Compositions and methods for treating liver disease with siRNA targeting CIDEB

Abstract

Disclosed herein are compositions comprising a siRNA capable of down-regulating expression of a cell death-inducing DFF45-like effector protein B (CIDEB) or a variant gene thereof. Also disclosed herein are methods of treating a liver disease or injury, such as fatty liver (FLD), non-alcoholic fatty liver disease (NAFLD), or non-alcoholic steatohepatitis (NASH), using such compositions.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of U.S. Provisional Application No. 63 / 328,557, filed on April 7, 2022, the entire disclosure of which is incorporated herein by reference for all purposes.

[0003] Sequence Listing

[0004] This application contains a sequence listing, which is submitted in XML format via EFS-Web, the entire text of which is incorporated herein by reference. The XML copy is named 106546-755471.xml and is 87KB in size. Background Art

[0005] 1. Field

[0006] The present inventive concept relates to compositions and methods of use for the treatment of liver diseases, particularly metabolic liver diseases, including but not limited to non-alcoholic fatty liver disease (NAFLD) and non-alcoholic steatohepatitis (NASH).

[0007] 2. Related technical discussions

[0008] NAFLD is a spectrum of chronic liver disorders that includes nonalcoholic fatty liver disease (NAFL) and nonalcoholic steatohepatitis (NASH). NASH is a common cause of chronic liver disease and is defined by steatosis and inflammation of at least 5% of the liver, with or without fibrosis. Over time, if left untreated, NASH may progress to cirrhosis and even hepatocellular carcinoma (HCC). In addition, NAFLD / NASH is closely associated with obesity and type II diabetes, which together affect more than 50% of the US population, resulting in a heavy economic burden. Unfortunately, treatment options for NASH remain limited, with only minor benefits from treatment with vitamin E or obeticholic acid. Although NASH is a major cause of chronic liver disease and cirrhosis, there are currently no clinically approved therapies. Therefore, new targets, therapies, and combinations thereof are needed to accelerate clinical progress in liver disease treatments. Summary of the invention

[0009] The present disclosure is based in part on the discovery that positive selection of somatic mutations in the liver of NASH patients can improve cell fitness and competitiveness by reducing lipid accumulation in NASH. Somatic mutation sequencing in human cirrhotic patients identified genetic alterations that may promote clonal fitness by reversing lipotoxicity. These works identified CIDEB (cell death-inducing DFF45-like effector protein B). Therefore, the present disclosure provides novel compositions that modulate CIDEB expression and methods for preventing, alleviating and / or treating liver disease.

[0010] In some aspects, the current disclosure relates to a composition comprising a nucleic acid that downregulates the expression of cell death-inducing DFF45-like effector protein B (CIDEB) or its variants. In some aspects, the nucleic acid that downregulates CIBED expression includes siRNA, clustered regularly spaced short palindromic repeats (CRISPR)-related nucleic acids, single guide RNA (sgRNA), CRISPR-RNA (crRNA), or trans-activating crRNA (tracrRNA). In some aspects, the nucleic acid that downregulates the expression of CIDEB or its variant genes is a small interfering RNA (siRNA) molecule. In some aspects, a plasmid or viral vector includes a nucleic acid encoding a siRNA molecule disclosed herein. In some aspects, the siRNA molecule includes a nucleotide sequence of 2 to 30 nucleotides in length and at least 80% homologous to at least 2 to 30 consecutive nucleotides of a human CIDEB cDNA sequence, wherein the human CIDEB cDNA sequence is SEQ ID NO: 1. In some aspects, the siRNA molecule targets an open reading frame or 5' or 3'UTR of the CIDEB gene. In some aspects, the siRNA molecule comprises at least one sense sequence, at least one antisense sequence, or at least one sense sequence and at least one antisense sequence. In some aspects, the siRNA molecule comprises a nucleotide sequence of SEQ ID NO: 2-97 or any combination thereof. In some aspects, at least one sense sequence comprises SEQ ID NO: 2-49. In some aspects, at least one antisense sequence comprises SEQ ID NO: 50-95.

[0011] In some aspects, the present disclosure also relates to a composition comprising a nucleic acid molecule that downregulates CIBED expression, wherein the nucleic acid is an sgRNA or the nucleic acid encodes an sgRNA. In some aspects, the composition comprises a plasmid or viral vector, wherein the plasmid or viral vector comprises a first nucleic acid encoding an sgRNA molecule disclosed herein, and optionally comprises a second nucleic acid encoding an RNA-guided nuclease. In some aspects, the RNA-guided nuclease is a Cas endonuclease.

[0012] In some aspects, the siRNA molecules disclosed herein specifically downregulate the gene expression of at least one variant of CIBED. In some aspects, the sgRNA molecules specifically downregulate the gene expression of at least one variant of CIBED. In some aspects, at least one variant of CIDEB is associated with liver disease. Non-limiting examples of liver disease include fatty liver disease (FLD), alcohol-related liver disease (ARLD), non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), end-stage liver disease (cirrhosis) caused by any cause, liver cancer, or any combination thereof.

[0013] In some aspects, the nucleic acid molecules disclosed herein can be conjugated with at least one targeting ligand. In some aspects, at least one targeting ligand includes a liver targeting ligand. In some aspects, the liver targeting ligand includes at least one N-acetylgalactosamine (GalNAc) conjugate. In some aspects, the nucleic acid molecule is conjugated with about one to about three GalNAc conjugates. In some aspects, the nucleic acid molecule comprises at least one chemical modification. In some aspects, the nucleic acid molecule includes a modification of at least one ribose moiety of its nucleotide sequence. In some aspects, at least one ribose molecule is modified by 2 2'-O-methyl (2'OMe), 2'-deoxy-2'-fluoro (2'F), 2'-deoxy, 5-C-methyl, 2'-O-(2-methoxyethyl) (MOE), 4'-thio, 2'-amino, 2'-C-allyl, or any combination thereof. In some aspects, less than about 10% to about 70% of the ribose moieties in the total nucleotide sequence are modified.

[0014] In some aspects, the disclosure also relates to a pharmaceutical composition comprising any of the compositions disclosed herein and at least one pharmaceutically acceptable carrier. In some aspects, the pharmaceutical composition further comprises nanoparticles. In some aspects, the pharmaceutical composition further comprises lipids.

[0015] In some aspects, the disclosure further relates to a method for treating a subject in need, the method comprising administering a therapeutically effective amount of a composition disclosed herein or a pharmaceutical composition disclosed herein. In some aspects, a subject in need is a human subject suffering from or suspected of having liver disease. In some aspects, liver disease includes fatty liver (FLD), alcohol-related liver disease (ARLD), non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), end-stage liver disease (cirrhosis) caused by any cause, liver cancer, or any combination thereof. In some aspects, the method of administration includes parenteral administration. In some aspects, compared with untreated subjects with the same disease condition and predicted results, administering a therapeutically effective amount of a composition disclosed herein or a pharmaceutical composition disclosed herein increases the life expectancy of the subject. In some aspects of the method, compared with untreated subjects with the same disease condition and predicted results, administering a therapeutically effective amount of a composition disclosed herein or a pharmaceutical composition disclosed herein improves the liver function of the subject. In certain aspects of the method, administration of a therapeutically effective amount of a composition disclosed herein or a pharmaceutical composition disclosed herein reduces liver fibrosis in a subject compared to an untreated subject with the same disease condition and predicted outcome. In certain aspects, administration of a therapeutically effective amount of a composition disclosed herein or a pharmaceutical composition disclosed herein prevents additional liver fibrosis in a subject compared to an untreated subject with the same disease condition and predicted outcome.

[0016] In some aspects, the present disclosure also relates to a kit, comprising: a container containing a composition disclosed herein or a pharmaceutical composition disclosed herein, a drug administration tool; and instructions for use. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] The following drawings constitute part of this specification and are used to further illustrate certain aspects of the present disclosure. Certain aspects of the present disclosure may be better understood by referring to the drawings in combination with the detailed description of specific embodiments herein.

[0018] Figure 1A Screening of 63 known NASH-associated genes is shown. The experimental scheme is shown in the figure.

[0019] Figure 1B Results from a screen of 63 known NASH-associated genes are shown. The most amplified clones tend to be associated with loss of lipogenic genes.

[0020] Figure 1C The screened popular genes are provided.

[0021] Figure 1D The pathways that these genes are involved in are shown. The results of this screen suggest that genes that are mutated in human cirrhotic liver tissue may be good drug targets for treating NASH. CIBED is such a gene that is frequently mutated in human liver disease.

[0022] Figure 2A Shown is a luciferase-based screen testing the relative knockdown efficacy of various CIDEB siRNAs.

[0023] Figure 2B Shown are CIDEB protein levels detected using Western blot analysis after siRNA knockdown.

[0024] The drawings do not limit the inventive concept to the specific embodiments disclosed and described herein. The drawings are not necessarily drawn to scale, emphasis instead being placed upon clearly illustrating the principles of certain embodiments of the inventive concept.

[0025] Detailed description

[0026] The following detailed description refers to the accompanying drawings that illustrate various embodiments of the inventive concept. The drawings and description are intended to describe the various aspects and embodiments of the inventive concept in sufficient detail so that those skilled in the art can practice the inventive concept. Other components may also be used and modified without departing from the inventive concept. Therefore, the following description is not intended to be limiting. The scope of the inventive concept is defined solely by the appended claims and the full range of equivalents to which these claims are entitled.

[0027] With the increase of overnutrition and obesity, non-alcoholic fatty liver disease (NAFLD) is rapidly becoming the leading cause of liver disease worldwide. NAFLD is usually conceptualized at the organismal and tissue levels, but genetic heterogeneity within liver clones is rarely considered. Somatic mutations are common in most healthy people, and there is increasing evidence that the mutation load increases with age and chronic tissue damage. The present disclosure is based in part on a new discovery that positive selection of somatic mutations in the liver of NASH patients can improve cell fitness and competitiveness by reducing lipid accumulation in NASH. Genomic sequencing of chronic liver disease samples has identified some genes that, when mutated, are likely to promote clonal fitness by reversing lipotoxicity, including CIDEB (cell death-inducing DFF45-like effector protein B). Therefore, the present invention provides compositions and methods of use for the treatment of liver diseases, especially metabolic liver diseases, including but not limited to non-alcoholic fatty liver disease (NAFLD) and non-alcoholic steatohepatitis (NASH).

[0028] I. Terminology

[0029] The words and terms used herein are for descriptive purposes only and should not be construed as limiting. For example, the use of singular terms, such as "a", "an", "an", "an" and "an" does not imply a limitation on the number of items. In addition, the use of relative terms, such as "top", "bottom", "left", "right", "above", "below", "lower", "upper" and "side" in the description is for clarity when specifically referring to the drawings and is not intended to limit the scope of the inventive concept or the appended claims.

