C4 gene molecular marker primer related to egg weight character and application of C4 gene molecular marker primer

Abstract

The invention relates to a C4 gene molecular marker primer related to egg weight character and application of the C4 gene molecular marker primer, and belongs to the technical field of biology. According to the invention, genome DNA of a chicken to be detected is taken as a template, a specific primer is adopted to carry out PCR amplification on the template, then a PCR amplification product is subjected to Sanger sequencing and SNP molecular marker genotyping, and based on the genotype of the SNP molecular marker, selection of the egg weight character of the chicken at the age of 37 weeks can be realized. By eliminating C / T and T / T genotype individuals and retaining C / C genotype individuals, the molecular marker has the beneficial effects that the molecular marker can be used as a genetic marker for chicken breeding to breed 37-week-old chickens with relatively large and uniform egg weight; the method can be used for efficiently and quickly identifying the egg weight character of the chicken at the age of 37 weeks, improves the uniformity of the egg weight of chicken flocks, provides a scientific basis for early breeding of the chicken, and has an important value for chicken breeding. In addition, the detection method disclosed by the invention is simple and easy to operate, and can be carried out in a laboratory.

Description

Technical Field

[0001] The invention relates to a C4 gene molecular marker primer related to egg weight traits and application thereof, belonging to the field of biotechnology. Background Art

[0002] Egg weight affects egg quality and grading, and is a key egg quality trait in poultry breeding, directly affecting the nutritional content of eggs, etc. The number of eggs laid and the strength of the eggshell are negatively correlated with the egg weight in the late egg-laying period. To continuously improve the duration of the peak egg-laying period and the strength of the eggshell, it is necessary to select the size of the eggs, thereby breeding better-quality egg-laying chickens and seeking a breakthrough between maximizing the breeding benefits and production potential of chickens. Before 30 weeks of age, it is generally considered to be the golden period for regulating egg weight through nutrition. During this period, egg weight is less affected by genetic factors. After 30 weeks, one of the most critical factors affecting egg weight is genetics, and 37 weeks of age is a critical time node for chicken egg laying. At this time, the egg production rate of chickens reaches its peak. It is difficult to regulate the egg weight of 37 weeks of age through external factors. Therefore, how to select and breed the egg weight of 37 weeks of age in the early stage, so as to stabilize the egg weight during the peak egg-laying period, is particularly critical. Using molecular markers to accurately identify the genotype of egg weight at 37 weeks of age and applying it to early breeding selection can improve resource utilization efficiency, maximize the functional value of eggs, and improve the economic benefits of chickens. The C4 gene encodes the most polymorphic protein-coding gene in the complement system and is mainly located in the major histocompatibility complex (MHC) region. The MHC region is closely related to a variety of important biological functions, including growth and development, aging, and reproduction. In addition, the MHC region involved in C4 may affect production traits such as hatchability, egg weight, and egg production, indicating that the C4 gene may be closely related to egg weight. Summary of the invention

[0003] The purpose of the present invention is to address the defects of the prior art and to propose a C4 gene molecular marker primer related to the egg weight trait and its application to quickly detect and screen the weight of 37-week-old eggs.

[0004] The present invention measured the egg weight of hens, performed SNP genotyping using whole genome resequencing technology, and screened the C4 gene molecular marker significantly correlated with the egg weight trait of chickens at 37 weeks of age through whole genome association analysis, providing new gene and molecular marker resources for the breeding of chickens with the egg weight trait at 37 weeks of age.

[0005] The present invention solves the technical problem through the following technical scheme: firstly, a C4 gene molecular marker primer related to the egg weight trait is provided, the nucleotide sequence of the molecular marker primer is shown in SEQ ID NO:1 and SEQ ID NO:2, the molecular marker is located at the 2225243rd base of chromosome 16 of the chicken reference genome GRCg7b version, and the base is mutated to T or C. The sequence is shown in the 87th base as shown in SEQ ID NO:3 or SEQ ID NO:4.

[0006] The present invention further provides the use of the above molecular marker primers for detecting the SNP genotype associated with the egg weight trait of recessive White Rock chickens, white broiler maternal lines and white broiler chickens at 37 weeks of age. The detection method comprises the following steps: The first step is to provide a chicken DNA sample to be tested, and perform PCR amplification using a molecular marker primer pair to obtain an amplification product, wherein the amplification product is 345 bp in length and contains the 2225243rd base of chicken chromosome 16; Step 2: Sanger sequencing of the PCR product; The third step is to determine the genotype of the SNP molecular marker at base 2225243 of chicken chromosome 16 based on the sequencing results of the second step.

