bar in the lower left corner represents 200 μm); (F): Correlation heat map; (G): RT-qPCR analysis of pten transcripts. Data are expressed as mean ± SD, n is 3 replicates, Fisher's LSD comparison between groups in one-way ANOVA; ns-no significant difference, *p<0.05, **p<0.01 compared with oe S-T+siNC; #p<0.05, ##p<0.01 compared with vector+siNC; G: n is 3 replicates, t test, **p<0.01, ***p<0.001. DETAILED DESCRIPTION

[0043] The experimental methods in the following examples of the present invention, where no specific conditions are specified, are usually carried out under conventional conditions or under conditions recommended by the manufacturers. The various commonly used chemical reagents used in the examples are all commercially available products.

[0044] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0045] The terms "including" and "having" and any variations thereof of the present invention are intended to cover non-exclusive inclusions. For example, a process, method, device, product or equipment comprising a series of steps is not limited to the listed steps or modules, but may optionally include steps not listed, or may optionally include other steps inherent to these processes, methods, products or equipment.

[0046] The ST mentioned in the present invention is the abbreviation of the chimeric SFT2D2-TBX19, and the "plurality" mentioned in the present invention refers to two or more. "And / or" describes the association relationship of the associated objects, indicating that three relationships can exist. For example, A and / or B can represent: A exists alone, A and B exist at the same time, and B exists alone. The character " / " generally indicates that the associated objects before and after are in an "or" relationship.

[0047] The following describes the invention in conjunction with specific embodiments.

[0048] Example 1 Discovery and characterization of chimeric SFT2D2-TBX19

[0049] Chimeric RNA is a transcript composed of exons from two independent maternal genes. There are three mechanisms for the formation of chimeric RNA: chromosome rearrangement, trans-splicing, and cis-splicing. In terms of non-coding, they can play the role of long non-coding RNA or circular RNA to mediate the biological metabolism of cells. As for coding, they can encode chimeric proteins or novel proteins, or regulate the expression of maternal genes through their translational regulatory regions. Chimeric RNA can mediate tumor cell plasticity, neuroendocrine processes, polarization of tumor-associated macrophages, and chemotherapy and immunotherapy resistance. At present, a large number of studies have found that the dysregulated expression of chimeric RNA is closely related to the occurrence of human diseases. More importantly, its dysregulated expression is tissue-specific and can be easily and stably detected in body fluids. Therefore, chimeric RNA has great clinical application potential as a tumor diagnostic marker.

[0050] 1. Search and analysis of public databases

[0051] The inventors of this application screened out chimeric RNAs from the raw data of the Chinese Prostate Cancer Genome and Epigenome Atlas (CPGEA) and constructed a chimeric RNA database. The inventors have completed the screening in the early stage and announced this part at the CUA2022 conference. In the present invention, the inventors selected 58 chimeric RNAs that were verified in the RNA mixture of prostate cancer cell lines.

[0052] 2. Experimental screening and verification

[0053] Subsequently, these 58 chimeric RNAs were validated in six prostate cancer cell lines and the prostate epithelial cell line RWPE-1 by RT-qPCR amplification of each chimeric RNA-specific junction sequence. Figure 1 A, B and Figure S1 A, B). It was found that 16 of the 58 chimeric RNAs were specifically expressed in prostate cancer cell lines, and another 32 were highly expressed in prostate cancer cell lines. Among the above 48 chimeric RNAs, their expression was quantified using AGREP analysis (https: / / www.tgries.de / agrep / ) by retrieving specific junction sequences in CPGEA RNA-seq data. Only SFT2D2-TBX19 and ERV3-ZNF506 were associated with poor prognosis in prostate cancer patients ( Figure 1 C and Figure S1 C). Therefore, the study focused on the chimeric SFT2D2-TBX19 and verified its high expression in 21 pairs of prostate patient tumor samples ( Figure S1 D). The transcription level of SFT2D2-TBX19 was highest in the neuroendocrine prostate cancer (NEPC) cell line NCI-H600, indicating that SFT2D2-TBX19 is closely related to the malignant progression of prostate cancer.