[0030] In addition, since the inventive concept is subject to a variety of different forms of implementation, the present disclosure should be regarded as an embodiment of the inventive concept principle, and is not intended to limit the inventive concept to the specific embodiments shown and described. Any feature of the inventive concept can be used alone or in combination with any other feature. The term "implementation" and / or similar terms mentioned in the description mean that the mentioned feature is included in at least one aspect of the description. The terms "implementation" and / or similar terms mentioned separately in the description do not necessarily refer to the same implementation, nor are they mutually exclusive, unless otherwise specified and / or it is easy for a person skilled in the art to see from the description. For example, the features, structures, processes, steps, actions, etc. described in one implementation may also be included in other implementations, but not necessarily. Therefore, the inventive concept may include various combinations and / or combinations of the embodiments described herein. In addition, all aspects of the disclosure described herein are not essential to its practice. Similarly, other systems, methods, features and advantages of the inventive concept will also be apparent to those skilled in the art after reading the drawings and the description. All of these additional systems, methods, features and advantages should be included in this specification, belong to the scope of the inventive concept, and are included in the claims.

[0031] As used herein, the term "about" can mean relative to a recited value, such as an amount, dosage, temperature, time, percentage, etc.

[0032] ±10%, ±9%, ±8%, ±7%, ±6%, ±5%, ±4%, ±3%, ±2%, or ±1%.

[0033] The terms "include", "comprising", "involving" and "having" can be used interchangeably in this disclosure. The terms "include", "comprising", "involving" and "having" mean including but not necessarily limited to the stated contents.

[0034] As used herein, the terms "or" and "and / or" should be interpreted as inclusive or meaning any one or any combination. Thus, "A, B, or C" or "A, B, and / or C" means any of the following: "A", "B", or "C"; "A and B"; "A and C"; "B and C"; "A, B, and C". Exceptions to this definition will only occur if a combination of elements, functions, steps or acts are inherently mutually exclusive to some extent.

[0035] As used herein, "biomarker" refers to any biological molecule (such as nucleic acids, genes, peptides, proteins, lipids, hormones, metabolites, etc.) that can reflect the current state of a biological system or predict the future state, either alone or together. Therefore, as used herein, the presence or concentration of one or more biomarkers can be detected and associated with a known condition, such as a disease state. In some aspects, detecting the presence and / or concentration of one or more biomarkers herein can be used as an indication of the risk of liver disease in a subject. In other aspects, detecting the presence and / or concentration of one or more biomarkers herein can be used to treat and / or prevent chronic liver disease in a subject.

[0036] As used herein, the terms "treat," "treatment," and the like, unless otherwise indicated, may refer to reversing, alleviating, inhibiting, or preventing the process of the disease, disorder, or condition to which the term applies, or one or more symptoms of the disease, disorder, or condition, including the administration of any composition, pharmaceutical composition, or dosage form described herein to prevent the occurrence of symptoms or complications, or to alleviate symptoms or complications, or to eliminate the condition or disorder.

[0037] The term "biological macromolecule" as used herein refers to, but is not limited to, proteins, enzymes, antibodies, DNA, siRNA, and small molecules. "Small molecules" as used herein may refer to chemicals, compounds, drugs, etc.

[0038] The term "nucleic acid" or "polynucleotide" refers to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) and polymers thereof in single-stranded or double-stranded form. Unless otherwise specified, the term includes nucleic acids containing known analogs of natural nucleotides, which have similar binding properties to the reference nucleic acid and are metabolized in a manner similar to natural nucleotides. Unless otherwise specified, a specific nucleic acid sequence also implicitly includes conservatively modified variants thereof (such as degenerate codon substitutions), alleles, orthologs, SNPs and complementary sequences as well as the sequences explicitly indicated. Specifically, degenerate codon replacement can be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and / or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); and Rossolini et al., Mol. Cell. Probes 8:91-98 (1994)).

[0039] The terms "peptide", "polypeptide" and "protein" are used interchangeably and refer to compounds composed of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, but there is no limit to the maximum number of amino acids that make up a protein or peptide sequence. Polypeptides include any peptide or protein that includes two or more amino acids linked to each other by peptide bonds. The term used herein refers to both short chains, which are also commonly referred to as peptides, oligopeptides and oligomers in the art, and long chains, which are commonly referred to as proteins in the art, and there are many types. "Polypeptides" include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, polypeptide variants, modified polypeptides, derivatives, analogs, fusion proteins, etc. Polypeptides include natural peptides, recombinant peptides or, or a combination thereof.

[0040] It should also be understood that, unless explicitly stated to the contrary, in any method claimed herein, if more than one step or action is included, the order of the steps or actions of the method is not necessarily limited to the order in which the steps or actions of the method are described.

[0041] II. Composition

[0042] (a) CIDEB

[0043] In certain embodiments, the compositions used in the methods disclosed herein can modulate the CIDEB (cell death-inducing DFF45-like effector protein B) gene. The CIDEB gene encodes the CIDEB protein, which is the main CIDE family member active in hepatocytes. Under normal dietary conditions, CIDEB promotes lipid storage and promotes the formation of triglyceride-rich VLDL particles in hepatocytes.

[0044] As used herein, a composition that "modulates" CIDEB may include any biomolecule that can reduce CIDEB gene expression, reduce CIDEB protein expression, reduce CIDEB activity, or a combination thereof. In some aspects, the biomolecule that can modulate CIDEB herein may be an inhibitor of CIDEB. As used herein, an inhibitor of CIDEB may inhibit the direct activity of CIDEB, inhibit the indirect activity of CIDEB, reduce the expression of the CIDEB gene, reduce the expression of the CIDEB protein, or a combination thereof.

[0045] In certain embodiments, the compositions used for the methods disclosed herein may include nucleic acid molecules. As used herein, the term "nucleic acid molecule" refers to a molecule having nucleotides. Nucleic acids may be single-stranded, double-stranded, or multi-stranded, and may include modified or unmodified nucleotides or non-nucleotides or various mixtures and combinations thereof. In some embodiments, the nucleic acid molecules used herein may be double-stranded RNA. In certain embodiments, the double-stranded RNA suitable for use herein may be small sequence RNA, small nuclear RNA, small nucleolar RNA, short hairpin RNA, micro RNA, or the like. In certain embodiments, the double-stranded RNA suitable for use herein may be small interfering RNA (siRNA).

[0046] The term "siRNA" as used herein refers to a small inhibitory RNA duplex that induces the RNA interference (RNAi) pathway. The siRNA molecules disclosed herein can silence, reduce and / or inhibit the expression of a target gene (such as CIDEB). The length of these molecules can vary (generally about 5-50 base pairs), and the degree of complementarity with their target mRNA in the antisense strand can also vary. Some siRNAs (but not all siRNAs) have unpaired overhanging end bases at the 5' or 3' end of the sense strand and / or antisense strand. The term "siRNA" as used herein includes a duplex of two independent chains, and also includes a single strand that can form a hairpin structure containing a double-stranded region.

[0047] In certain embodiments, the siRNA molecules disclosed herein can be any interfering RNA with a double-stranded length of about 2-60, about 5-50, or about 10-40 nucleotides, more typically about 2-30, about 5-25, or about 10-25 nucleotides. In some embodiments, the siRNA molecules disclosed herein can have a nucleotide sequence of about 2 to about 30 nucleotides, about 5 to about 25 nucleotides, or about 10 to about 20 nucleotides in length. In some embodiments, the siRNA molecules disclosed herein can have a length of about 10 nucleotides, a length of about 11 nucleotides, a length of about 12 nucleotides, a length of about 13 nucleotides, a length of about 14 nucleotides, a length of about 15 nucleotides, a length of about 14 nucleotides, a length of about 15 nucleotides, a length of about 16 nucleotides, a length of about 17 nucleotides, a length of about 18 nucleotides, a length of about 19 nucleotides, a length of about 20 nucleotides, a length of about 21 nucleotides, a length of about 22 nucleotides, a length of about 23 nucleotides, a length of about 24 nucleotides, or a length of about 25 nucleotides. Each complementary sequence of the double-stranded siRNA can be about 2-60, about 5-50, about 10-40, about 2-30, about 5-25, or about 10-25 nucleotides in length, but other non-complementary sequences may also be present. For example, the siRNA duplex can include a 3' overhang of about 1 to about 4 or more nucleotides and / or a 5' phosphate end of about 1 to about 4 or more nucleotides.

[0048] In certain embodiments, the siRNA molecules disclosed herein may have about 2-60, about 2-50, about 2-40, or about 2-30 consecutive homologous nucleotides with a target nucleotide sequence (such as CIDEB). In some aspects, the target nucleotide sequence herein may be a human CIDEB nucleotide sequence or a variant thereof. In other aspects, the target nucleotide sequence herein may be human CIDEB, reference sequence (RefSeq): NM_001393339.1 or a variant thereof. In other aspects, the target nucleotide sequence herein may be the following SEQ ID NO: 1 or a variant thereof:

[0049] Human CIDEB (SEQ ID NO: 1):

