RT-PCR multiple detection method for main viruses of solanum muricatum

Abstract

The invention discloses a reverse transcription-polymerase chain reaction (RT-PCR) multiple detection method for main viruses of solanum muricatum, and belongs to the technical field of plant virus detection. The RT-PCR multiple detection method for the main viruses of solanum muricatum disclosed by the invention is based on RT-PCR detection of a TaqMan fluorescent probe, and is used for specifically and rapidly detecting TMV, ToMV and PVS. According to the method, the operation steps are simple and clear, complex equipment and tedious operation are not needed, the detection time is greatly shortened, and the convenience of practical application is improved.

Description

Technical Field

[0001] The invention relates to the technical field of plant virus detection, and more specifically to a RT-PCR multiplex detection method for major melon and eggplant viruses. Background Art

[0002] Solanum muricatum, commonly known as ginseng fruit, is a Solanaceae crop propagated by cuttings. At present, virus disease is a serious problem in the production of Solanum muricatum. Due to continuous cuttings in production, Solanum muricatum accumulates a large amount of viruses. At present, domestic Solanum muricatum production is infected by tobacco mosaic virus (TMV), tomato mosaic virus (ToMV) and potato virus S (PVS). The occurrence of virus disease can cause Solanum muricatum to have wrinkled leaves, mosaic, short plants, weak flower bud differentiation ability and reduced yield. The detoxification method relying on plant tissue culture technology has been applied to Solanum muricatum, but the method for rapid and effective virus detection in detoxified seedlings, cutting seedlings and introduced seedlings has not yet been established. The commonly used detection method is appearance identification, which uses specific plants to produce unique and obvious symptoms to indicate viruses, such as mosaic, leaf shrinkage, etc. In addition, the immunological method of pathogens, ELISA, is also included to detect antibodies in tissues to detect plant viruses. However, this method has low sensitivity and cannot effectively detect some viruses when applied to virus-free seedlings or some samples with low virus content. The RT-PCR virus detection system based on TaqMan probes has high sensitivity and specificity, can perform quantitative detection, and can be used for the identification and classification of pathogens. The probe RT-PCR method can be used when ELISA is selected for further testing of positive samples in routine screening. The two methods can be used in combination to complement each other.

[0003] Therefore, providing a RT-PCR multiplex detection method for major Solanum cucumerinoides viruses is an urgent problem to be solved by those skilled in the art. Summary of the invention

[0004] In view of this, the present invention provides a RT-PCR multiplex detection method for major viruses of Solanum cucumerinum, which combines TaqMan fluorescent probes and RT-PCR method and has good specificity in multiple virus detection.

[0005] Compared with the prior art, the present invention improves detection sensitivity and specificity; provides more reliable results through automatic analysis of fluorescence signals and data processing; and is fast and simple to operate, thereby improving convenience in the actual application and production of melon eggplant.

[0006] In order to achieve the above object, the present invention adopts the following technical solution:

[0007] A primer and probe for RT-PCR detection of major viruses of Solanum cucumerinum, used for detecting TMV, ToMV and PVS;

[0008] The primer and probe sequences are as follows:

[0009] TMV-F: 5′-CACACGTGGTGCGTACGATAAC-3′; 5′ end labeled with VIC;

[0010] TMV-R: 5′-TCCAAGACACAACCCTTCGAT-3′; 5′ end labeled with BHQ1;

[0011] TMV-P: 5'-CACAGCTGCATAGAGACGGCATAC-3';

[0012] ToMV-F: 5′-TCAACATCCGACTTTTATTGCT-3′; 5′ end labeled with 6-FAM;

[0013] ToMV-R: 5′-CAGACACGGGTACAGGGATAA-3′; 5′ end labeled with BHQ1;

[0014] ToMV-P: 5'-ACACTTCGTTGGATGTTCGACCGAC-3';

[0015] PVS-F: 5′-ATATTCTCCTCGGGGAAGGG-3′; 5′ end labeled with CY5;

[0016] PVS-R: 5′-CGTCCAGCCWTCTGCCTAG-3′; 5′ end labeled with BHQ2;

[0017] PVS-P: 5'-CCAGTCGGTTCGCTCTCGTAGTCA-3'.