[0054] Since the chimeric SFT2D2-TBX19 is a novel chimeric RNA that has not been reported before, PCR was performed using a permutation and combination approach to determine its full length ( Figure 1 D). Even when the forward primer closest to the 5' end of SFT2D2 and the reverse primer closest to the 3' end of TBX19 were used, the entire length of SFT2D2-TBX19 was successfully amplified. After recovering the amplified product, the junction sequence was identified by Sanger sequencing ( Figure 1E). Therefore, it was confirmed that SFT2D2-TBX19 contains the first 8 exons of the parental SFT2D2 gene and the last 7 exons of the parental TBX19 gene. Chimeric RNA is mainly produced by the following three ways: gene fusion, cis-splicing, and trans-splicing. Since SFT2D2 and TBX19 are adjacent genes, it is assumed that the chimeric RNA is formed by cis-splicing. To confirm this hypothesis, a cis-splicing (cis-SAGe) validation experiment between adjacent genes was further performed. Instead of using oligo-dT, we added specific TBX19 exon 2 primers to the reverse transcription system to amplify all transcripts containing the TBX19 exon 2 sequence. The junction sequence of intron 7 and exon 8 of SFT2D2 was amplified ( Figure 1 F, G), indicating the presence of a pre-mRNA that spans the junction sequence between SFT2D2 and TBX19. Therefore, the chimeric SFT2D2-TBX19 can be considered a product of a cis-splicing isoform (cis-SAGe).

[0055] Among them, the nucleotide sequence of the forward primer closest to the 5' end of SFT2D2 is: caacaggctgccgctgaggagctg (SEQ ID NO. 7);

[0056] The nucleotide sequence of the reverse primer closest to the 3′ end of TBX19 is: taggcctcaccctcgagaggcttacag (SEQ ID NO. 8);

[0057] The nucleotide sequence of the primer specific for exon 2 of TBX19 is: ctaatctttaggactggaaacatccg (SEQ ID NO. 9);

[0058] The nucleotide information of the chimeric SFT2D2-TBX19 is shown in SEQ ID NO.1:

[0059] SEQ ID NO.1:

[0060]

[0061] The nucleotide information of the forward primer of the chimeric SFT2D2-TBX19 is shown in SEQ ID NO.2:

[0062] SEQ ID NO.2: CGTGGTCCTGCATAGAGTGA;

[0063] The nucleotide information of the chimeric SFT2D2-TBX19 reverse primer is shown in SEQ ID NO.3:

[0064] SEQ ID NO. 3: AGTCCGGGTGAATGTAGACG.

[0065] Experiments showed that overexpression of chimeric SFT2D2-TBX19 promoted cell proliferation, migration and invasion ( Figure 1 H, I and Figure S1 F), revealing that the chimeric SFT2D2-TBX19 may play an oncogene role in prostate tumor development. Subsequently, we designed specific siRNA targeting the chimeric SFT2D2-TBX19 junction sequence. The results showed that siSFT2D2-TBX19 significantly interfered with the transcription of the chimeric SFT2D2-TBX19 without affecting the transcription of the parental genes SFT2D2 or TBX19 ( Figure S2 A) or protein level ( Figure S2 B). Importantly, knockdown of chimeric SFT2D2-TBX19 inhibited cancer cell proliferation, clonogenicity, migration, and invasion ( Figure 2 A, B and Figure S2 CF). The nude mouse subcutaneous tumor formation experiment also showed that the tumor volume of the shSFT2D2-TBX19 group was smaller (p<0.05) ( Figure 2 C). The above results support that the chimeric SFT2D2-TBX19 is a potential novel chimeric oncogene in prostate tumor development.