[0050] CCCTTCCGGTGGAGCCAGCGCTGCGACCGCCTGCAGAAGGTTGACTGCGTGGTAGGGG

[0051] GCCCAGAGCAAGCCGAAGGCAAGCACGATGGCGCTCACCAGCCGGCCCACCCGCGCC

[0052] CCGTGCCGCCCGGAGCCCCAGCGGGCGCCCCGCAGCCGTGCCAGCGTCACGCTGTAGC

[0053] AGCCGAGCATCAGCCCGAAAGGAAGCACGAAAGCGGTCAGAGTCTCCAGGCTCAGGT

[0054] GGGCGGCGGCGTGGACCGGCGACGGGTGGCACAGCTGGCATACGCGGTCCCTCCACA

[0055] GGTGGCGGTAGACGGCGGCCGGGACGGCGAGCAACAGGGCGGCCAGCCAGACCGCCA

[0056] GCAGCAGGCGGCGGGCCAGGGCCGGGCTGCGCAGCCGAGGCCAGGAAGGGGCGGG

[0057] TGACTGCGAGGCAGCGCTGCAGGCTGAGCAGGCCGGTGAGCAGCACGCTGGCGTACAT

[0058] GCTGAGCGCGCACACGTAGTACACCGCCTTGCAGCCCGCCTGGCCCAGCGGCCAGGCC

[0059] TGCCGGGTCAGGAAGGCCACAAAGAGCGGCGTGAGCAGCAGCACCGCGCCGTCGGCC

[0060] AGCGCCAGGTGCAGCACAAGCGTGGCCGCCAGCGGTCGCCCCCGTGCAGGCCGCCAGC

[0061] CCGCCAAGCTCCACACCACGAAGCCGTTGCCAGGCAGCCCCAGCAGCGCCGCCAGCAG

[0062] CAGGAAGGCTGTGCCTGTGGCCCGCGAAGTCTTCCAGCTCAGCAGTGTCTCGTTCCCTG

[0063] GGGGACGGTAGCAGACCGACATCCTTCTGGGCCTACAGTGAGAGTCTCAGCTTCCATG

[0064] CAACTGTCCATCACGGCTGCAACTGAAATCAGAGCTGGGACACAGCGCACCAGAAGCT

[0065] AAAGTCTTGATGCCATCAAAGGACATCCCTGCCCCATTCACATCTCTGTCACGTCCACT

[0066] AATCGGCAAAAGGAGAAAAGTGAGAGAAGATGACCTAAGTGTGACTGCAGCAGGCAG

[0067] CTCTGGAAAATGAAGCCAGAGCAGTGAGCCAGCCCCTCCTCCGACCAAGGAGGAAGG

[0068] AAAGAGCAGCCCCAGCACAGGAGAGAACCACCCAGCCCAGAAGTTCCAGGGAAGGAA

[0069] CTCTCCGGTCCACCATGGAGTACCTCTCAGCTCTGAACCCCAGTGACTTACTCAGGTCA

[0070] GTATCTAATATAAGCTCGGAGTTTGGACGGAGGGTCTGGACCTCAGCTCCACCACCCC

[0071] AGCGACCTTTCCGTGTCTGTGATCACAAGCGGACCATCCGGAAAGGCCTGACAGCTGC

[0072] CACCCGCCAGGAGCTGCTAGCCAAAGCATTGGAGACCCTACTGCTGAATGGAGTGCTA

[0073] ACCCTGGTGCTAGAGGAGGATGGAACTGCAGTGGACAGTGAGGACTTCTTCCAGCTGC

[0074] TGGAGGATGACACGTGCCTGATGGTGTTGCAGTCTGGTCAGAGCTGGAGCCCTACAAG

[0075] GAGTGGAGTGCTGTCATATGGCCTGGGACGGGAGAGGCCCAAGCACAGCAAGGACAT

[0076] CGCCCGATTCACCTTTGACGTGTACAAGCAAAACCCTCGAGACCTCTTTGGCAGCCTGA

[0077] ATGTCAAAGCCACATTCTACGGGCTCTACTCTATGAGTTGTGACTTTCAAGGACTTGGC

[0078] CCAAAGAAAGTACTCAGGGAGCTCCTTCGTTGGACCTCCACACTGCTGCAAGGCCTGG

[0079] GCCATATGTTGCTGGGAATTTCCTCCACCCTTCGTCATGCAGTGGAGGGGGCTGAGCAG

[0080] TGGCAGCAGAAGGGCCGCCTCCATTCCTACTAAGGGGCTCTGAGCTTCTGCCCCCAGA

[0081] ATCATTCCAACCGACCCACTGCAAAGACTATGACAGCATCAAATTTCAGGACCTGCAG

[0082] ACAGTACAGGCTAGATAACCCACCCAATTTCCCCACTGTCCTCTGATCCCCTCGTGACA

[0083] GAACCTTTCAGCATAACGCCTCACATCCCAAGTCTATACCCTTACCTGAAGAATGCTGT

[0084] TCTTTCCTAGCCACCTTTCTGGCCTCCCACTTGCCCTGAAAGGCCAAGATCAAGATGTC

[0085] CCCCAGGCATCTTGATCCCAGCCTGACTGCTGCTACATCTAATCCCCTACCAATGCCTC

[0086] CTGTCCCTAAACTCCCCAGCATACTGATGACAGCCCTCTCTGACTTTACCTTGAGATCT

[0087] GTCTTCATACCCTTCCCCTCAAACTAACAAAAACATTTCCAATAAAAATATCAAATATT

[0088] TACCACTAA

[0089] In certain embodiments, the siRNA molecules disclosed herein may have a length of about 2-30 consecutive nucleotides and a nucleotide sequence that is at least about 80% homologous (e.g., about 80%, about 85%, about 90%, about 95%, or about 99%) to at least about 2 to about 30 consecutive nucleotides of the human CIDEB cDNA sequence. In some embodiments, the siRNA molecules disclosed herein may have a length of about 2-30 consecutive nucleotides and a nucleotide sequence that is at least 80% homologous (e.g., about 80%, about 85%, about 90%, about 95%, or about 99%) to at least about 2 to about 30 consecutive nucleotides of the human CIDEB sequence reference sequence: NM_001393339.1 or a variant thereof. In some embodiments, the siRNA molecules disclosed herein may have a nucleotide sequence of about 2-30 consecutive nucleotides in length and at least 80% homologous (e.g., about 80%, about 85%, about 90%, about 95%, or about 99%) to at least about 2 to about 30 consecutive nucleotides of SEQ ID NO: 1. In other embodiments, the siRNA molecules disclosed herein may have a nucleotide sequence of about 2-30 consecutive nucleotides in length and at least about 2 to about 30 consecutive nucleotides homologous to SEQ ID NO: 1.

[0090] The siRNA molecules disclosed herein can be synthesized in any of a variety of ways. One skilled in the art can identify siRNA conformational configurations for a particular purpose. Examples of siRNA configurations include, but are not limited to: a double-stranded polynucleotide molecule assembled from two independent strand molecules, one of which is a sense strand and the other is a complementary antisense strand; a double-stranded polynucleotide molecule assembled from single-stranded molecules, wherein the sense region and the antisense region are connected by a nucleic acid-based or non-nucleic acid-based linker; a double-stranded polynucleotide molecule having a hairpin secondary structure, which has a complementary sense region and an antisense region; or a circular single-stranded polynucleotide molecule having two or more circular structures and a stem, the stem having a self-complementary sense region and an antisense region. For circular polynucleotides, the polynucleotides can be treated in vivo or in vitro to produce active double-stranded siRNA molecules.

[0091] In certain embodiments, the siRNA molecules disclosed herein can be double-stranded siRNA molecules. In certain aspects, the double-stranded siRNA molecules disclosed herein can have at least one sense sequence. In other aspects, the double-stranded siRNA molecules disclosed herein can have at least one antisense sequence. In other aspects, the double-stranded siRNA molecules disclosed herein can have at least one antisense sequence and at least one sense sequence. In some embodiments, the double-stranded siRNA molecules disclosed herein can have at least one antisense sequence selected from Table 1, at least one sense sequence selected from Table 1, or both.

[0092] Table 1

[0093]

[0094]

[0095]

[0096]

[0097] In some embodiments, the double-stranded siRNA molecules disclosed herein may have at least one sense sequence having at least about 80% (e.g., about 80%, about 85%, about 90%, about 95%, or about 99%) homology to any one of SEQ ID NOs: 2-49. In some embodiments, the double-stranded siRNA molecules disclosed herein may have at least one antisense sequence having at least about 80% (e.g., about 80%, about 85%, about 90%, about 95%, or about 99%) homology to any one of SEQ ID NOs: 50-97. In some embodiments, the double-stranded siRNA molecules disclosed herein may have at least one sense sequence having at least about 80% (e.g., about 80%, about 85%, about 90%, about 95%, or about 99%) homology to any one of SEQ ID NOs: 2-49, and at least one antisense sequence having at least about 80% (e.g., about 80%, about 85%, about 90%, about 95%, or about 99%) homology to any one of SEQ ID NOs: 50-97. In some embodiments, the double-stranded siRNA molecules disclosed herein may have at least one sense sequence of SEQ ID NOs: 2-49. In some embodiments, the double-stranded siRNA molecules disclosed herein may have at least one antisense sequence of SEQ ID NOs: 50-97. In some embodiments, the double-stranded siRNA molecules disclosed herein may have at least one sense sequence of SEQ ID NOs: 2-49 and at least one antisense sequence of SEQ ID NOs: 50-97. In some other aspects, the double-stranded siRNA molecules disclosed herein may have at least one sense sequence of SEQ ID NO: 2-19 and at least one antisense sequence of SEQ ID NO: 50-67. In some aspects, the double-stranded siRNA molecules disclosed herein may have at least one sense sequence of SEQ ID NO: 36-49 and at least one antisense sequence of SEQ ID NO: 84-97. In some aspects, the double-stranded siRNA molecules disclosed herein may have a sense sequence of SEQ ID NO: 2 and an antisense sequence of SEQ ID NO: 50. In some aspects, the double-stranded siRNA molecules disclosed herein may have a sense sequence of SEQ ID NO: 3 and an antisense sequence of SEQ ID NO: 51. In some aspects, the double-stranded siRNA molecules disclosed herein may have a sense sequence of SEQ ID NO: 17 and an antisense sequence of SEQ ID NO: 65. In some aspects, the double-stranded siRNA molecules disclosed herein may have a sense sequence of SEQ ID NO: 18 and an antisense sequence of SEQ ID NO: 66.

[0098] In some embodiments, the present disclosure also relates to nucleic acid sequences encoding double-stranded siRNA molecules disclosed herein. In some embodiments, the nucleic acid sequence encoding the double-stranded siRNA disclosed herein can be double-stranded DNA, single-stranded DNA, plasmid vectors, viral vectors, such as retroviral vectors, lentiviral vectors, poxvirus vectors, adenoviral vectors, or adenovirus-associated vectors. In some embodiments, the nucleic acid may encode at least one sense sequence having at least about 80% (e.g., about 80%, about 85%, about 90%, about 95%, or about 99%) homology to any one of SEQ ID NOs: 2-49. In some embodiments, the nucleic acid may encode at least one antisense sequence having at least about 80% (e.g., about 80%, about 85%, about 90%, about 95%, or about 99%) homology to any one of SEQ ID NOs: 50-97. In some embodiments, the nucleic acid may encode at least one sense sequence having at least about 80% (e.g., about 80%, about 85%, about 90%, about 95%, or about 99%) homology to any one of SEQ ID NOs: 2-49, and at least one antisense sequence having at least about 80% (e.g., about 80%, about 85%, about 90%, about 95%, or about 99%) homology to any one of SEQ ID NOs: 50-97. In some embodiments, the nucleic acid may encode at least one sense sequence of any one of SEQ ID NOs: 2-49. In some embodiments, the nucleic acid may encode at least one antisense sequence of any one of SEQ ID NOs: 50-97. In some embodiments, the nucleic acid may encode at least one sense sequence of SEQ ID NOs: 2-49 and at least one antisense sequence of SEQ ID NOs: 50-97. In some embodiments, the nucleic acid may encode the sense sequence of SEQ ID NO: 2 and the antisense sequence of SEQ ID NO: 50. In some aspects, the nucleic acid can encode the sense sequence of SEQ ID NO: 3 and the antisense sequence of SEQ ID NO: 51. In some aspects, the nucleic acid molecule can encode the sense sequence of SEQ ID NO: 17 and the antisense sequence of SEQ ID NO: 65. In some aspects, the nucleic acid molecule can encode the sense sequence of SEQ ID NO: 18 and the antisense sequence of SEQ ID NO: 66.