[0018] Further, a method for multiplex detection of major viruses of Solanum melone by RT-PCR is provided, wherein the specific steps are as follows:

[0019] (1) collecting leaf samples of the to-be-tested melon eggplant and preparing cDNA;

[0020] (2) using the cDNA prepared in step (1) as a template and performing RT-PCR detection using the primers and probes;

[0021] (3) The results are interpreted based on the fluorescence signals of 6-FAM, VIC and CY5. If the amplification Ct value is less than 35 and the amplification curve is S-shaped, it is reported as positive. If the Ct value is between 35 and 40 and the re-test result is still between 35 and 40, the result is reported as negative. If the Ct value is greater than 40, it is also reported as negative.

[0022] Furthermore, the reaction system of the RT-PCR is: 5 μL of 20 μmol / μL cDNA, 0.1 μL of probe, 1 μL of 5 U / μL Taq enzyme, 2.5 μL of 10×PCR buffer, 0.5 μL of 10 mmol / L dNTP mixed solution, 2 μL of 25 mmol / L MgCl2 solution, 0.5 μL each of 20 μmol / μL upstream and downstream primers, and finally filled to 25 μL with DEPC water.

[0023] Furthermore, the reaction procedure of the RT-PCR is: first 45°C for 10 min; pre-denaturation at 95°C for 15 min; and finally 40 cycles of amplification at 95°C for 15 s, 60°C for 1 min, and 72°C for 30 s.

[0024] Furthermore, the primers and probes or the detection method are used in detecting TMV, ToMV and PVS.

[0025] It can be seen from the above technical solutions that, compared with the prior art, the present invention discloses a RT-PCR multiplex detection method for major viruses of Solanum cucumerinum, which has the following beneficial effects:

[0026] (1) Improve detection sensitivity: RT-PCR technology based on TaqMan fluorescent probe can improve the sensitivity of virus detection, detect the presence of low concentrations of viruses, and improve the accuracy of detection.

[0027] (2) High specificity: TaqMan fluorescent probes are highly specific and can accurately identify target viral sequences, avoiding the occurrence of false positive results and improving the reliability of detection.

[0028] (3) Multiple virus detection: The present invention can simultaneously detect the presence of multiple viruses (tobacco mosaic virus, tomato mosaic virus, potato virus S), saving time and resources and improving detection efficiency.

[0029] (4) Fast and simplified operation: The operation steps of the present invention are simple and clear, and do not require complex equipment and cumbersome operations, which greatly shortens the detection time and improves the convenience of practical application. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0031] Figure 1 The accompanying drawing is a flow chart of the present invention;

[0032] Figure 2 The accompanying drawing is a fluorescence curve of the single-plex sensitivity test of TaqMan fluorescent probe RT-PCR of the present invention;

[0033] Among them, A: TaqMan fluorescent probe RT-PCR single-plex sensitivity test of TMV; B: TaqMan fluorescent probe RT-PCR single-plex sensitivity test of ToMV; C: TaqMan fluorescent probe RT-PCR single-plex sensitivity test of PVS; In A, B, and C, the curves from left to right correspond to different plasmid concentrations, from 10 7 -10 2 . DETAILED DESCRIPTION

[0034] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0035] In order to quickly and accurately detect viruses, the present invention screened out the most suitable internal reference gene for Solanum melanocarpa from the 9 commonly used internal reference genes in the Solanaceae family, and on this basis, established internal reference genes and tobacco mosaic virus (TMV), tomato mosaic virus (ToMV) and potato virus S (PVS) standards. Based on this, specific primers were designed, and the method of detecting three Solanum melanocarpa viruses TMV, ToMV, and PVS using TaqMan probe real-time quantitative RT-PCR was studied. Flow chart is shown in Figure 1 .

