SSR (Simple Sequence Repeat) primer and method for identifying purity of Cuijin cabbage seeds
By using SSR primers for PCR amplification and electrophoresis separation, the rapid and accurate identification of the seed purity of Cuijin cabbage was achieved, and the problem of morphological methods being greatly affected by external factors was solved, and rapid, stable and low-cost seed purity detection was achieved.
Patent Information
- Application Number
- CN202411680578.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-22
- Publication Date
- 2025-01-07
AI Technical Summary
In the prior art, the identification of seed purity of Cuijin cabbage depends on morphological methods, which leads to great influences due to the external environment, planting season, planting technology and experience, long cycle and large workload, making it difficult to quickly and accurately identify seed purity, affecting seeds. Quality and economic losses to breeding companies.
PCR amplification and electrophoresis separation were performed using SSR primers (upstream primer Rapa11-F and downstream primer Rapa11-R). The hybrid purity was developed by silver staining and the calculation of hybrid purity was achieved quickly and accurately.
The seed purity of the Cuijin cabbage hybrid can be quickly and accurately identified within one to two hours. It is fast, stable, simple to operate, low cost, and is not affected by the environment. It solves the cycle caused by morphological identification in the prior art Long-term and high-working issues.
Smart Images
Figure CN119265349A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the field of hybrid seed purity identification, and in particular to an SSR primer and method for identifying the purity of Cuijin Chinese cabbage seeds. Background Art
[0002] Chinese cabbage (Brassica campestris L.) is an important vegetable in the genus Brassica of the family Cruciferae, also known as cabbage, Chinese cabbage, etc. Originated in my country, it has a long history of cultivation and a variety of varieties. It has the characteristics of high yield, strong storage and transportation resistance, excellent quality, and high nutritional value. It is one of the vegetable crops with the largest cultivation area and consumption in my country, and has important economic and edible value.
[0003] High-quality varieties are the key to ensuring the normal production and supply of Chinese cabbage, and seed purity is an important criterion for judging the quality of varieties. At present, Chinese cabbage mostly uses self-incompatible lines to produce hybrids. In the process of seed production, there are factors such as self-pollinated seeds, mixing of foreign pollen, or insufficient seed production distance, which lead to the phenomenon that the purity of hybrids does not meet the standards, seriously affecting the quality of seeds. Therefore, the purity of hybrid seeds is increasingly valued by seed companies and vegetable farmers. However, the current identification method of Chinese cabbage seed purity still uses the traditional field morphological identification method, which adopts field regional planting, takes the developed plants as the identification object, and identifies them based on the morphological characteristics and biological characteristics of the plants during the growth period. There are disadvantages such as long cycle, great influence of environmental factors, labor and land consumption, which are easy to lead to peak sales seasons, resulting in seed inventory backlogs, causing huge economic losses to breeding companies.
[0004] Cuijin cabbage is a new generation of hybrid medium-sized cabbage variety independently cultivated by Wuxi Puwei Agricultural Technology Co., Ltd., with a single head weight of 1-1.8kg, cylindrical shape, dark green outer leaves, embracing head, golden inner core, thin leaf veins, low moisture content, excellent taste, high quality, rapid differentiation of inner leaves under low temperature conditions, strong disease resistance, and good heat resistance. In order to cultivate high-quality Cuijin cabbage, it is necessary to identify the seed purity of Cuijin cabbage, which is an important indicator for evaluating the quality of Cuijin cabbage seeds. This variety has always used morphological identification of seed purity. With the increase in sowing area and seed demand, it is urgent to explore a purity identification method that is fast, accurate, and not easily affected by external factors. Summary of the invention
[0005] In view of the above-mentioned problems, the present invention provides an SSR primer and method for identifying the seed purity of green cabbage, which can solve the problems that the existing technology has always used morphology to identify seed purity, which is greatly affected by factors such as the external environment, planting season, planting technology and experience, and has a large workload and a long cycle. Therefore, the seed purity of green cabbage hybrids can be quickly and accurately identified within one or two hours, and has broad application prospects.
[0006] To achieve the above object, the technical solution adopted by the present invention is:
[0007] The present invention provides an SSR primer for identifying the purity of Cuijin Chinese cabbage seeds, comprising an upstream primer Rapa11-F and a downstream primer Rapa11-R, wherein:
[0008] The upstream primer Rapa11-F is: GCGTAGGTCCGATGTCTCTG;
[0009] The downstream primer Rapa11-R is: GCACCCGCATCTAACAGAGA.