[0066] Example 2 Verification and functional study of chimeric SFT2D2-TBX19 encoding TBX19-202 protein

[0067] Different cellular localizations of chimeric RNAs play crucial and diverse roles in regulating cellular metabolism. Figure 2 D, Figure S3 A) and RT-qPCR analysis of nucleoplasmic extracts ( Figure 2E) revealed the distribution of SFT2D2-TBX19 in the nucleus and cytoplasm, suggesting that it has multiple functional roles. We used SnapGene to predict the open reading frame (ORF) of SFT2D2-TBX19 and identified two ORFs. The first predicted ORF was identical to the parental SFT2D2. Interestingly, the second predicted ORF matched TBX19-202 on UCSC, although UCSC did not provide the 5'UTR sequence ( Figure 2 G). On the one hand, ribosomal RNA extraction analysis showed that SFT2D2-TBX19 may encode a polypeptide ( Figure 2 F). On the other hand, to further confirm whether SFT2D2-TBX19 can encode protein, we designed several plasmids based on the two predicted ORF sequences ( Figure 2 H): (a) full-length plasmid of SFT2D2-TBX19; (b) TBX19-202-HA tag plasmid; (c) SFT2D2-Flag-TBX19 tag plasmid, i.e., adding a Flag tag sequence after the first ORF (consistent with the ORF of the parent SFT2D2); (d) SFT2D2-TBX19-HA, adding an HA tag sequence after the second ORF; and (e) SFT2D2-TBX19-HA start codon mutant plasmid (coding ability lost). After overexpression of SFT2D2-Flag-TBX19 in 293T cells (left figure, Figure 2 I), Flag-coupled agarose beads were used to immunoprecipitate the tagged proteins. The results showed that after transfection of the Flag tag plasmid, SFT2D2 did not increase, and Flag was not detected at the expected band position ( Figure 2 J), indicating that the first ORF of SFT2D2-TBX19 has no coding capacity. The second ORF is aligned with most of the amino acid sequence of the parent TBX19 protein and is named TBX19-202 ( Figure S3 B). HA-coupled agarose beads were used to immunoprecipitate the TBX19-202-HA peptide. The HA antibody was used to visualize the location of the TBX19-202-HA peptide on the protein membrane. We found that the TBX19 antibody could recognize the common peptide sequences in TBX19 and TBX19-202. Figure 2 As shown in Figure 1, we confirmed that the TBX19 antibody can recognize the parental TBX19 protein and the predicted TBX19-202 peptide. In addition, after overexpression of SFT2D2-TBX19-HA (middle figure, Figure 2 I), TBX19-202 significantly increased at the corresponding band position in the transfected group (top figure, Figure 2 L). After the ATG mutation was introduced into SFT2D2-TBX19-HA and overexpressed in 293T cells (right, Figure 2 I), TBX19-202 did not increase, and HA did not show (Figure 2 Figure 2 L). We further observed that overexpression (oe SFT2D2-TBX19) and knockdown (shSFT2D2-TBX19) of wild-type SFT2D2-TBX19 modulated the expression level of TBX19-202 in PC3 and C4-2 cells ( Figure S3 C), confirming that SFT2D2-TBX19, the 5'UTR of TBX19-202 identified in this study, can encode TBX19-202.

[0068] To explore the biological function of TBX19-202, we used the plasmid TBX19-202-HA to construct an overexpression cell system in PC3 and C4-2 cells ( Figure S3 D). The results showed that TBX19-202 promoted cell proliferation, migration and invasion ( Figure 3 A, B and Figure S3 EH). Therefore, the oncogenic effect of SFT2D2-TBX19 is mediated at least in part through its encoded peptide TBX19-202.