[0036] The tobacco mosaic virus (TMV) sequence is shown in SEQ ID NO.1:

[0037] ACACAGCAGATTCCATACATCAATAGAGTTTCAGGATTCCCGTACCCCGCCCATTTTTCCAAATTGGAAGTCGACGAGGTTGAGACACGCAGAACTACTCTCCGTTGTCCGGCCGATGTCACACATTATCTGAACAGGAGATATGAGGGCTTTGTCATGAGTACTTCTTCGGTTAAAAAGTCTGTTTCGCAGGAGATGGTTAGCGGAGCCGCTGTGATCAATCCGATCTCAAAACCCCTGCATGGCAAGATTCTGACGTTTACCCAATCGGATAAAGAAGCTCTGCTTTCAAGAGGGTATTCAGATGTTCACACTGTGCATGAAGTGCAAGGCGAGACATACTCTGATGTTTCACTAGTTAGGTTAACCCCTACACCAGTCTCCATCATTGCAGGAGACAGCCCACACGTTTTGGTTGCATTGTCGAGACACACCTGTTCGCTCAAGTACTACACTGTTGTTATGGATCCTTTAGTTAGTATTATTAGAGATCTAGAGAAACTTAGCTCGTACTTGTTAGATATGTATAAGGTCGATGCAGGAACACAATAGCAATTACAGATTGACTCGGTGTTCAAAGGTTCCAATCTTTTTGTGGCAGCGCCGAAGACTGGTGATATTTCTGATATGCAATTTTACTATGATAAGTGTCTCCCAGGTAACAGCACCATGATGAATAATTTTGATGCTGTTACCATGAGGTTGACTGACATCTCATTGAATGTCAAAGATTGCATATTGGATATGTCCAAGTCTGTTGCTGCG; SEQ ID NO.1.

[0038] The sequence of Tomato mosaic virus (ToMV) is shown in SEQ ID NO.2:

[0039] ATGTCTTACTCAATCACTTCTCCATCGCAATTTGTGTTTTTGTCATCTGTATGGGCTGACCCTATAGAATTGTTAAACGTTTGTACAAATTCGTTAGGTAACCAGTTTCAAACACAGCAAGCAAGAACTACTGTTCAACAGCAGTTCAGCGAGGTGTGGAAACCTTTCCCTCAGAGCACCGTCAGATTTCCTGGCGATGTTTATAAGGTGTACAGGTACAATGCAGTTTTAGATCCTCTAATTACTGCGTTGCTGGGGGCTTTCGATACTAGGAATAGAATAATCGAAGTAGAAAACCAGCAGAGTCCGACAACAGCTGAAACGTTAGATGCTACCCGCAGGGTAGACGACGCTACGGTTGCAATTCGGTCTGCTATAAATAATTTAGTTAATGAACTAGTAAGAGGTACTGGACTGTACAATCAGAATACTTTTGAAAGTATGTCTGGGTTGGTCTGGACCTCTGCACCTGCATCTTAA; SEQ ID NO.2。

[0040] The sequence of Potato virus S (PVS) is shown in SEQ ID NO.3:

[0041] AGCACCTTTAGGTTCACAGGTAAGAGTTCGAAGAAACTGTCCCACAGAGAAAATGCCGCCCAAACCGGATCCGACAAGCTCAGGAGAGACACCACAAACTATACCGCTTGTGCCGCCGCCCAGGAACGTAGAGGAGCATAGAGTTGGCCCAAATCAAGGGCACGGGCAGAATGAAGAGGCTATGCTGGAGCAGAGGCTCATCGGATTGATTGAACTCATGGCCTCGAAAAGGCACAATTCAACATTGAGCAACATCTCTTTCGAGATAGGTAGGCCCTCGCTTGAGCCGACCCCTGAAATGCGGAGGAATCCGGAGAACCCATACTCGCGGTTTTCAA; SEQ ID NO.3。

[0042] Example 1

[0043] 1.1 Test materials

[0044] RNA of Cucumis melonii was extracted by Trizol method, and cDNA was synthesized by TIANGEN FastKing one-step method to remove the first strand of genomic cDNA synthesis premix (KR118). The fragments of ToMV, TMV and PVS in Cucumis melonii leaves were amplified by PCR method. PCR reaction system: 2×TaqPCR Master Mix 14μL, template 1μL, upstream and downstream primers (10μmol / L) 1μL each, ddH2O supplemented 25μL. Pre-denaturation at 94℃ for 4min in PCR instrument, then cycle: 94℃ for 30s, 55℃ for 30s, 72℃ for 60s, 30 cycles; after the cycle, 72℃ for 10min. The primers used are shown in Table 1.