[0007] Wherein, the deoxyribonucleotide sequence of the molecular marker primer pair described in the first step is: Upstream primer: 5'-GTGGAGATGCTTTGTAGAGGAGTG-3' (SEQ ID NO: 1) Downstream primer: 5'-GGTGTGACTGCTGTAGGGAAAT-3' (SEQ ID NO: 2) The final concentration of the reaction system is 25 μl. Chicken DNA to be tested 50 ng, 2 x Accurate Taq Master Mix 12.5 μl, Upstream primer 1 μl, Downstream primer 1 μl, Add sterile water to 25 μl.

[0008] The reaction conditions of the PCR amplification are: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 60 seconds, for a total of 30 cycles; extension at 72°C for 2 minutes; storage at 4°C; the nucleotide sequence of the amplified product is shown in SEQ ID NO: 3 or SEQ ID NO: 4, the amplified product is 345 bp in length, and contains the 2225243rd base of chicken chromosome 16.

[0009] In the third step, the judgment standard is that the egg weight of the C / C genotype chickens at 37 weeks of age is higher than that of the C / T and T / T genotype individuals, and the egg weight of the C / T genotype chickens at 37 weeks of age is higher than that of the T / T genotype individuals.

[0010] The present invention detects the genotype of the egg weight trait of chickens at 37 weeks of age by using C4 gene molecular markers, and obtains that the egg weight of C / C genotype chickens at 37 weeks of age is higher than that of C / T and T / T genotype individuals, and the egg weight of C / T genotype chickens at 37 weeks of age is higher than that of T / T genotype individuals. By using the genomic DNA of the chicken to be tested as a template, using specific primers to amplify it by PCR, and then performing Sanger sequencing and SNP molecular marker genotyping on the PCR amplification product, the genotype of the SNP molecular marker can be used to select the egg weight trait of the chicken at 37 weeks of age. In breeding, according to the breeding goal, by eliminating C / T and T / T genotype individuals, the C / C genotype individual can be retained, and the beneficial effect is that the molecular marker can be used as a genetic marker for chicken breeding, and chickens with larger and uniform egg weight at 37 weeks of age can be selected; the egg weight trait of the chicken at 37 weeks of age can be identified efficiently and quickly, and the uniformity of the egg weight of the chicken flock can be improved, providing a scientific basis for the early selection of chickens, which is of great value for chicken breeding. In addition, the detection method disclosed in the present invention is simple and easy to operate and can be carried out in a laboratory. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 Manhattan plot of genome-wide association analysis of egg weight at 37 weeks of age.

[0012] Figure 2 These are the Sanger sequencing results of the PCR amplification products of the three genotypes. DETAILED DESCRIPTION

[0013] The following embodiments are applicable to chicken breeding, and the breeds of chickens cited are not limited to the following embodiments.

[0014] Example 1 In this example, the egg weight of recessive White Rock hens at 37 weeks of age was measured, and whole-genome SNP genotyping was performed using second-generation sequencing technology. The C4 gene molecular marker significantly associated with egg weight at 37 weeks of age was screened through whole-genome association analysis. The results are as follows: Figure 1 shown.

[0015] In this example, the following experiment was conducted to identify and apply the C4 gene molecular marker related to egg weight in chickens at 37 weeks of age.

[0016] 1. Phenotypic and genotypic testing (1) Experimental materials and egg weight phenotype determination at 37 weeks of age A total of 1781 recessive White Rock hens were selected as experimental animals and raised under the same feeding conditions with free access to food and water throughout the entire process. At 37 weeks of age, the egg weight of each chicken was recorded as the phenotypic data of egg weight at 37 weeks of age.

[0017] (2) Extraction of genomic DNA Blood was collected from the subwing vein of the individual to be tested, lysed after anticoagulation, digested with proteinase K, extracted with saturated sodium chloride method, dissolved in TE and stored at -20℃.

[0018] (3) PCR amplification The fragment containing the 2225243rd base of chromosome 16 was amplified using the genomic DNA extracted as above as a template.