[0069] Among them, the TBX19-202 protein encoded by the chimeric SFT2D2-TBX19 comprises the amino acid sequence shown in SEQ ID NO.4:

[0070] SEQ ID NO.4: m fpvlkisvtg ldpnamysll ldfvptdshr wkyvngewvp agkpevsshscvyihpdspn fgahwmkapi sfskvkltnk lngggqimln slhkyepqvh ivrvgsahrm vtncsfpetqfiavtayqne eitalkikynpfakafldak ernhlrdvpe aisesqhvty shlggwifsn pdgvctagnsnyqyaaplpl paphthhgce hysglrghrqapypsaymhr nhspsvnlie sssnnlqvfs gpdswtslsstphasilsvp htngpinpgp spypclwtis ngaggpsgpgpevhastpga flllgnpavts ppsvlstqaptsagvevlge psltsiavst wtavashpfa gwggpgaggh hspssldg;

[0071] The nucleotide information of the forward primer of TBX19-202 protein is shown in SEQ ID NO.5:

[0072] SEQ ID NO.5: gacagtcaccgctggaagtac

[0073] The nucleotide information of the reverse primer of TBX19-202 protein is shown in SEQ ID NO.6:

[0074] SEQ ID NO. 6: cacttccaacacgcactatgtg.

[0075] Considering the high similarity of amino acid sequences between parental TBX19 and TBX19-202, they may have similar regulatory roles. We further observed that high expression levels of TBX19 were associated with a lower survival probability during progression-free survival ( Figure 3 C), and biochemical recurrence in the TCGA dataset ( Figure 3 D). In addition, the expression of TBX19 transcripts was more in cases with Gleason score >7, pathological stage T4, pathological stage N1, and clinical stage M ( Figure 3 EH). These findings suggest that TBX19 may function as an oncogene in prostate cancer. To confirm this, we designed specific siRNAs targeting exon 1 of parental TBX19 to avoid affecting the transcription of SFT2D2-TBX19 and evaluated the knockdown efficiency ( Figure 3 I). Knockdown of parental TBX19 inhibited the proliferation, colony formation, migration and invasion of prostate cancer cells ( Figure 3 J, K and Figure S4 AD). In contrast, overexpression of parental TBX19 promoted proliferation, colony formation, migration, and invasion of PC3 and C4-2 cells ( Figure 3 L, M and Figure S4 EJ). Given their amino acid sequence similarities, we speculated that TBX19-202 and parental TBX19 might regulate similar downstream signaling pathways. Further RNA sequencing revealed that the first four molecular pathways were consistent: DNA replication, cell cycle, mismatch repair, and TNF signaling pathways ( Figure 3 N). In conclusion, SFT2D2-TBX19 encodes TBX19-202, which has similar oncogenic effects as parental TBX19 in promoting prostate cancer progression.

[0076] Example 3 Functional study of chimeric SFT2D2-TBX19 as lncRNA

[0077] Considering that the UTR region of the chimeric SFT2D2-TBX19 shares most of the nucleotide sequence with its parental gene SFT2D2, we investigated the potential role of SFT2D2 lncRNA in prostate cancer progression. Initially, we did not find that the SFT2D2 transcript was associated with the survival probability of prostate cancer patients in the CPGEA database ( Figure S5 A). Subsequently, we constructed an ATG mutant SFT2D2 plasmid to eliminate the potential effects of SFT2D2 protein. Our experiments revealed that overexpression of SFT2D2 lncRNA did not affect the proliferation, migration, and invasion of prostate cancer ( Figure S5 BD). This suggests that the molecular function of SFT2D2-TBX19 may not be dependent on the RNA sequence of SFT2D2.

[0078] When comparing the transcription levels of chimeric SFT2D2-TBX19 RNA and parental TBX19 RNA using a PCR standard amplification curve, the amount of parental TBX19 transcripts was 10^2 times higher than that of chimeric SFT2D2-TBX19 in six prostate cancer cell lines ( Figure S6 AF). Since the expression level of SFT2D2-TBX19 is much lower than that of TBX19 and TBX19 itself promotes the development of prostate cancer, we speculated that SFT2D2-TBX19 lncRNA may have different molecular functions in addition to encoding TBX19-202. To verify this hypothesis, we established an overexpression system of SFT2D2-TBX19 (ATGmut) in C4-2 and PC3 cells. The results showed that SFT2D2-TBX19 lncRNA can also enhance the proliferation, migration and invasion of prostate cancer cells ( Figure 3 O and Figure S6 GI).