[0010] The present invention provides a method for identifying the purity of green cabbage seeds, comprising:
[0011] (1) Extraction of the parents and hybrid F of the sample Cuijin Chinese cabbage 1 genomic DNA;
[0012] (2) using the SSR primers described in claim 1 to isolate the parent and hybrid F 1 PCR amplification of genomic DNA;
[0013] (3) using 8% polyacrylamide gel to separate the PCR amplification product of step (2) by electrophoresis and silver staining;
[0014] (4) Statistical results, calculation of the purity of the hybrid seeds of Cuijin Chinese cabbage, seed purity (%) = (total number of seeds tested - pseudo-hybrids) / total number of seeds tested × 100%;
[0015] The step (2) uses a 10 μl PCR reaction system: 5 μl 2×Taq Master Mix, 0.5 μl each of 10 μM upstream primer Rapa11-F and downstream primer Rapa11-R, 1.5 μl genomic DNA, and 2.5 μl of Tris-HCl at pH=8.0 and 0.1 μM;
[0016] The PCR reaction procedure uses Touch-down, which has six stages:
[0017] Stage 1: pre-denaturation at 95°C for 5 min;
[0018] The second stage: denaturation at 94°C for 45 seconds; annealing at 68-58°C for 6 cycles, decreasing by 2°C each cycle, 1 min each time; extension at 72°C for 1 min;
[0019] The third stage: denaturation at 94℃ for 30S; annealing at 58-50℃ for 8 cycles, decreasing by 1℃ each cycle, 1min each time; extension at 72℃ for 1min;
[0020] The fourth stage: denaturation at 94°C for 30 seconds; annealing at 50°C for 30 seconds; extension at 72°C for 1 minute; this stage was repeated 20 times;
[0021] Stage 5: extension at 72°C for 7 min;
[0022] Stage 6: Keep warm at 4°C.
[0023] The method for identifying the purity of Cuijin Chinese cabbage seeds provided by the present invention is preferably as follows: taking 3 mm 2 Place the cotyledons in a 2 ml centrifuge tube; add a 3 mm diameter steel ball and 300 μl DNA extract; place on a grinder and grind at a frequency of 50 Hz for 15 seconds; centrifuge at 10,000 rpm for 1 minute and take out for use.
[0024] In the method for identifying the purity of green cabbage seeds provided by the present invention, preferably, in the step (3), 8% polyacrylamide gel is used for electrophoresis detection of PCR amplification products: 1.5 μl of PCR amplification products are added to each spot well, and electrophoresis is performed, and the electrophoresis is stopped when the electrophoresis indicator is at the lower middle part of the gel;
[0025] Remove the gelatin plate, pour in the staining solution, and place on a shaker to shake slowly for 3 minutes;
[0026] Pour out the staining solution, add a small amount of distilled water to quickly wash three times, then pour in the color developing solution to develop the color, shake slowly until the strips are clean, and rinse with distilled water;
[0027] The total amount of dyeing solution is 1000ml, including 1.2g of AgNO 3 , and the rest is made up by distilled water; the total amount of the color developing solution is 1000ml, including 15g of NaOH and 15ml of formaldehyde, and the rest is made up by distilled water.
[0028] The method for identifying the purity of green brocade cabbage seeds provided by the present invention is preferably used in the step (4) to calculate the purity of green brocade cabbage hybrids: the gel obtained in the step (3) is placed on a film observation light, and photographs are taken to obtain statistical results. The hybrids having the specific bands of both the male and female parents are true hybrids, and the hybrids lacking any characteristic band of the two parents or having non-parent specific bands are false hybrids.
[0029] The above technical solution has the following advantages or beneficial effects:
[0030] The SSR primers and method for identifying the seed purity of green cabbage provided by the present invention can solve the problems of being greatly affected by external environment, planting season, planting technology and experience, and having a large workload and a long cycle due to the morphological identification of seed purity in the prior art, by screening and using primers with strong specificity that can simultaneously show the specific bands of the male and female parents in green cabbage hybrids, so that the seed purity of green cabbage hybrids can be quickly and accurately identified within one or two hours, and the method has the advantages of being fast, stable, simple to operate, low cost, not affected by the environment, etc., and can efficiently detect the seed purity of green cabbage hybrids, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0031] The present invention and its features, configurations and advantages will become more apparent by reading the detailed description of non-limiting embodiments with reference to the following drawings. The same reference numerals indicate the same parts throughout the drawings. The drawings are not drawn to scale, but rather to illustrate the subject matter of the present invention.