[0045] Table 1 PCR amplification virus primers

[0046]

[0047]

[0048] The PCR product was loaded on a 1.5% agarose gel and electrophoresed to separate the target fragment. After the target band position was determined, gel recovery was performed according to the instructions of the kit to obtain the purified ToMV, TMV, and PVS fragments. Then, the purified amplified fragments were connected to the pMD18-T vector (TaKaRa) according to the instructions, and then transferred to the DH5α competent cells (TaKaRa). The competent cells were cultured in a 37°C incubator for 12-16 hours, followed by blue-white screening to obtain positive clones and pick single clones. The surface of the control plate of the empty vector competent cells was covered with blue colonies, and the test group plate had blue colonies and white colonies. Select a single white colony with a clear boundary and add it to about 5 ml of LB liquid culture medium containing ampicillin (100 μg / mL), ensure that air enters the tube mouth, and gently shake and mix in a 37°C water bath for about 12-16 hours. After the cultivation is completed, the plasmid is extracted using the Mini BEST plasmid extraction kit Ver.5.0 (TaKaRa). The plasmids were named p-ToMV, p-TMV and p-PVS, respectively, and stored in a -20°C refrigerator as standard plasmids.

[0049] The plasmid concentration was quantified using a Nanodrop 2000 spectrophotometer (Thermo Scientific, China), with APT as the internal reference. According to the formula: plasmid copy number (copies / pL) = (plasmid concentration × 6.02 × 1029) / (330 Daltons / base × plasmid length), 1 × 10 8copy / ml p-TMV, p-ToMV and p-PVS gene recombinant plasmids containing target gene amplification sequences were prepared at a ratio of 1:10, 1:10 2 , 1:10 3 , 1:10 4 , 1:10 5 , 1:10 6 and 1:10 7 dilute to obtain 1×10 7 copy / ml, 1×10 6 copy / ml, 1×10 5 copy / ml, 1×10 4 copy / ml, 1×10 3 copy / ml, 1×10 2 copy / ml and 1×10 1 copy / ml of the test sample.

[0050] The reference genes of closely related Solanaceae crops were selected from IGG (http: / / icg.big.ac.cn), and APT (Adenine phosphoribosyltransferase, Assessment Number: CK270447) was finally selected through experimental comparison, and its upstream primer was GAACCGGAGCAGGTGAAGAA (SEQ ID NO.10); downstream primer was GAAGCAATCCCAGCGATACG (SEQID NO.11). In this study, a pair of specific primers and their corresponding TaqMan probes were designed for the conserved region Coatprotein of TMV, ToMV and PVS viruses (Table 2), and the primers and probes were synthesized and provided by Shanghai Shenggong Biotechnology Co., Ltd.

[0051] Table 2 TaqMan primer and probe information

[0052]

[0053] 1.2 TaqMan fluorescent probe RT-PCR reaction system and amplification conditions

[0054] The 25 μL reaction system contained: 5 μL cDNA (20 μmol / μL), 0.1 μL probe, 1 μL Taq enzyme (5 U / μL), 2.5 μL 10×PCR buffer, 0.5 μL dNTP mixed solution (10 mmol / L), 2 μL MgCl2 solution (25 mmol / L), 0.5 μL of upstream and downstream primers (20 μmol / μL), and finally filled to 25 μL with DEPC water. The PCR reaction conditions were set as follows: first 45°C for 10 min; pre-denaturation at 95°C for 15 min; and finally 40 cycles of amplification at 95°C for 15 s, 60°C for 1 min, and 72°C for 30 s. The results are interpreted based on the 6-FAM, VIC and CY5 fluorescence signals. If the amplification Ct value is less than 35 and the amplification curve is S-shaped, it is reported as positive; if the Ct value is between 35 and 40 and is retested once, and the retest result is still 35 to 40, the result is reported as negative; if the Ct value is greater than 40, it is also negative.