[0079] To elucidate which of SFT2D2-TBX19 lncRNA and TBX19-202 plays a major role in tumor cell development, we performed cell function experiments based on equal TBX19-202 translation between SFT2D2-TBX19 and TBX19-202 overexpression, and equal transcription of SFT2D2-TBX19 lncRNA between SFT2D2-TBX19 and SFT2D2-TBX19(ATGmut) overexpression. Figure S7 A, B). The results showed that SFT2D2-TBX19 lncRNA had an effect on tumor cell progression of about 60-70%, while TBX19-202 had an effect of about 30-40% ( Figure 4 A, B and Figure S7C, D). Given the importance of the lncRNA form of SFT2D2-TBX19, in-depth study of its molecular mechanism in promoting prostate cancer progression is necessary.

[0080] Example 4 Study on the interaction between chimeric SFT2D2-TBX19 and ATP synthase.

[0081] To elucidate the lncRNA mechanism of SFT2D2-TBX19, we performed RNA pulldown experiments and silver staining. Mass spectrometry analysis showed that the main enriched proteins were mitochondrial membrane ATP synthase subunits ATP5F1A and ATP5F1B ( Figure 4 C). Western blot analysis further confirmed the enrichment of these proteins in the sense and antisense pulldown proteins of PC3 and C4-2 cells ( Figure 4 D). Immunofluorescence imaging showed that SFT2D2-TBX19 co-localized with ATP5F1A and ATP5F1B as well as mitochondria ( Figure 4 E). RNA immunoprecipitation using ATP5F1A and ATP5F1B antibodies further validated the interaction of SFT2D2-TBX19 with ATP5F1A and ATP5F1B ( Figure 4 F).

[0082] Among them, the fluorescent probe sequence of the chimeric SFT2D2-TBX19 (SEQ ID NO.10) is ctggaaacatccgtctcactc catgg (5'-3' sense)

[0083] Mitochondrial membrane ATP synthase (F1F0 ATP synthase or complex V) converts ADP into ATP by utilizing the proton gradient across the membrane, which is generated by the electron transport complex of the respiratory chain. ATP5F1A and ATP5F1B subunits constitute the catalytic core of the F1 complex. Rotation of the central rod structure relative to the surrounding ATP5F1A3ATP5F1B3 subunits leads to the hydrolysis of ATP. Numerous studies have shown that ATP synthase can regulate the progression of prostate cancer through the production of ATP. Further RNA sequencing analysis showed that the regulation of ATPase activity was enriched in the oe SFT2D2-TBX19 group, but not in the oe TBX19-202 group ( Figure 4 GH). In addition, co-immunoprecipitation experiments showed no interaction between TBX19-202 protein and ATP5F1A / ATP5F1B ( Figure S8 A). The above results suggest that SFT2D2-TBX19, as a lncRNA, may mediate the activity of ATP synthase to regulate cell proliferation, migration and invasion in prostate cancer.

[0084] Example 5 Study on the mechanism of regulation of ATP synthase by chimeric SFT2D2-TBX19.

[0085] To explore whether chimeric SFT2D2-TBX19 regulates ATP production through ATP5F1A / B, we first performed Western blot analysis, and the results showed that SFT2D2-TBX19 did not affect the protein levels of ATP5F1A or ATP5F1B ( Figure 5 A). Subsequent experiments further demonstrated that SFT2D2-TBX19 does not mediate the degradation of ATP5F1A / B through post-translational ubiquitination modification ( Figure 5 B, C and Figure S8 B, C). Therefore, SFT2D2-TBX19 may not affect the production or degradation of ATP5F1A and ATP5F1B.