[0099] The present disclosure also provides methods for making siRNA molecules disclosed herein. The manufacture of siRNA can be by chemical synthesis, or siRNA can be encoded and transcribed by a plasmid, or siRNA can be expressed by an engineered viral vector. siRNA can be a single-stranded molecule with complementary sequences that can self-hybridize into a duplex with a hairpin loop. siRNA can also be produced by cleaving the parent dsRNA using an appropriate enzyme, such as E. coli RNase III or Dicer. The parent dsRNA can be any double-stranded RNA duplex that can produce siRNA, such as a complete or partial mRNA transcript. The use of cell lysates or in vitro treatment may further involve the subsequent separation of short nucleotide siRNAs (e.g., about 2-25 nucleotides in length) from the lysate, making the entire process somewhat cumbersome and expensive. The method of chemical synthesis is to first make two single-stranded RNA-oligomers, and then anneal the two single-stranded oligomers into double-stranded RNA. There are many different methods for chemical synthesis, and different siRNAs can be easily synthesized.

[0100] In certain embodiments, the siRNA molecules disclosed herein can eliminate the gene expression of CIDEB. RNA expression detection and quantification methods known in the art that are applicable to this article include, but are not limited to, northern blotting and in situ hybridization, RNAse protection detection, polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), real-time quantitative reverse transcription PCR (RT-qPCR or qPCR), gene expression analysis based on sequencing (such as continuous analysis of gene expression (SAGE)), gene expression analysis of massively parallel signature sequencing (MPSS), etc.

[0101] The siRNA molecules of the present invention can specifically downregulate the gene expression of CIDEB or its variants. The term downregulation can be interchangeably expressed as reducing, inhibiting, preventing, blocking or silencing. Here, "downregulating gene expression" refers to a decrease in the gene expression level compared to the normal expression level. For example, the reduced gene expression level can be about 70% to 0% of the normal expression level. In other words, compared to the normal expression level, about 30% to 100% of the gene expression is downregulated, reduced, blocked, inhibited, prevented or silenced. Specifically, the reduced gene expression level is about 70%, 65%, 60%, 55%, 50%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 8%, 5%, 4%, 3%, 2%, 1% or 0% of the normal expression level of CIDEB. The reduction in the gene expression level can also be any percentage or range as described above. On the other hand, the term "specific" or "specifically" used in connection with downregulation refers to downregulation of expression of a target gene with little or no binding or downregulation of other nucleic acids or their expression.

[0102] In some embodiments, the siRNA molecules disclosed herein can reduce the gene expression of CIDEB by at least about 50%. In some aspects, the siRNA molecules disclosed herein can reduce the gene expression of CIDEB by about 50% to about 99%, about 55% to about 98%, or about 60% to about 95%. In some aspects, the siRNA molecules disclosed herein can reduce the gene expression of CIDEB by about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 99%.

[0103] In some embodiments, the siRNA molecules disclosed herein can eliminate the expression of CIDEB protein. Protein expression detection and quantification methods known in the art suitable for use herein include, but are not limited to, ELISA (enzyme-linked immunosorbent assay), immunoblotting assay, flow cytometry, immunohistochemistry assay, radioimmunoassay, protein blot (Western blot) assay, immunofluorescence assay, chemiluminescence assay, mass spectrometry, matrix-assisted laser desorption / ionization time of flight (MALDI-TOF) mass spectrometry, liquid chromatography / quadrupole time of flight electrospray tandem mass spectrometry (LC / Q-TOF-ESI-MS / MS), two-dimensional polyacrylamide gel electrophoresis (2D-PAGE), etc.

[0104] In some embodiments, siRNA molecules disclosed herein can reduce CIDEB protein expression by at least about 50%. In some aspects, siRNA molecules disclosed herein can reduce CIDEB protein expression by about 50% to about 99%, about 55% to about 98%, or about 60% to about 95%. In some aspects, siRNA molecules disclosed herein can reduce CIDEB protein expression by about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 99%.

[0105] In some embodiments, the siRNA molecules disclosed herein may have one or more chemical modifications. Non-limiting examples of chemical modifications may include end caps, phosphate backbone modifications, and the like. Examples of classes of end caps include, but are not limited to, inverted deoxy abasic residues, glycerol modifications, 4′,5′-methylene nucleotides, 1-(β-D-furanose) nucleotides, 4′-thionucleotides, carbocyclic nucleotides, 1,5-anhydrohexitol nucleotides, L-nucleotides, α-nucleotides, modified base nucleotides, threo-pentofuranosyl (threo-pentofuranosyl) nucleotides, and the like. pentofuranosyl) nucleotide, acyclic 3′,4′-seco nucleotide, acyclic 3,4-dihydroxybutyl nucleotide, acyclic 3,5-dihydroxypentyl nucleotide, 3′-3′-reverse nucleotide portion, 3′-3′-reverse abasic portion, 3′-2′-reverse nucleotide portion, 3′-2′-reverse abasic portion, 5′-5′-reverse nucleotide portion, 5′-5′-reverse abasic portion, 3′-5′-reverse deoxy abasic portion, 5′ -aminoalkyl phosphate, 1,3-diamino-2-propyl phosphate, 3-aminopropyl phosphate, 6-aminohexyl phosphate, 1,2-aminododecyl phosphate, hydroxypropyl phosphate, 1,4-butanediol phosphate, 3'-phosphoramidate, 5'-phosphoramidate, hexyl phosphate, aminohexyl phosphate, 3'-phosphate, 5'-amino, 3'-phosphorothioate, 5'-phosphorothioate, phosphorodithioate, and bridged or non-bridged methylphosphonate or 5'-sulfhydryl moiety. Non-limiting examples of phosphate backbone modifications (i.e., resulting in modified internucleotide connections) include phosphorothioate, phosphorodithioate, methylphosphonate, phosphotriester, morpholino, amidate, carbamate, carboxymethyl, acetamidate, polyamide, sulfonate, sulfonamide, sulfamate, methylal, thiomethylal, and alkylsilicon substitution. These chemical modifications can occur at the 5' end and / or the 3' end of the sense strand, the antisense strand, or both strands of the siRNA.

[0106] Chemical modification of the siRNA molecules disclosed herein may include modification of at least one ribose moiety in its nucleotide sequence. The ribose moiety may be modified with 2 2′-O-methyl (2′OMe), 2′-deoxy-2′-fluoro (2′F), 2′-deoxy, 5-C-methyl, 2′-O-(2-methoxyethyl) (MOE), 4′-thio, 2′-amino, 2′-C-allyl, or any combination thereof. In some aspects, the siRNA molecules disclosed herein account for less than about 10% to about 70% (e.g., about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%) of the ribose moiety of the total nucleotide sequence.

[0107] Chemical modification of siRNA molecules disclosed herein may include connecting a conjugate to the siRNA molecule. The type of conjugate used and the degree of conjugation to siRNA can be evaluated for improving the pharmacokinetic characteristics, bioavailability and / or stability of siRNA while maintaining its activity. Therefore, those skilled in the art can utilize any of various well-known in vitro cell culture or in vivo animal models, including the above-mentioned negative control expression studies, to screen siRNA molecules connected with various conjugates to identify siRNA conjugates with improved properties. Conjugates can be connected to the 5' end and / or 3' end of the sense strand and / or antisense strand of siRNA by a covalent linker (such as a nucleic acid or non-nucleic acid linker). Conjugates can be connected to siRNA by a carbamate group or other linking groups (e.g., see U.S. Patent Publication Nos. 20050074771, 20050043219 and 20050158727, the entire contents of which are incorporated herein by reference). Conjugates can be added to siRNA for a variety of purposes. For example, the conjugate can be a molecular entity that promotes the delivery of siRNA to cells, or it can be a molecule containing a drug or a label. Examples of conjugate molecules suitable for connection to the siRNA of the present invention include, but are not limited to, steroids such as cholesterol, glycols such as polyethylene glycol (PEG), human serum albumin (HSA), fatty acids, carotenoids, terpenes, bile acids, folic acid (such as folic acid, folic acid analogs and derivatives thereof), carbohydrates (such as galactose, galactosamine, N-acetylgalactosamine, glucose, mannose, fructose, fucose, etc.), phospholipids, peptides, cell receptor ligands capable of mediating cell absorption, and combinations thereof. Other examples include, for example, lipophilic moieties, vitamins, polymers, peptides, proteins, nucleic acids, small molecules, oligosaccharides, carbohydrate clusters, intercalating agents, small groove adhesives, cleavage agents, and cross-linking agent conjugate molecules described in U.S. Patent Publication Nos. 20050119470 and 20050107325, the contents of each of which are incorporated herein by reference in their entirety. Other examples include 2'-O-alkylamines, 2'-O-alkoxyalkylamines, polyamines, C5-cationically modified pyrimidines, cationic peptides, guanidine groups, amidine groups, cationic amino acid conjugate molecules, etc. Other examples of conjugate molecules include hydrophobic groups, membrane active compounds, cell permeable compounds, cell targeting signals, interaction modifiers or steric stabilizers, as described in U.S. Patent Publication No. 20040167090, the entire contents of which are incorporated herein by reference.

[0108] In certain embodiments, the siRNA molecules disclosed herein can be conjugated with at least one targeting ligand. The targeting ligands considered herein include ligands suitable for targeting siRNA molecules to the liver, liver tissue and / or hepatocytes. Non-limiting examples of targeting ligands suitable for use herein may include galactose, galactosamine, N-formyl-galactosamine, N-acetyl-galactosamine, N-propionyl-galactosamine, N-n-butyryl-galactosamine, N-isobutyryl-galactosamine, galactose clusters and N-acetyl-galactosamine trimers, and may optionally have a pharmacokinetic modulator selected from the following: a hydrophobic group with 16 or more carbon atoms, a hydrophobic group with 16-20 carbon atoms, a palmitoyl group, a hexadecene-8-enoyl group, an oleoyl group, (9E, 12E)-octadecene-9,12 dienoyl group, a dioctanoyl group, a C16-C20 acyl group, and cholesterol. In some aspects, the liver targeting ligand suitable for use herein can be an N-acetylgalactosamine (GalNAc) conjugate. In some embodiments, the siRNA molecules disclosed herein can be conjugated with at least one GalNAc conjugate. In some embodiments, the siRNA molecules disclosed herein can be conjugated with about 1 to about 10 GalNAc conjugates, about 2 to about 9 GalNAc conjugates, or about 3 to about 8 GalNAc conjugates. In some embodiments, the siRNA molecules disclosed herein can be conjugated with about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, or about 10 GalNAc conjugates.