[0019] Upstream primer: 5'-GTGGAGATGCTTTGTAGAGGAGTG-3' (SEQ ID NO: 1) Downstream primer: 5'-GGTGTGACTGCTGTAGGGAAAT-3' (SEQ ID NO: 2) The final concentration of the reaction system is 25 μl. DNA to be tested 50 ng, 2 x Accurate Taq Master Mix 12.5 μl, Upstream primer 1 μl, Downstream primer 1 μl, Add sterile water to 25 μl.

[0020] The reaction conditions of PCR amplification are: 94℃ pre-denaturation for 5min; 94℃ denaturation for 30sec, 55℃ annealing for 30sec, 72℃ extension for 60sec, 30 cycles in total; 72℃ extension for 2min; 4℃ storage; 10μl was taken for agarose detection, and a single target band with a length of 345 bp was amplified, containing the SNP molecular marker at the 2225243rd base site of chicken chromosome 16. The sequence of the amplified product is as follows: SEQ ID NO:3 GTGGAGATGCTTTGTAGAGGAGTGGGTTGGGATGTGGGGGGTGGGCAGCTCATCCTCAGTGCATGATTGGTTATGGAAGCTGAGTGCTTGCCCTCAGTTGCAGCAGCACTGTAGGTTATGGAGGGGAGGCACAGCTCAGCCCAAAGTGGGACGAAGTTTCCAGCCATGTCTC CATATGAAAGCCATGCAGATACCAGGGAGTGCAAGGGCAAATGCTGGGGAGAAGAGGGAGAGCAGCAGTGTGTGATGGAGTGACAAGCAAGGAGGGTGGGGTGGGCACAGGACTGCAGGGGGTGGGAGGGACTTCTGTGTTCCCCAAGCATTTCCCTACAGCAGTCACACC SEQ ID NO:4 GTGGAGATGCTTTGTAGAGGAGTGGGTTGGGATGTGGGGGGTGGGCAGCTCATCCTCAGTGCATGATTGGTTATGGAAGCTGAGTGTTTGCCCTCAGTTGCAGCAGCACTGTAGGTTATGGAGGGGAGGCACAGCTCAGCCCAAAGTGGGACGAAGTTTCCAGCCATGTCTC CATATGAAAGCCATGCAGATACCAGGGAGTGCAAGGGCAAATGCTGGGGAGAAGAGGGAGAGCAGCAGTGTGTGATGGAGTGACAAGCAAGGAGGGTGGGGTGGGCACAGGACTGCAGGGGGTGGGAGGGACTTCTGTGTTCCCCAAGCATTTCCCTACAGCAGTCACACC (4) Sanger sequencing and genotyping The PCR products of each sample were subjected to Sanger sequencing, and the sequencing peaks of different genotypes were obtained as shown in Figure 2 shown.

[0021] 2. Correlation Analysis 1781 recessive White Rock hens with clear records of egg weight phenotype at 37 weeks of age were selected for correlation analysis. The ANOVA test function of R 4.2 statistical drawing software was used for statistical test, and the pairwise mean comparison mode was selected to perform statistical test on the genotype and egg weight trait at 37 weeks of age of the test flocks. P<0.05 indicated significant differences. The results are shown in Table 1. Among the tested individuals, the egg weight of the three genotypes at 37 weeks of age was significantly different (P<0.05). The average egg weight of C / C genotype individuals at 37 weeks of age was 59.48g, which was higher than 58.31g (P<0.05) of C / T genotype individuals and 57.35g (P<0.05) of T / T genotype individuals. The egg weight of C / T genotype individuals at 37 weeks of age was higher than that of T / T genotype individuals (P<0.05). The results showed that the site at base 2225243 of chicken chromosome 16 was significantly associated with the egg weight phenotype of chickens at 37 weeks of age. According to the actual breeding goals, C / C genotype individuals can be selected to breed hens with larger and more uniform egg weight at 37 weeks of age, thereby improving the overall egg weight and uniformity and improving the breeding efficiency.

[0022] Table 1 Association analysis between C4 gene molecular marker and egg weight at 37 weeks of age

[0023] Note: Data in the same column with the same letters on their shoulders indicate no significant difference, while data with different letters on their shoulders indicate significant difference (P<0.05).

[0024] Example 2 Genotype frequencies of different varieties 1. Blood Sample Collection Blood samples from 17 breeds, including White Leghorn laying hens, Recessive White Rock chickens, Cobb broilers, Jingxing yellow chickens, Beijing oily chickens, big bone chickens, Daweishan miniature chickens, Wenchang chickens, Wuding chickens, Piao chickens, bearded chickens, Tibetan chickens, Camellia chickens, Fujian Hetian chickens, Liyang chickens, Xinghua chickens and Guangxi Sanhuang chickens, were collected by subwing vein blood collection and stored at -20℃ for future use.