[0086] Previous studies have shown that phosphorylation of ATP5F1A plays a key role in the interaction between ATP5F1A and ATP5F1B, as well as the activity of ATP synthase and the protection of mitochondrial vulnerability. Based on these findings, we hypothesized that SFT2D2-TBX19 may regulate ATP synthase activity and protect mitochondrial function by regulating the phosphorylation of ATP5F1A. Protein co-immunoprecipitation verified that the phosphorylation level of ATP5F1A increased when SFT2D2-TBX19 was overexpressed, and vice versa ( Figure 5 D). TNK2 / ACK1 is the only known phosphokinase of ATP5F1A, and its immunoprecipitated protein amount is reduced after SFT2D2-TBX19 knockdown ( Figure 5 E), indicating that SFT2D2-TBX19 promotes the phosphorylation modification of ATP5F1A through TNK2 / ACK1. To determine whether SFT2D2-TBX19 regulates the binding interaction between ATP5F1A and ATP5F1B, we measured the levels of ATP5F1A and ATP5F1B under the same immunoprecipitation protein amount conditions after SFT 2D2-TBX19 knockdown or overexpression. The results showed that SFT2D2-TBX19 promoted the binding stability between ATP5F1A and ATP5F1B, while its knockdown destroyed this stability ( Figure 5 FH). Further experiments showed that the stability of the ATP5F1A and ATP5F1B complex affects ATP production and ATP synthase activity ( Figure 5 IJ). These findings suggest that SFT2D2-TBX19 regulates ATP production by modulating the stability of the mitochondrial ATP synthase core F1 complexes ATP5F1A and ATP5F1B.

[0087] Furthermore, we constructed a docetaxel-induced mitochondrial injury model ( Figure S8 DF). The study showed that SFT2D2-TBX19 maintained the proliferation of prostate cancer cells even after docetaxel treatment ( Figure 6 A). It still enhances the phosphorylation of ATP5F1A through TNK2 / ACK1 ( Figure 6 B, C). Overexpression of SFT2D2-TBX19 stabilizes the interaction between ATP5F1A and ATP5F1B even after docetaxel treatment ( Figure 6 DF). In the absence of docetaxel, there were no significant changes in mitochondrial membrane potential or structure in PC3 or C4-2 cells stably overexpressing SFT2D2-TBX19 ( Figure 6 G, I). However, SFT2D2-TBX19 significantly protected mitochondrial membrane potential and maintained normal mitochondrial structure after docetaxel treatment ( Figure 6 H, J, K). This protective effect helps maintain ATP production, thereby promoting cell proliferation ( Figure 6 L). In conclusion, SFT2D2-TBX19 stabilizes the interaction between ATP5F1A and ATP5F1B through phosphorylation of ATP5F1A, leading to increased ATP synthase activity and ATP production. In addition, it can maintain mitochondrial metabolic capacity and structure under conditions of mitochondrial fragility.

[0088] Example 6 Study on the mechanism of regulation of ATP synthase by chimeric SFT2D2-TBX19.