[0032] Figure 1 The Rapa11 provided in Example 1 of the present invention is used in the hybrid of Cuijin Chinese cabbage F 1 Electropherograms of the amplified products of the parental genes. DETAILED DESCRIPTION
[0033] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments, but is not intended to be a limitation of the present invention. The male and female parents of the Cuijin Chinese cabbage used can be obtained from the Chinese cabbage research group of Wuxi Puwei Agricultural Technology Co., Ltd., and the Cuijin Chinese cabbage hybrid is commercially available.
[0034] Embodiment 1:
[0035] 1. Materials
[0036] Take 10 seeds of each of the parents of Cuijin Chinese cabbage and randomly select 100 seeds of Cuijin Chinese cabbage hybrid F 1 , placed in a germination box at a constant temperature of 26°C in the dark for germination, and after germination, transferred to growth under light. Samples were collected after the cotyledons were completely flattened.
[0037] 2. Primer Screening
[0038] Firstly, DNA of one male and one female plant was extracted respectively, and 192 pairs of SSR primers were selected to perform PCR amplification and electrophoresis on the parental materials to screen out primers that can distinguish the different banding patterns of the parents. Then, 48 hybrid F 1 The polymorphic primers were verified by DNA sequencing, and Rapa11 was screened out as a polymorphic primer with obvious differences and easy to interpret, which can be used to detect the purity of hybrids.
[0039] Rapa11 includes an upstream primer Rapa11-F and a downstream primer Rapa11-R, wherein:
[0040] The upstream primer Rapa11-F is: GCGTAGGTCCGATGTCTCTG;
[0041] The downstream primer Rapa11-R is: GCACCCGCATCTAACAGAGA.
[0042] 3. Extraction of genomic DNA
[0043] Take 3mm 2 The cotyledons were placed in a 2 ml centrifuge tube; a steel ball with a diameter of 3 mm was added, and 300 μl of DNA extraction solution was added; the tube was placed in a grinder and ground at a frequency of 50 Hz for 15 seconds; the tube was centrifuged at 10,000 rpm for 1 minute and the tube was taken out for use.
[0044] IV. PCR Amplification and Detection
[0045] PCR reaction system: 2×Taq Master Mix 5 μl, 10 μM upstream primer Rapa11-F and downstream primer Rapa11-R 0.5 μl each, genomic DNA 1.5 μl, pH=8.0, 0.1 μM Tris-HCl 2.5 μl.
[0046] The PCR reaction procedure uses Touch-down, which has six stages:
[0047] Stage 1: pre-denaturation at 95°C for 5 min;
[0048] The second stage: denaturation at 94°C for 45 seconds; annealing at 68-58°C for 6 cycles, decreasing by 2°C each cycle, 1 min each time; extension at 72°C for 1 min;
[0049] The third stage: denaturation at 94℃ for 30S; annealing at 58-50℃ for 8 cycles, decreasing by 1℃ each cycle, 1min each time; extension at 72℃ for 1min;
[0050] The fourth stage: denaturation at 94°C for 30 seconds; annealing at 50°C for 30 seconds; extension at 72°C for 1 minute; this stage was repeated 20 times;
[0051] Stage 5: extension at 72°C for 7 min;
[0052] Stage 6: Keep warm at 4°C.
[0053] Detection of amplified products: Add 1.5 μl of amplified products to each spot well and perform electrophoresis. Stop electrophoresis when the electrophoresis indicator is at the lower middle of the gel. Remove the gel plate, pour in the staining solution, and place it on a shaker and shake slowly for 3 minutes. Pour out the staining solution, add a small amount of distilled water to quickly wash 3 times, then pour in the color developing solution for color development, shake slowly until the band is clean, and rinse with distilled water; the total amount of staining solution is 1000 ml, including 1.2 g of AgNO 3 , and the rest is made up by distilled water; the total amount of the color developing solution is 1000ml, including 15g of NaOH and 15ml of formaldehyde, and the rest is made up by distilled water.
[0054] 5. Seed purity identification
[0055] Using Rapa11 to isolate the hybrid F 1 PCR test, the result is Figure 1 As shown in the figure, it can be clearly seen that Rapa11 can clearly amplify the paternal-specific bands and the maternal-specific bands, and the hybrids show both parental band types. According to the results, it can be analyzed that the purity of this batch of seeds is 96%.
[0056] Those skilled in the art should understand that those skilled in the art can implement the above-mentioned variations by combining the prior art and the above-mentioned embodiments, which will not be described in detail here. Such variations do not affect the essential content of the present invention, and will not be described in detail here.