[0109] Any siRNA molecules disclosed herein can target the open reading frame or 5' or 3'UTR of CIDEB gene or at least one variant thereof. In some embodiments, at least one variant of CIDEB may include rs12590407G>A, rs368997599G>A, or any combination thereof. In some aspects, siRNA molecules disclosed herein can specifically downregulate the gene expression of CIDEB and its variants, such as rs12590407G>A, rs368997599G>A, or any combination thereof. CIDEB gene and / or its variants may be associated with metabolic disorders, such as diabetes, liver disease, liver dysfunction, liver injury and / or liver damage. Liver disease may include fatty liver (FLD), alcohol-related liver disease (ARLD), non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), end-stage liver disease (cirrhosis) caused by any cause, liver cancer, or any combination thereof. Liver damage may include cirrhosis, chronic infection with hepatitis B virus (HBV), chronic infection with hepatitis C virus (HCV), non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), primary biliary cirrhosis (PBC), hereditary hemochromatosis, type 2 diabetes, obesity, smoking, alcohol abuse, long-term use of anabolic steroids, tyrosinemia, alpha 1-antitrypsin deficiency, porphyria cutanea tarda, glycogen storage disease, Wilson's disease, or any combination thereof.

[0110] In certain embodiments, the methods and compositions provided herein may include a vector containing any of the siRNA molecules disclosed herein. In some embodiments, the vector used herein may be a viral vector. As used herein, the term "viral vector" may refer to a nucleic acid vector construct, which includes at least one element of viral origin, has the ability to be packaged into viral vector particles, and encodes at least one exogenous polynucleotide. In certain embodiments, vectors and / or particles can be used to transfer any nucleic acid to cells in vitro or in vivo. There are many viral vectors known in the art. The term virion may refer to a single infectious viral particle. "Viral vector", "viral vector particle" and "viral particle" also refer to complete viral particles with DNA or RNA core and protein capsid present outside the cell. Non-limiting examples of viral vectors used herein may include adenovirus, adeno-associated virus (AAV), herpes virus, retrovirus, lentivirus, integrase defective lentivirus (IDLV), etc. In some embodiments, the viral vector disclosed herein may be a lentiviral vector. Examples of lentiviruses include, but are not limited to, human lentiviruses, such as HIV (especially HIV-1 or HIV-2), simian immunodeficiency virus (SIV), equine infectious anemia virus (EIAV), feline immunodeficiency virus (FIV), caprine arthritis encephalitis virus (CAEV), sheep myelin shedding virus and progressive pneumonia virus, baboon pseudovirus, bovine immunodeficiency virus (BIV), etc. In some embodiments, the siRNA molecules and / or vectors described herein can be prepared by conventional recombinant techniques known to those skilled in the art. In other embodiments, the siRNA molecules and / or vectors described herein can be prepared by gene editing methods known in the art (such as CRISPR). In certain embodiments, the methods provided herein may include generating cells expressing any siRNA molecules and / or vectors described herein. In some embodiments, the vectors, viral particles, etc. contemplated herein can be encapsulated in liposomes for delivery to a subject.

[0111] In some aspects, the current disclosure also relates to the use of a gene editing system, such as a CRISPR-based system, to eliminate or downregulate the gene expression of CIBED. Therefore, the current disclosure also relates to a composition that specifically targets CIBED or its variants, which comprises a clustered regularly interspaced short palindromic repeat (CRISPR) system-related nucleic acid sequence, such as a single guide RNA (sgRNA), CRISPR-RNA (crRNA), a trans-activated crRNA (tracrRNA), and a further plasmid DNA (pDNA) or viral vector encoding a clustered regularly interspaced short palindromic repeat (CRISPR) system-related nucleic acid sequence. In some aspects, the gene editing system includes at least an sgRNA targeting CIBED and an RNA-guided nuclease, such as Cas9. In some aspects, the gene editing system includes at least an sgRNA targeting CIBED and an RNA-guided nuclease, such as Cas9.

[0112] (b) Pharmaceutical Compositions

[0113] The siRNA molecules targeting CIDEB disclosed herein for use in the methods described herein may be provided per se and / or may be provided as part of a pharmaceutical composition, wherein the modulator and / or inhibitor may be mixed with a suitable carrier or excipient.

[0114] As used herein, "pharmaceutical composition" refers to a preparation of one or more active ingredients described herein with other chemical ingredients (such as physiologically suitable carriers and excipients). The purpose of a pharmaceutical composition is to facilitate the administration of a compound to an organism. Here, the term "active ingredient" refers to any siRNA molecule disclosed herein. The term "active ingredient" as used herein may also include any vector, culture medium, microorganism or cell culture that synthesizes, expresses and / or contains siRNA molecules, such as genetically modified cells, viral vectors, plasmids, bacteria, yeast, fungi and cultures or culture media thereof.

[0115] (i) Pharmaceutically acceptable carriers and excipients

[0116] Hereinafter, the phrases "physiologically acceptable carrier" and "pharmaceutically acceptable carrier" are used interchangeably to refer to a carrier or diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the given compound. Adjuvants are also included in these phrases.

[0117] In certain embodiments, the compositions disclosed herein may further include one or more pharmaceutically acceptable diluents, excipients and / or carriers. Pharmaceutically acceptable diluents, excipients or carriers used herein refer to materials suitable for administering medication to a subject without causing undesirable biological effects or interacting with any component of the contained composition in a harmful manner. Pharmaceutically acceptable diluents, carriers and excipients may include, but are not limited to, physiological saline, Ringer's solution, phosphate solution or buffer, buffered physiological saline, and other carriers known in the art.

[0118] In some embodiments, the pharmaceutical composition herein may also include stabilizers, antioxidants, colorants, other drugs or medicaments, carriers, adjuvants, preservatives, stabilizers, wetting agents, emulsifiers, solution promoters, salts, solubilizers, defoamers, antioxidants, dispersants, surfactants or any combination thereof. Here, the term "excipient" refers to an inert substance added to the pharmaceutical composition to further promote the use of active ingredients. Examples of excipients include but are not limited to calcium carbonate, calcium phosphate, various sugars and starch types, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols. The formulation and administration techniques of the drug can be found in the latest version of "Remington's Pharmaceutical Sciences" of Mike Publishing Company, Easton, Pennsylvania, which is incorporated herein by reference.

[0119] In certain embodiments, the pharmaceutical compositions described herein can be formulated in a conventional manner, using one or more physiologically acceptable carriers, including excipients and adjuvants, so as to facilitate the processing of genetically modified endothelial progenitor cells into pharmaceutically usable preparations. In some embodiments, any well-known techniques, carriers and excipients can be used, as long as they are suitable and / or consistent with the understanding of the art.

[0120] In certain embodiments, the pharmaceutical composition described herein may be an aqueous suspension comprising one or more polymers as suspending agents. In some embodiments, the polymers that may comprise the pharmaceutical composition described herein include: water-soluble polymers, such as cellulose polymers, for example, hydroxypropyl methylcellulose; water-insoluble polymers, such as cross-linked carboxyl-containing polymers; mucoadhesive polymers, selected from, for example, carboxymethylcellulose, carbomer (acrylic acid polymer), polymethyl methacrylate, polyacrylamide, polycarbophil, acrylic acid / butyl acrylate copolymer, sodium alginate and dextran, etc.; or combinations thereof. In some embodiments, the pharmaceutical composition disclosed herein may comprise a total amount of at least about 5%, at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, or at least about 50% of the polymer as a suspending agent, based on the total weight of the composition. In some embodiments, the pharmaceutical composition disclosed herein may comprise a total amount of about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% of the polymer as a suspending agent, based on the total weight of the composition.

[0121] In certain embodiments, the pharmaceutical compositions disclosed herein may include viscous preparations. In certain embodiments, the viscosity of the compositions described herein may be increased by adding one or more gelling or thickening agents. In some embodiments, the compositions disclosed herein may include one or more gelling or thickening agents in an amount that can provide a sufficiently viscous preparation to remain on the treated tissue. In some embodiments, the pharmaceutical compositions disclosed herein may include a total amount of at least about 5%, at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, or at least about 50% of the total weight of the composition. In some embodiments, the pharmaceutical compositions disclosed herein may include a total amount of about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% of the total weight of the composition. In some embodiments, the thickener suitable for use herein can be hydroxypropyl methylcellulose, hydroxyethylcellulose, polyvinyl pyrrolidone, carboxymethyl cellulose, polyvinyl alcohol, sodium chondroitin sulfate, sodium hyaluronate. In other aspects, the viscosity increasing agent can be gum arabic, agar, magnesium aluminum silicate, sodium alginate, sodium stearate, bladder gum, bentonite, carbomer, carrageenan, Carbopol, xanthan gum, cellulose, microcrystalline cellulose (MCC), carob gum, chitosan, carboxymethyl chitosan, chondroitin, glucose, furcellaran, gelatin, gati gum, guar gum, hectorite, lactose, sucrose, maltodextrin, mannitol, sorbitol, honey, corn starch, wheat starch, rice starch, potato starch, gelatin, karaya gum, xanthan gum, tragacanth gum, ethylcellulose, ethylhydroxy Ethylcellulose, ethylmethylcellulose, methylcellulose, hydroxyethylcellulose, hydroxyethylmethylcellulose, hydroxypropylcellulose, polyhydroxyethyl methacrylate, oxypolygelatin, pectin, polygelatin, povidone, propylene carbonate, methyl vinyl ether / maleic anhydride copolymer (PVM / MA), poly(methoxyethyl methacrylate), poly(methoxyethoxyethyl methacrylate), hydroxypropylcellulose, hydroxypropyl methylcellulose (HPMC), sodium carboxymethylcellulose (CMC), silicon dioxide, polyvinylpyrrolidone (PVP: povidone), (glucose, maltodextrin and sucralose), or any combination thereof.

[0122] In certain embodiments, the pharmaceutical compositions disclosed herein may include additional agents or additives selected from surfactants, detergents, solvents, acidifiers, alkalizers, buffers, tonicity modifiers, ionic additives that can effectively increase the ionic strength of the solution, antibacterial agents, antibiotics, antifungal agents, antioxidants, preservatives, electrolytes, defoamers, oils, stabilizers, enhancers, and the like. In certain embodiments, the pharmaceutical compositions disclosed herein may include a total amount of at least about 5%, at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, or at least about 50% of one or more agents by weight of the total composition. In certain embodiments, the pharmaceutical compositions disclosed herein may include a total amount of about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% of one or more agents by weight of the total composition. In some embodiments, one or more of these agents may be added to improve the performance, efficacy, safety, shelf life, and / or other properties of the muscarinic antagonist compositions disclosed herein. In some embodiments, the additive may be biocompatible, non-irritating, non-abrasive, and / or non-allergenic.