[0089] To investigate the functional region between the chimeric SFT2D2-TBX19 and ATP5F1A, truncated RNAs of SFT2D2-TBX19 of 600 bp each were synthesized and verified by gel electrophoresis ( Figure 7 A). Pulldown experiments using truncated SFT2D2-TBX19 revealed that the 1801-2400 bp region is the most important RNA sequence for SFT2D2-TBX19 binding to ATP5F1A and ATP5F1B ( Figure 7 B, C). TBX19 transcripts also contain the 1801-2400bp region of SFT2D2-TBX19. To investigate the association between ATP5F1A / B and TBX19 transcripts, we performed RNA pulldown experiments and found that TBX19 transcripts can also interact with ATP5F1A / B. However, under the same molar amount of probe conditions, SFT 2D2-TBX19 lncRNA can bind to more ATP5F1A / B, indicating that SFT2D2-TBX19 has a stronger binding ability ( Figure S8G). In addition, after extracting and purifying mitochondrial RNA, we found that even though the number of SFT2D2-TBX19 transcripts was much lower than that of TBX19, the number of SFT2D2-TBX19 transcripts in mitochondria was approximately 10^2 times that of TBX19 transcripts ( Figure S8 H), confirming that TBX19 may lack the ability to enter mitochondria. Importantly, we did not find that TBX19 had any effect on the activity of ATP synthase ( Figure S8 I). In conclusion, TBX19 lacks the ability to regulate mitochondrial ATP synthesis by interacting with ATP5F1A and ATP5F1B due to its low protein ATP5F1A / B binding ability and the difficulty of TBX19 entering mitochondria.

[0090] Given that SFT2D2-TBX19 regulates the phosphorylation of ATP5F1A, we designed and validated two domains of ATP5F1A, △N-Flag and △C-Flag, for RNA immunoprecipitation ( Figure 7 D, E). The amount of SFT2D2-TBX19 transcripts pulled down by △N-Flag and △C-Flag indicated that the middle domain of ATP5F1A interacted with SFT2D2-TBX19 ( Figure 7 F, G). In addition, we performed a cell phenotype recovery experiment. The knockdown efficiency of ATP5F1A and ATP5F1B was detected by Western blotting after siRNA transfection ( Figure 7 H, Figure S9 A). In the oe SFT2D2-TBX19 group, the proliferation, migration, and invasion of prostate cancer cells were reversed after knockdown of ATP5F1A or ATP5F1B ( Figure 7 IL and Figure S9 BE). These findings further suggest that the interaction between ATP5F1A and ATP5F1B is a key molecular signaling pathway mediated by SFT2D2-TBX19.

[0091] We also found that chimeric SFT2D2-TBX19 gradually increased from castration-resistant prostate cancer cell lines PC3, C4-2, DU145, 22RV1 to the neuroendocrine prostate cancer cell line NCI-H660. The correlation heat map showed that SFT2D2-TBX19 was associated with NEPC markers CHGA and NCAM1 in the CPGEA database ( Figure S9F). In addition, TBX19-202 is similar to many oncogenes and is associated with known oncogene DNA replication, cell cycle, and TNF signaling pathways. The well-known tumor suppressor genes p53, pten, and rb1 play a fundamental role in cell cycle regulation, cell proliferation, and DNA replication. In addition, other studies have found that p53, pten, and rb1 triple-knockout mice (PBCre4:ptenf / f:rb1f / f:p53f / f) showed increased invasive metastatic ability in bones, liver, and lungs. Moreover, the levels of NEPC markers CHGA, SYP, and NSE in TKO tumors were also significantly increased. Further, we evaluated the expression of p53, pten, and rb1 in chimeric SFT2D2-TBX19 knockdown and overexpression PC3 and C4-2 cells, and the results showed that pten was regulated by SFT2D2-TBX19 ( Figure S9 G). These data suggest that SFT2D2-TBX19 may mediate the neuroendocrine regulation of prostate cancer.

[0092] In summary, chimeric SFT2D2-TBX19 is a potential novel chimeric oncogene in the development of prostate tumors. Knockdown of chimeric SFT2D2-TBX19 inhibits cancer cell proliferation, cloning, migration and invasion; and the TBX19-202 protein encoded by it can promote the progression of prostate cancer through pathways such as DNA replication, cell cycle and TNF signaling pathways. Chimeric SFT2D2-TBX19 can also act as a lncRNA to enhance the phosphorylation of ATP synthase F1 subunit ATP5F1A through TNK2 / ACK1, thereby stabilizing the interaction with ATP5F1B. This stable interaction protects the mitochondrial structure and promotes ATP production, thereby promoting the proliferation, migration and invasion of prostate cancer cells. Chimeric SFT2D2-TBX19 still maintains mitochondrial membrane potential and normal structure in the harsh environment induced by docetaxel, thereby promoting the survival of prostate cancer cells. The truncated RNA and domain analysis of chimeric SFT2D2-TBX19 provide a reference for its potential as a therapeutic target for prostate cancer. Therefore, intervention targeting the multiple mechanisms of action of chimeric SFT2D2-TBX19 and its encoded protein TBX19-202 is expected to enhance the therapeutic effect and improve the patient's quality of life and prognosis.