[0057] The above describes the preferred embodiments of the present invention. It should be understood that the present invention is not limited to the above-mentioned specific embodiments, and the devices and structures that are not described in detail should be understood to be implemented in a common manner in the art; any technician familiar with the art can make many possible changes and modifications without departing from the technical solution of the present invention, or modify them into equivalent embodiments with equivalent changes, which does not affect the essential content of the present invention. Therefore, any simple modifications, equivalent changes and modifications made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solution of the present invention are still within the scope of protection of the technical solution of the present invention.
Claims
1. An SSR primer for identifying the purity of Cuijin Chinese cabbage seeds, characterized in that: It includes an upstream primer Rapa11-F and a downstream primer Rapa11-R, wherein: The upstream primer Rapa11-F is: GCGTAGGTCCGATGTCTCTG; The downstream primer Rapa11-R is: GCACCCGCATCTAACAGAGA.
2. A method for identifying the purity of Cuijin Chinese cabbage seeds, characterized in that: include: (1) Extracting genomic DNA from the parents and hybrid F1 of the sample Cuijin Chinese cabbage; (2) using the SSR primers described in claim 1 to perform PCR amplification on the genomic DNA of the parents of the Chinese cabbage and the hybrid F1 in step (1); (3) using 8% polyacrylamide gel to separate the PCR amplification product of step (2) by electrophoresis and silver staining; (4) Statistical results, calculation of the purity of the hybrid seeds of Cuijin Chinese cabbage, seed purity (%) = (total number of seeds tested - pseudo-hybrids) / total number of seeds tested × 100%; The step (2) uses a 10 μl PCR reaction system: 5 μl 2×Taq Master Mix, 0.5 μl each of 10 μM upstream primer Rapa11-F and downstream primer Rapa11-R, 1.5 μl genomic DNA, and 2.5 μl of Tris-HCl at pH=8.0 and 0.1 μM; The PCR reaction procedure uses Touch-down, which has six stages: Stage 1: pre-denaturation at 95°C for 5 min; The second stage: denaturation at 94°C for 45 seconds; annealing at 68-58°C for 6 cycles, decreasing by 2°C each cycle, 1 min each time; extension at 72°C for 1 min; The third stage: denaturation at 94℃ for 30S; annealing at 58-50℃ for 8 cycles, decreasing by 1℃ each cycle, 1min each time; extension at 72℃ for 1min; The fourth stage: denaturation at 94°C for 30 seconds; annealing at 50°C for 30 seconds; extension at 72°C for 1 minute; this stage was repeated 20 times; Stage 5: extension at 72°C for 7 min; Stage 6: Keep warm at 4°C.
3. The method for identifying the purity of Cuijin Chinese cabbage seeds as claimed in claim 2, characterized in that: The specific steps of step (1) are as follows: 2 Place the cotyledons in a 2 ml centrifuge tube; add a 3 mm diameter steel ball and 300 μl DNA extract; place on a grinder and grind at a frequency of 50 Hz for 15 seconds; centrifuge at 10,000 rpm for 1 minute and take out for use.
4. The method for identifying the purity of Cuijin Chinese cabbage seeds as claimed in claim 2, characterized in that: In the step (3), 8% polyacrylamide gel is used for electrophoresis detection of PCR amplification products: 1.5 μl of PCR amplification products are added to each spot well, and electrophoresis is performed, and electrophoresis is stopped when the electrophoresis indicator is at the lower middle part of the gel; Remove the gelatin plate, pour in the staining solution, and place on a shaker to shake slowly for 3 minutes; Pour out the staining solution, add a small amount of distilled water to quickly wash three times, then pour in the color developing solution to develop the color, shake slowly until the strips are clean, and rinse with distilled water; The total amount of the dyeing solution is 1000 ml, including 1.2 g of AgNO3, and the rest is made up of distilled water; the total amount of the developing solution is 1000 ml, including 15 g of NaOH and 15 ml of formaldehyde, and the rest is made up of distilled water.
5. The method for identifying the purity of Cuijin Chinese cabbage seeds as claimed in claim 2, characterized in that: In the step (4), the purity of the hybrid of Cuijinbaicai is calculated by placing the gel obtained in the step (3) on a film observation lamp, taking photos and counting the results. The hybrids having the specific bands of both the male and female parents are true hybrids, while those lacking any characteristic band of the two parents or having non-parent specific bands are false hybrids.