[0123] In certain embodiments, the pharmaceutical compositions disclosed herein may include one or more acidifiers. "Acidifier" as used herein refers to a compound used to provide an acidic medium. For example, such compounds include, but are not limited to, acetic acid, amino acids, citric acid, fumaric acid, and other α-hydroxy acids, such as hydrochloric acid, ascorbic acid, and nitric acid, as well as other compounds known to those of ordinary skill in the art. In some embodiments, any pharmaceutically acceptable organic or inorganic acid may be used. In some embodiments, the pharmaceutical compositions disclosed herein may include a total amount of at least about 5%, at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50% of one or more acidifiers, based on the total weight of the composition. In some embodiments, the pharmaceutical compositions disclosed herein may include a total amount of about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% of one or more acidifiers, based on the total weight of the composition.

[0124] In certain embodiments, the pharmaceutical compositions disclosed herein may include one or more alkalizing agents. "Alkalizing agents" used herein are compounds for providing alkaline media. For example, such compounds include, but are not limited to, ammonia solution, ammonium carbonate, diethanolamine, monoethanolamine, potassium hydroxide, sodium borate, sodium carbonate, sodium bicarbonate, sodium hydroxide, trihydroxyethylamine, triethanolamine, and other compounds known to those of ordinary skill in the art. In some embodiments, any pharmaceutically acceptable organic or inorganic base may be used. In some embodiments, the pharmaceutical compositions disclosed herein may include a total amount of at least about 5%, at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50% of one or more alkalizing agents, accounting for a total amount of about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% of the total weight of the composition.

[0125] In certain embodiments, the pharmaceutical compositions disclosed herein may include one or more antioxidants. As used herein, "antioxidants" are agents that inhibit oxidation, and therefore can be used to prevent preparations from deteriorating due to oxidation processes. For example, such compounds include, but are not limited to, ascorbic acid, ascorbyl palmitate, butylated hydroxyanisole, butylated hydroxytoluene, sulfoxylate, monothioglycerol, propyl gallate, sodium ascorbate, sodium bisulfite, sodium formaldehyde sulfinate, sodium pyrosulfite, and other compounds known to those of ordinary skill in the art. In some embodiments, the pharmaceutical compositions disclosed herein may include a total amount of at least about 5%, at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50% of the total weight of the composition. In some embodiments, the pharmaceutical compositions disclosed herein may include a total amount of about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% of the total weight of the composition.

[0126] In certain embodiments, the pharmaceutical compositions disclosed herein may include a buffer system. As used herein, a "buffer system" is a composition consisting of one or more buffers, wherein a "buffer" is a compound used to resist pH changes when diluting or adding an acid or base. Buffers include, for example, but are not limited to potassium metaphosphate, potassium phosphate, monobasic sodium acetate, sodium citrate anhydrate and dihydrate, and other compounds known to those of ordinary skill in the art. In certain embodiments, any pharmaceutically acceptable organic or inorganic buffer may be used. In some embodiments, the pharmaceutical compositions disclosed herein may include a total amount of at least about 5%, at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50% of one or more buffers of the total weight of the composition. In some embodiments, the pharmaceutical compositions disclosed herein may include a total amount of about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% of one or more buffers of the total weight of the composition.

[0127] In some embodiments, the amount of one or more buffers depends on the desired pH of the composition. In some embodiments, the pH of the pharmaceutical compositions disclosed herein may be from about 6 to about 9. In some embodiments, the pH of the pharmaceutical compositions disclosed herein may be greater than about 8, greater than about 7.5, greater than about 7, greater than about 6.5, or greater than about 6.

[0128] In certain embodiments, the pharmaceutical compositions disclosed herein may include one or more preservatives. "Preservatives" as used herein refer to agents or combinations of agents that can inhibit, reduce or eliminate bacterial growth in pharmaceutical dosage forms. Non-limiting examples of preservatives include parabens, propylparabens, isopropanol, and combinations thereof. In some embodiments, any pharmaceutically acceptable preservative may be used. In some embodiments, the pharmaceutical compositions disclosed herein may include a total amount of at least about 5%, at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50% of one or more preservatives of the total weight of the composition. In some embodiments, the pharmaceutical compositions disclosed herein may include a total amount of about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% of one or more preservatives of the total weight of the composition.

[0129] In certain embodiments, the pharmaceutical compositions disclosed herein may include one or more surfactants or detergents. In certain embodiments, the surfactants or detergents may be synthetic, natural or semi-synthetic. In some embodiments, the compositions disclosed herein may include anionic detergents, cationic detergents, zwitterionic detergents, zwitterionic detergents, acid-base amphoteric detergents, non-ionic detergents with steroid skeletons, or combinations thereof. In certain embodiments, the pharmaceutical compositions disclosed herein may include a total amount of at least about 5%, at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50% of one or more surfactants or detergents. In some embodiments, the pharmaceutical compositions disclosed herein may include a total amount of about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% of the total weight of the composition.

[0130] In certain embodiments, the pharmaceutical compositions disclosed herein may include one or more stabilizers. "Stabilizer" as used herein refers to a compound used to stabilize an active agent to counteract the effects of physical, chemical or biochemical processes, otherwise the therapeutic activity of the active agent will be reduced. For example, suitable stabilizers include, but are not limited to, succinic anhydride, albumin, sialic acid, creatinine, glycine and other amino acids, nicotinamide, sodium acetyltryptophanate, zinc oxide, sucrose, glucose, lactose, sorbitol, mannitol, glycerol, polyethylene glycol, sodium caprylate and sodium saccharin, and other compounds known to those of ordinary skill in the art. In certain embodiments, the pharmaceutical compositions disclosed herein may include a total amount of at least about 5%, at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50% of one or more stabilizers of the total weight of the composition. In some embodiments, the pharmaceutical compositions disclosed herein may comprise one or more stabilizers in a total amount of about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% by total weight of the composition.

[0131] In some embodiments, the pharmaceutical compositions disclosed herein may include one or more tension agents. "Tensity agent" as used herein refers to a compound that can be used to adjust the tension of a liquid formulation. Suitable tension agents include, but are not limited to, glycerol, lactose, mannitol, glucose, sodium chloride, sodium sulfate, sorbitol, trehalose, and other compounds known to those of ordinary skill in the art. The osmotic pressure in the composition can be expressed in milliosmole / liter (mOsm / L). The osmotic pressure can be measured using methods generally known in the art. In some embodiments, the osmotic pressure of the composition disclosed herein is calculated using the vapor pressure reduction method. In some embodiments, the amount of one or more tension agents included in the pharmaceutical compositions disclosed herein can make the composition osmotic pressure be about 150mOsm / L to about 500mOsm / L, about 250mOsm / L to about 500mOsm / L, about 250mOsm / L to about 350mOsm / L, about 280mOsm / L to about 370mOsm / L, or about 250mOsm / L to about 320mOsm / L. In some embodiments, the osmotic pressure of the compositions herein ranges from about 100 mOsm / kg to about 1000 mOsm / kg, from about 200 mOsm / kg to about 800 mOsm / kg, from about 250 mOsm / kg to about 500 mOsm / kg, or from about 250 mOsm / kg to about 320 mOsm / kg, or from about 250 mOsm / kg to about 350 mOsm / kg, or from about 280 mOsm / kg to about 320 mOsm / kg. In some embodiments, the osmotic pressure of the pharmaceutical compositions described herein may be about 100 mOsm / L to about 1000 mOsm / L, about 200 mOsm / L to about 800 mOsm / L, about 250 mOsm / L to about 500 mOsm / L, about 250 mOsm / L to about 350 mOsm / L, about 250 mOsm / L to about 320 mOsm / L, or about 280 mOsm / L to about 320 mOsm / L. In some embodiments, the pharmaceutical compositions disclosed herein may include one or more tonicity modifiers in a total amount of at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50% by weight of the total composition. In some embodiments, the pharmaceutical compositions disclosed herein may comprise one or more tonicity modifiers in a total amount of about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% by total weight of the composition.

[0132] (ii) Dosage Formulation

[0133] In certain embodiments, the present disclosure provides compositions formulated for one or more routes of administration. For example, suitable routes of administration may include oral, rectal, mucosal, nasal, intestinal and / or parenteral administration. In certain embodiments, the compositions formulated herein may be used for parenteral administration. In some embodiments, the compositions formulated herein may be formulated for intramuscular, subcutaneous, intramedullary, intravenous, intraperitoneal and / or intranasal injection.

[0134] In certain embodiments, the compositions herein can be administered in a local or systemic manner, for example, by direct local injection of the pharmaceutical composition into a tissue area of ​​the patient. In some embodiments, the pharmaceutical compositions disclosed herein can be administered parenterally, for example, by intravenous injection, intraventricular injection, intracisterna magna injection, intraparenchymal injection, or a combination thereof. In some embodiments, the pharmaceutical compositions disclosed herein can be administered to a subject in a manner disclosed herein. In some embodiments, the pharmaceutical compositions disclosed herein can be used in human patients. In some embodiments, the pharmaceutical compositions disclosed herein can be administered to human patients by at least two routes of administration. In some embodiments, the combination of routes of administration can be intraventricular injection and intravenous injection; intrathecal injection and intravenous injection; intracisterna magna injection and intravenous injection; and / or intraparenchymal injection and intravenous injection.

[0135] In certain embodiments, pharmaceutical compositions of the present disclosure can be manufactured by processes well known in the art, such as by conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.

[0136] In certain embodiments, the pharmaceutical compositions used in accordance with the present disclosure can be formulated in a conventional manner using one or more physiologically acceptable carriers (including excipients and adjuvants) that aid in processing the active ingredient into a pharmaceutically acceptable formulation. The correct formulation depends on the selected route of administration. For injection, the active ingredient of the pharmaceutical composition herein can be formulated in an aqueous solution, preferably in a physiologically compatible buffer, such as Hank's solution, Ringer's solution, physiological saline buffer, or any combination thereof.

[0137] In certain embodiments, pharmaceutical compositions as described herein can be prepared in the form of nanoparticles.Nanoparticles can have a monolayer surrounding a nanoparticle core, wherein the siRNA molecule is placed in the nanoparticle core.In one embodiment, the nanoparticle core includes solid lipids (i.e., lipids that maintain a solid state at room temperature and body temperature) or liquid lipids (i.e., oils that maintain a liquid state at room temperature and body temperature, such as vegetable oils or lipids extracted from human adipose tissue).Particularly, embodiments of the present disclosure include nanoparticles and compositions for controlling and / or sustained release (e.g., releasing at a predetermined rate, maintaining a certain concentration within a certain time) reagents (e.g., small interfering RNA (siRNA) from nanoparticles).