[0093] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0094] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. Chimeric SFT2D2-TBX19 as a marker for prostate cancer diagnosis, characterized in that The chimeric SFT2D2-TBX19 contains the nucleotide sequence shown in SEQ ID NO.1; or contains the sequence shown in SEQ ID NO.1 and has one or more nucleotides replaced, deleted or added in the sequence, but has the same function.

2. The chimeric SFT2D2-TBX19 according to claim 1 is used as a marker for the diagnosis of prostate cancer, characterized in that It also includes a primer pair or probe for amplifying a specifically identified nucleotide sequence, wherein the primer pair or probe includes a nucleotide sequence generated according to the upstream gene nucleotide sequence and a nucleotide sequence generated according to the downstream gene nucleotide sequence; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

3.

3. A prostate cancer detection kit, characterized in that: The kit comprises a reagent for detecting the marker according to claim 1 or 2, or the content of a protein expressed by the marker according to claim 1 or 2.

4. Use of chimeric SFT2D2-TBX19 as a marker for the diagnosis of prostate cancer in the treatment of prostate cancer, characterized in that: It includes TBX19-202 protein, wherein the TBX19-202 contains the amino acid sequence shown in SEQ ID NO.4; or contains the amino acid sequence shown in SEQ ID NO.4 with one or more amino acids replaced, deleted or added, and has a sequence with the same function.

5. A prostate cancer diagnostic reagent, characterized in that: The diagnostic reagent includes an antibody or antibody fragment that specifically recognizes the protein expressed by the chimeric SFT2D2-TBX19 and / or the TBX19-202 protein.

6. A composition for diagnosing, detecting, monitoring or predicting the progression of prostate cancer, characterized in that A nucleic acid affinity ligand and / or a peptide affinity ligand comprising a chimeric SFT2D2-TBX19, a TBX19-202 protein, a TBX19-202 protein; Preferably, the progression of prostate cancer includes at least proliferation, migration and invasion of cancer cells; Preferably, the affinity ligand comprises at least an aptamer specific to the TBX19-202 protein, an antibody specific to the TBX19-202 protein and / or an antibody variant specific to the TBX19-202 protein.

7. Use of a substance that inhibits the expression and / or activity reduction of a chimeric SFT2D2-TBX19 and / or TBX19-202 protein in prostate cancer cells, characterized in that: The application is at least one of the following (a')-(c'): (a') inhibiting the proliferation of prostate cancer cells, or preparing a product for inhibiting the proliferation of prostate cancer cells; (b') inhibiting the migration of prostate cancer cells, or preparing a product for inhibiting the migration of prostate cancer cells; (c') inhibiting the invasion of prostate cancer cells, or preparing a product for inhibiting the invasion of prostate cancer cells.

8. A pharmaceutical composition for treating or preventing prostate cancer, characterized in that: A substance comprising a chimeric SFT2D2-TBX19 and / or TBX19-202 protein with reduced expression and / or activity.

9. The pharmaceutical composition according to claim 8, characterized in that The substances include TBX19-202-specific antibodies, RNA interference molecules or antisense oligonucleotides against chimeric SFT2D2-TBX19, small molecule inhibitors, and siRNA.

10. The pharmaceutical composition according to claim 8, characterized in that The pharmaceutical composition further comprises at least one or more pharmaceutically or food-acceptable excipients.

Images