[0055] 2. Results Analysis

[0056] The aim of this study was to develop and validate a TaqMan fluorescent probe-based RT-PCR assay for the specific and rapid detection of TMV, ToMV, and PVS. Other positive samples (standard plasmids) were provided as controls as templates for the developed multiplex qPCR. The results showed that TMV, ToMV, and PVS were detected within the dilution range of 1 × 10 2 Copy to 1×10 7 The same amplification curves were observed for each copy, which means that the TaqMan fluorescent probe RT-PCR single-plex detection of TMV, ToMV and PVS has a good amplification performance from 1×10 2 Copy to 1×10 7 The wide linear range of TMV, while the non-template control (NTC; no cDNA, only primers, probe and polymerase) did not produce fluorescence and therefore did not amplify ( Figure 2 ), although 1×10 2 TMV CT values ​​> 35 are considered negative. Nucleotide mismatches in the primer and probe binding sites of TMV may affect low plasmid copies (less than 10 3 copy) detection sensitivity.

[0057] Based on the established single-plex TaqMan fluorescent probe RT-PCR detection method, this study established two sets of dual TaqMan fluorescent probe RT-PCR methods for melon and solanum virus. They are TMV / ToMV and PVS / ToMV. At the same time, the primers and probes of two melon and solanum viruses were added, and the sensitivity, amplification efficiency and repeatability of the established system were tested. A dual TaqMan fluorescent probe RT-PCR system that can quickly and accurately identify these three melon and solanum viruses was established. The results showed that the dual detection sensitivity of all viruses except ToMV and TMV was 10 3 copies / pL, the sensitivity of PVS reaches 10 2 The sensitivity of the TMV and ToMV TaqMan-based fluorescent probe RT-PCR assay was evaluated by serial dilution of the two synthetic plasmids. Compared with the sensitivity of the single-plex TaqMan fluorescent probe RT-PCR system, the ToMV / TMV dual detection showed a significant decrease, with ToMV reduced by 1 order of magnitude. The detection limits of ToMV and PVS were 10 3 copy / mL and 10 2 Compared with the single-plex fluorescent RT-PCR reaction, the amplification efficiency of ToMV was also reduced by one order of magnitude, while the sensitivity of PVS did not show a significant decrease.

[0058] Table 3 Repeatability test of TMV / ToMV dual fluorescent probe RT-PCR system

[0059]

[0060] The repeatability and reproducibility of the TaqMan fluorescent probe RT-PCR method were evaluated by calculating the intra-assay and inter-assay variations, respectively. The repeatability CV of the analysis of TMV and ToMV duplex tests ranged from 0.50% to 3.00%, with SD values ​​from 0.09 to 0.43, indicating that the analysis was highly reproducible (Table 3). Similarly, we also found that these assays were highly reproducible. The repeatability of the analysis of ToMV and PVS duplex tests with a CV of the mean inter-assay Ct values ​​ranged from 0.45% to 2.30%, with SD values ​​from 0.04 to 0.38, also showing good reproducibility (Table 4).

[0061] Table 4 Repeatability test of ToMV / PVS dual fluorescent probe RT-PCR system

[0062]

[0063] A method for multiplex detection of major viruses of Solanum melone by RT-PCR, the specific steps are as follows:

[0064] 1. Collect the leaf samples of the melon eggplant to be tested and place them in a sterile centrifuge tube.

[0065] 2. Use the Trizol method to extract RNA from Solanum melonense to ensure that high-quality RNA samples are extracted.