[0138] In certain embodiments, the pharmaceutical compositions described herein can be formulated for parenteral administration, for example, by bolus injection or continuous infusion. The injection formulations herein can be presented in unit dose form, such as in ampoules or multi-dose containers, with the optional addition of preservatives. In some embodiments, the compositions herein can be suspensions, solutions or emulsions in oily or aqueous carriers, and / or can contain formulation agents such as suspending agents, stabilizers and / or dispersants.

[0139] In certain embodiments, the pharmaceutical composition formulated for parenteral administration herein may include an aqueous solution of a water-soluble active agent (such as an siRNA molecule). In some embodiments, the composition comprising an active agent suspension may be prepared into an oily or aqueous injection suspension. Suitable lipophilic solvents and / or carriers used in the text may include, but are not limited to, fatty oils (such as sesame oil) or synthetic fatty acid esters (such as ethyl oleate), triglycerides or liposomes. In some embodiments, the composition comprising an aqueous injection suspension herein may contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, and / or dextran. In certain embodiments, the composition comprising a suspension may also contain one or more suitable stabilizers and / or agents that increase the solubility of the active ingredient (such as an siRNA molecule) to prepare a preparation of a high concentration solution.

[0140] In some embodiments, the compositions herein may contain the active ingredient in powder form for constitution with a suitable vehicle (eg, sterile, pyrogen-free, water-based solution) before use.

[0141] Pharmaceutical compositions suitable for the present disclosure may include compositions that may contain an amount of active ingredients effective to achieve the intended purpose. In some embodiments, a therapeutically effective amount refers to an amount of active ingredient (such as siRNA molecules) that effectively prevents, slows down, alleviates or improves symptoms of a disorder (such as liver disease) or prolongs the survival of a subject being treated.

[0142] Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.

[0143] For any formulation used in the disclosed methods, a therapeutically effective amount or dosage can be initially estimated based on the in vitro and cell culture assays and / or screening platforms disclosed herein. For example, a dosage can be formulated in an animal model to achieve a desired concentration or titer. This information can be used to more accurately determine an effective dosage in humans.

[0144] In some embodiments, the toxicity and therapeutic effect of the active ingredients disclosed herein can be determined in vitro, in cell culture or in experimental animals by standard pharmaceutical procedures. In some embodiments, the data obtained from these in vitro and cell culture assays and animal studies can be used to formulate a dosage range for human subjects. In some embodiments, the dosage used in this regimen may vary depending on the dosage form and route of administration used. The specific dosage form, route of administration and dosage can be selected by the doctor according to the patient's condition. (See Fingl et al., 1975, "The Pharmacological Basis of Therapeutics", Chapter 1).

[0145] In certain embodiments, dosage and / or dosing interval can be adjusted individually to the brain or blood level of the active ingredient sufficient to induce or inhibit biological effects (minimum effective concentration, MEC). In some embodiments, the MEC of active ingredient (such as siRNA molecules or compositions disclosed herein) may vary due to each preparation, but can be estimated based on in vitro data. In some embodiments, the dosage required to reach MEC herein may depend on individual characteristics and route of administration. Detection analysis can be used to determine plasma concentration.

[0146] In certain embodiments, depending on the severity and responsiveness of the condition to be treated, the compositions herein may be administered single or multiple times, with courses of treatment lasting from several days to several weeks or until a cure or a reduction in the disease state is achieved.

[0147] In certain embodiments, the dosage of the composition of the present invention depends on the subject to be treated, the severity of the affliction, the mode of administration, the judgment of the prescribing physician, etc. In some embodiments, the effective dose can be extrapolated from a dose-response curve derived from an in vitro or in vivo test system.

[0148] III. How to use

[0149] The present disclosure provides methods for treating, alleviating and preventing liver disease in subjects in need thereof. In several embodiments, the method for treating, alleviating or preventing liver disease in a subject may include administering to a subject (including a human subject) an effective amount of one or more siRNA molecules targeting CIDEB disclosed herein or a nucleic acid encoding a siRNA molecule targeting CIDEB disclosed herein. In several embodiments, the method for treating, alleviating or preventing liver disease in a subject may include administering to a subject (including a human subject) an effective amount of a nucleic acid encoding a suitable sgRNA, or a suitable sgRNA targeting CIDEB and an RNA-guided endonuclease.

[0150] Methods disclosed herein may include treating a subject in need by administering a therapeutically effective amount of one or more siRNA molecules or pharmaceutical compositions disclosed herein. Subjects may be human subjects suffering from or suspected of suffering from liver disease, liver damage, liver dysfunction or liver injury risk. The terms "liver disease", "liver damage" or "abnormal liver function" may be used interchangeably, referring to any injury of the liver, including but not limited to hardening of the liver, scarring of the liver, decreased or abnormal biliary function, abnormal liver enzyme activity, cirrhosis, physiological abnormalities determined by common diagnostic methods (including but not limited to ultrasound or biopsy / histopathology), liver necrosis, etc. Non-limiting examples of liver diseases treated using methods disclosed herein may include fatty liver (FLD), alcohol-related liver disease (ARLD), non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), end-stage liver disease (cirrhosis) caused by any cause, liver cancer HCC or any combination thereof. In some embodiments, compared with untreated subjects with the same disease status and predicted results, subjects benefit from the extension of life expectancy. In other embodiments, treatment improves liver function in the subject compared to an untreated subject with the same disease status and predicted outcome. In other embodiments, treatment reduces liver fibrosis in the subject compared to an untreated subject with the same disease status and predicted outcome. In some embodiments, treatment prevents the subject from developing additional liver fibrosis compared to an untreated subject with the same disease status and predicted outcome.

[0151] Subjects suitable for the treatment of liver diseases disclosed herein can be selected according to the diagnosis of the subject. In some embodiments, the diagnostic method can detect one or more serum markers indicating liver disease. Non-limiting examples of serum markers indicating liver disease (such as NAFLD, NASH, or HCC) may include alpha-fetoprotein (AFP) (such as AFP levels of 20ng / mL or higher), de-γ-carboxy prothrombin, lentil agglutinin reactive AFP (AFP-L3), etc. The diagnostic method may also include assessing at least one clinical symptom associated with liver disease. Non-limiting examples of clinical symptoms associated with liver disease may include mild to moderate upper abdominal pain, weight loss, early satiety or palpable masses in the upper abdomen, paraneoplastic syndrome, hypoglycemia, polycythemia, hypercalcemia, intractable diarrhea and related electrolyte disorders (such as hyponatremia, hypokalemia, metabolic alkalosis), skin manifestations (such as dermatomyositis, pemphigus foliaceus, seborrheic keratosis, pityriasis circumflexus), intraperitoneal hemorrhage, jaundice, fever, suppurative liver abscess, etc. Other aspects of the diagnosis may include diagnosing and / or determining the severity of the following diseases: cirrhosis, chronic infection with hepatitis B virus (HBV), chronic infection with hepatitis C virus (HCV), non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), primary biliary cirrhosis (PBC), hereditary hemochromatosis, type 2 diabetes, obesity, smoking, alcohol abuse, long-term use of anabolic steroids, tyrosinemia, alpha 1-antitrypsin deficiency, porphyria cutanea tarda, glycogen storage disease, Wilson's disease, or any combination thereof.

[0152] In some embodiments, the risk of a subject suffering from liver disease (such as NASH or NAFLD) can be diagnosed and / or predicted to be high or low by histological or imaging-based examinations, such as contrast-enhanced multiphase CT, ultrasound and / or MRI. Imaging features for diagnosis may include growth of liver size, dynamics, contrast-enhanced patterns, and continuous imaging, wherein size may be measured as the maximum cross-sectional diameter of the most clearly visible lesion on the image. NASH or NAFLD biopsy histology may include fatty degeneration, inflammation, and fibrosis.

[0153] The methods and compositions disclosed herein can be used to treat subjects with fatty liver-related disorders such as NAFLD and / or NASH. The subject's biliary function may be normal or substantially normal. Normal or substantially normal biliary function may be determined by any suitable method known in the art. In general, the preferred tests for biliary function in patients with NASH can be divided into two categories: physiological-based tests and biochemical-based tests. Physiological tests include, but are not limited to, abdominal ultrasound, abdominal CT scan, abdominal MRI scan, endoscopic retrograde cholangiopancreatography (ECRP), percutaneous transhepatic cholangiography (PTCA), or magnetic resonance cholangiopancreatography (MRCP). Biochemical tests include, but are not limited to, alanine aminotransferase (GGT) tests, liver function tests, bilirubin tests, alkaline phosphatase (ALP) tests, liver enzyme tests, amylase blood tests, lipase blood tests, prothrombin time, and urine bilirubin determination. In most cases, one or more detection methods may be used to characterize the liver function of NASH subjects.

[0154] In some embodiments, any method disclosed herein may further include monitoring the occurrence of one or more adverse reactions of the subject. Adverse reactions may include, but are not limited to, liver damage, hematotoxicity, nervous system toxicity, skin toxicity, gastrointestinal toxicity, or a combination thereof. When one or more adverse reactions are observed, the method disclosed herein may further include reducing or increasing the dosage of one or more treatment regimens according to the adverse reactions of the subject. For example, when moderate to severe liver damage is observed in the subject after treatment, the concentration or frequency of the composition used to treat the subject may be reduced.

[0155] In certain embodiments, the treatment given according to the methods disclosed herein can improve the patient's life expectancy compared to the life expectancy of untreated subjects with the same disease condition (such as NAFLD or NASH) and predicted results. "Patient life expectancy" used herein is defined as the time when 50% of the subjects survive and 50% of the subjects die. In some embodiments, after treatment according to the methods disclosed herein, the patient's life expectancy can be indefinite. In other aspects, compared to untreated subjects with the same disease condition and predicted results, the patient's life expectancy can increase by at least about 5% or more to at least about 100%, at least about 10% or more to at least about 95% or more, at least about 20% or more to at least about 80% or more, at least about 40% or more to at least about 60% or more. In some embodiments, the patient's life expectancy can be increased by at least about 5% or more, at least about 10% or more, at least about 15% or more, at least about 20% or more, at least about 25% or more, at least about 30% or more, at least about 35% or more, at least about 40% or more, at least about 45% or more, at least about 50% or more, at least about 55% or more, at least about 60% or more, at least about 65% or more, at least about 70% or more, at least about 75% or more, at least about 80% or more, at least about 85% or more, at least about 90% or more, at least about 95% or more, at least about 100% as compared to an untreated subject with the same disease condition and predicted outcome. In some embodiments, the patient's life expectancy can be increased by at least about 5% or more to at least about 10% or more, at least about 10% or more to at least about 15% or more, at least about 15% or more to at least about 20% or more, at least about 20% or more to at least about 25% or more, at least about 25% or more to at least about 30% or more, at least about 30% or more to at least about 35% or more, at least about 35% or more to at least about 40% or more, at least about 40% or more to at least about 45% or more, at least about 45% or more to at least about 50% or more, at least about 51% or more to at least about 52% or more, at least about 53% or more to at least about 54% or more, at least about 55% or more to at least about 56% or more, at least about 57% or more to at least about 58% or more, at least about 59% or more to at least about 60% or more, at least about 61% or more to at least about 62% or more, at least about 63% or more to at least about 64% or more, at least about 65% or more to at least about 66% or more, at least about 67% or more to at least about 68% or more, at least about 69% or more to at least about 70% or more, at least about 71% or more to at least about 72% or more, at least about 73% or more to at least about 74% or more, at least about 75% or more to at least about 76% or more, at least about 77% or more to at least about 78% or more. More to at least about 50% or more, at least about 50% or more to at least about 55% or more, at least about 55% or more to at least about 60% or more, at least about 60% or more to at least about 65% or more, at least about 65% or more to at least about 70% or more, at least about 70% or more to at least about 75% or more, at least about 75% or more to at least about 80% or more, at least about 80% or more to at least about 85% or more, at least about 85% or more to at least about 90% or more, at least about 90% or more to at least about 95% or more, at least about 95% or more to at least about 100%.