[0025] 2. Extraction of Genomic DNA Take the tissue sample obtained in step 1 and use Omega's tissue genomic DNA extraction kit to extract genomic DNA. The specific method refers to the standard operating procedure provided by Omega.

[0026] 3. Genotype detection Using the genomic DNA obtained in step 2 as a template, a primer pair consisting of an F nucleotide sequence (SEQ ID NO: 1) and an R nucleotide sequence (SEQ ID NO: 2) was used for PCR amplification and Sanger sequencing to obtain the C / C genotype, C / T genotype, and T / T genotype of the individual.

[0027] 4. Results Analysis White Leghorn laying hens are a common commercial laying hen breed with high egg production and moderate and uniform egg weight. Recessive White Rock and Cobb broilers are common commercial broiler breeds with large body size and poor egg production performance. Jingxing Yellow Chicken, Beijing Oil Chicken, Big Bone Chicken, Daweishan Miniature Chicken, Wenchang Chicken, Wuding Chicken, Piao Chicken, Bearded Chicken, Tibetan Chicken, Camellia Chicken, Fujian Hetian Chicken, Liyang Chicken, Xinghua Chicken and Guangxi Sanhuang Chicken are well-known local chicken breeds in China. White Leghorn laying hens, as the most common fine-breed laying hens, have been selected for the egg weight trait for a long time. However, the selection and breeding work of recessive White Rock and Cobb broilers has mainly focused on the egg quantity and egg quality traits, and has not been highly selected for egg weight. Chinese local chicken breeds have not been selected for specific traits for a long time. In the White Leghorn chicken population, the frequency of the C allele is higher than that of other breeds. See Table 2. These research results show that this SNP locus can be used as a molecular marker for the egg weight trait at 37 weeks of age.

[0028] Table 2 Allele frequency distribution of C4 gene molecular marker in different varieties

[0029] In addition to the above implementations, the present invention may also have other implementations. Any technical solution formed by equivalent replacement or equivalent transformation falls within the protection scope required by the present invention.

Claims

1. A C4 gene molecular marker primer related to egg weight trait, characterized in that: The nucleotide sequences of the molecular marker primers are shown in SEQ ID NO: 1 and SEQ ID NO:

2. The molecular marker is located at the 2225243rd base on chicken chromosome 16, and the base is mutated to T or C.

2. The use of the C4 gene molecular marker primers related to egg weight trait according to claim 1, characterized in that: Used to detect SNP genotypes related to egg weight traits in chickens at 37 weeks of age.

3. The use of the C4 gene molecular marker primers related to the egg weight trait according to claim 2, characterized in that: The detection method comprises the following steps, The first step is to provide a chicken DNA sample to be tested, and perform PCR amplification using a molecular marker primer pair to obtain an amplification product, wherein the amplification product is 345 bp in length and contains the 2225243rd base of chicken chromosome 16; The second step is to perform Sanger sequencing on the PCR product; The third step is to determine the genotype of the SNP molecular marker at base 2225243 of chicken chromosome 16 based on the sequencing results of the second step.

4. The use of the C4 gene molecular marker primers related to the egg weight trait according to claim 3, characterized in that: The final concentration of the reaction system is 25 μl. Chicken DNA to be tested 50 ng, 2 x Accurate Taq Master Mix 12.5 μl, Upstream primer 1 μl, Downstream primer 1 μl, Add sterile water to 25 μl; The reaction conditions of the PCR amplification are: 94°C pre-denaturation for 5 minutes; 94°C denaturation for 30 seconds, 55°C annealing for 30 seconds, 72°C extension for 60 seconds, a total of 30 cycles; 72°C extension for 2 minutes; 4°C storage; the nucleotide sequence of the amplified product is shown in SEQ ID NO: 3 or SEQ ID NO:

4.

5. The use of the C4 gene molecular marker primers related to the egg weight trait according to claim 3, characterized in that: In the third step, the judgment standard is that the egg weight of the C / C genotype chickens at 37 weeks of age is higher than that of the C / T and T / T genotype individuals, and the egg weight of the C / T genotype chickens at 37 weeks of age is higher than that of the T / T genotype individuals.

Images