[0066] 3. Synthesis of cDNA: Synthesize cDNA using TIANGEN FastKing one-step genomic cDNA first-strand synthesis premix (KR118). Thaw the template RNA, 5×Fastking-RT SuperMIX and RNase-Free ddH2O on ice, add 1μL template RNA, 4μL 5×Fastking-RT SuperMIX, and 15μL RNase-Free ddH2O to the reaction system; perform reverse transcription at 45℃ for 15min and 95℃ for 3min, dilute the product concentration to about 100ng / μL, and store at -20℃ for later use.

[0067] 3. Prepare the reaction system, including primers, fluorescent probes, polymerase and cDNA to perform PCR amplification reaction, use specific primers and fluorescent probes to detect the presence of the target virus. Perform PCR amplification through real-time fluorescence quantitative PCR equipment and monitor the intensity of the fluorescent signal in real time.

[0068] 4. Determine the presence or absence of the target virus in the sample based on the real-time PCR amplification curve and fluorescence signal.

[0069] 72 leaf samples of Melon solanum were collected from the field for validation and compared with the results of conventional RT-PCR test. The results are shown in Table 5.

[0070] Table 5 Comparison between conventional RT-PCR and TaqMan fluorescent probe RT-PCR

[0071]

[0072] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A primer and probe for RT-PCR detection of major viruses of Solanum melone, characterized in that: Used to detect TMV, ToMV and PVS; The primer and probe sequences are as follows: TMV-F: 5′-CACACGTGGTGCGTACGATAAC-3′; 5′ end labeled with VIC; TMV-R: 5′-TCCAAGACACAACCCTTCGAT-3′; 5′ end labeled with BHQ1; TMV-P: 5'-CACAGCTGCATAGAGACGGCATAC-3'; ToMV-F: 5′-TCAACATCCGACTTTTATTGCT-3′; 5′ end labeled with 6-FAM; ToMV-R: 5′-CAGACACGGGTACAGGGATAA-3′; 5′ end labeled with BHQ1; ToMV-P: 5'-ACACTTCGTTGGATGTTCGACCGAC-3'; PVS-F: 5′-ATATTCTCCTCGGGGAAGGG-3′; 5′ end labeled with CY5; PVS-R: 5′-CGTCCAGCCWTCTGCCTAG-3′; 5′ end labeled with BHQ2; PVS-P: 5'-CCAGTCGGTTCGCTCTCGTAGTCA-3'.

2. A multiplex RT-PCR detection method for major viruses of Solanum melone, characterized in that: The specific steps are as follows: (1) collecting leaf samples of the to-be-tested melon eggplant and preparing cDNA; (2) using the cDNA prepared in step (1) as a template and performing RT-PCR detection using the primers and probes described in claim 1; (3) The results are interpreted based on the fluorescence signals of 6-FAM, VIC and CY5. If the amplification Ct value is less than 35 and the amplification curve is S-shaped, it is reported as positive. If the Ct value is between 35 and 40 and the re-test result is still between 35 and 40, the result is reported as negative. If the Ct value is greater than 40, it is also reported as negative.

3. A RT-PCR multiplex detection method for major viruses of Solanum melone according to claim 2, characterized in that: The reaction system of the RT-PCR is: 5 μL of 20 μmol / μL cDNA, 0.1 μL of probe, 1 μL of 5U / μL Taq enzyme, 2.5 μL of 10×PCR buffer, 0.5 μL of 10 mmol / L dNTP mixed solution, 2 μL of 25 mmol / L MgCl2 solution, 0.5 μL each of 20 μmol / μL upstream and downstream primers, and finally filled to 25 μL with DEPC water.

4. The RT-PCR multiplex detection method for major viruses of Solanum melone according to claim 2, characterized in that: The reaction procedure of the RT-PCR is: first, 45°C for 10 min; pre-denaturation at 95°C for 15 min; and finally, 40 cycles of amplification at 95°C for 15 s, 60°C for 1 min, and 72°C for 30 s.

5. Use of the primers and probes described in claim 1 or the detection method described in any one of claims 2 to 4 in detecting TMV, ToMV and PVS.

Images