[0156] In some embodiments, treating a liver disease, such as NAFLD or NASH, according to the methods disclosed herein can reduce, shrink, decrease, or prevent liver fibrosis compared to the starting size of liver fibrosis. In some embodiments, the reduction or shrinkage of liver fibrosis can be from at least about 5% or more to at least about 10% or more, at least about 10% or more to at least about 15% or more, at least about 15% or more to at least about 20% or more, at least about 20% or more to at least about 25% or more, at least about 25% or more to at least about 30% or more, at least about 30% or more to at least about 35% or more, at least about 35% or more to at least about 40% or more, at least about 40% or more to at least about 45% or more, at least about 45% or more to at least about 50% or more, compared to the starting extent of liver fibrosis. The present invention relates to a method for treating liver tumors in a manner that is at least about 50% or more to at least about 55% or more, at least about 55% or more to at least about 60% or more, at least about 60% or more to at least about 65% or more, at least about 65% or more to at least about 70% or more, at least about 70% or more to at least about 75% or more, at least about 75% or more to at least about 80% or more, at least about 80% or more to at least about 85% or more, at least about 85% or more to at least about 90% or more, at least about 90% or more to at least about 95% or more, at least about 95% or more to at least about 100% (referring to complete disappearance of liver tumors after treatment).

[0157] In some embodiments, liver disease, such as NAFLD or NASH, can be treated according to the methods disclosed herein to improve liver function. Liver function can be detected by conventional biochemical methods. Biochemical tests may include, but are not limited to, GGT detection, liver function tests, bilirubin detection, alkaline phosphatase (ALP) detection, liver enzyme detection, amylase blood test, lipase blood test, prothrombin time and urine bilirubin determination. In some cases, one or more tests can be used to characterize biliary function. In some cases, a variety of test combinations can be used to assess biliary function. Improvement in liver function can also be assessed by relief of symptoms in the subject, such as relief of symptoms such as fatigue, weight loss and weakness in the subject. Other relieved symptoms may include reduced fluid retention, muscle atrophy, intestinal bleeding, and any combination thereof.

[0158] IV. Kit

[0159] The present disclosure provides a kit for using the method disclosed herein. In some aspects, the present disclosure provides a kit for treating liver diseases disclosed herein (such as NASH or NAFLD) and diagnosing liver diseases. Such a kit may include a tool for accommodating and / or administering such siRNA compositions or pharmaceutical compositions.

[0160] In some embodiments, the kits disclosed herein may have a medical container to contain the composition in a safe, stable and durable manner. In some embodiments, the kits disclosed herein may also include a tool for applying the composition, such as a needle or a spatula.

[0161] Any kit may further comprise instructions for how to use the kit for treatment. The manual may be written with physicians or liver specialists as the target audience.

[0162] Having described several embodiments, those skilled in the art will recognize that various modifications, alternative structures and equivalents may be used without departing from the spirit of the inventive concept. In addition, in order to avoid unnecessarily obscuring the inventive concept, some well-known processes and elements are not described. Therefore, this description should not be regarded as limiting the scope of the inventive concept.

[0163] Those skilled in the art will appreciate that the presently disclosed embodiments are taught by way of example and not by way of limitation. Therefore, the contents contained in this description or shown in the accompanying drawings should be interpreted as illustrative and not restrictive. The following claims are intended to cover all generic and specific features described herein, as well as all statements of the scope of methods and components that can be said to fall therein in a language. Example

[0164] The following examples are intended to illustrate preferred embodiments of the present disclosure. It will be appreciated by those skilled in the art that the techniques disclosed in the following examples represent techniques that the inventors have discovered to work well in the practice of the present disclosure, and therefore can be considered to constitute preferred modes for the practice of the present disclosure. However, it will be appreciated by those skilled in the art that, based on the present disclosure, many changes may be made to the disclosed specific embodiments without departing from the spirit and scope of the present disclosure, and still the same or similar results may be obtained.

[0165] Example 1.

[0166] To broadly understand how mutations in candidate NASH genes affect clonal competition in an unbiased manner in animal models, a method was developed to generate a heterogeneous collection of somatic mutations in tissues of Cas9-expressing mice. A hybrid adeno-associated virus (AAV) carrying Sleeping Beauty transposase (SB100), Cre, and a single guide (sg) RNA with its payload flanked by transposon integration sequences (SB-IR) was created. This AAV was used to deliver sgRNAs into the liver of doxorubicin (dox)-inducible Cas9-expressing mice for in vivo CRISPR screens. Briefly, a hybrid screen was performed against 63 NASH genes identified in GWAS (i.e., APOB, TM6SF2, GCKR), exome sequencing (i.e., PNPLA3, MBOAT7, HSD17B13), somatic mutation sequencing (i.e., PPARGC1B, FOXO1, GPAM, ACVR2A), or biochemical studies. Hepatocyte pools with mosaic deletions of these NASH-associated genes were established after injection of AAV to induce Cas9 expression. These chimeric mice were then fed either a normal chow diet (chow) (NC) or a Western diet (WD: high sugar, high fat, high cholesterol) to understand clonal dynamics under both dietary conditions. After 6 months, sgRNA deep sequencing identified genes with the greatest impact on clonal fitness, particularly in the NASH setting. To exclude pure proliferation effects unrelated to NASH, sgRNAs that were enriched or depleted in common between NC and WD conditions were excluded. Six genes, when deleted, were most associated with clonal expansion: Acvr2a, Irs1, Srebp1, Gpam, Dgat2, and Pparg ( Figures 1A-1D ). When these genes are inhibited, the liver is protected from NASH. Two of these genes, Gpam and Acvr2a, are also two of the top five most frequently mutated genes in human NASH cirrhotic samples. The in vivo genetic screen of this exemplary method demonstrates the concept that mutations observed in human cirrhosis (selected out during the long course of chronic liver disease) can represent effective drug targets. This functional screen in mice helps us understand the significance of human somatic mutations in NASH cirrhotic samples.

[0167] Another NAFLD gene identified is cell death-inducing DFF45-like effector protein B (CIDEB), which is mutated in human NASH cirrhotic samples. As an introduction, without being bound by theory, SREBP transcription factors regulate lipid metabolism by controlling the expression of lipogenic, sterologenic, and lipid uptake genes. In the presence of sterols, a complex of SREBP, SCAP, and the sterol-binding protein Insig-1 / 2 localizes to the ER. In the absence of sterols, SREBP / SCAP translocates to the Golgi, where SREBP is cleaved, releasing the N-terminal portion of the protein that acts as a transcriptional activator. CIDEB is a regulator of the ER-to-Golgi trafficking process and in this way enhances the activity of SREBP. CIDEB is an ER and lipid droplet protein expressed in the liver, regulating lipid droplet fusion and VLDL lipidation. In summary, CIDEB coordinates multiple independent pathways of lipid homeostasis. Therefore, the observation of loss-of-function mutations in metabolic factors that generate hepatic lipids, such as CIDEB, suggests that some somatic mutations can increase tissue fitness by reversing the driver etiology of the disease.

[0168] To further determine which genes increase clonal expansion by affecting metabolic fitness, conditional knockout mouse models are needed. The CRISPR plus AAV-sgRNA approach described in this article was first used to generate a liver-wide conditional gene deletion model. AAV-sgRNA targeting GFP or LacZ was also used as an independent control model. High-titer AAV-sgRNA targeting CIDEB was injected into 8-week-old Cas9-expressing mice, and then the mice were fed a Western diet (WD) for three months after 2 weeks. Body weight, liver weight, histology, steatosis, fibrosis, and serum tests (liver function tests, cholesterol, TG, non-esterified free fatty acids (NEFA)) were measured for each conditional CRISPR KO model.

[0169] In order to study liver-deficient or clonal mosaic CIDEB loss-of-function mutations using conventional mouse genetic tools, whole-body CIDEB knockout mice and CIDEB floxed mice targeting exon 3, which are predicted to result in a frameshift and stop codon causing premature protein termination, were also generated. Using these mice, we confirmed that CIDEB floxed mice achieved CIDEB deficiency after Cre recombination. Furthermore, liver-specific CIDEB knockout mice were protected from the hepatic triglyceride accumulation associated with 3 months of chronic WD feeding.

[0170] Since it is currently unknown whether liver-specific deletion of CIDEB can alleviate NASH, the present study examined whether whole-liver genetic deletion of CIDEB can prevent the development of NASH. In brief, a novel CIDEBfloxed mouse was generated to more rigorously test liver-specific CIDEB deletion. Nearly 100% hepatocyte deletion can be achieved using these mice, which is not achievable using the above-mentioned CRISPR approach. AAV-TBG-Cre expresses Cre recombinase only in hepatocytes, allowing spatial and temporal conditional deletion. Mice were given AAV at 6 weeks of age and started on a NASH diet at 8 weeks of age. CIDEB fl / fl and CIDEB + / + Mice were given AAV-TBG-Cre to mediate flox recombination. The following four groups of mice were compared: CIDEB mice fed a normal chow diet (NC) + / + +AAV-TBG-Cre, CIDEB of NC fl / fl +AAV-Cre, WD's CIDEB + / + +AAV-TBG-Cre, WD's CIDEB fl / fl +AAV-TBG-Cre. The NC group could exclude any phenotypic effects of CIDEB deletion that were unrelated to the diet. These strict reference standard KO mice were used to determine the extent of NASH prevention. The effects of CIDEB deletion on hepatic steatosis, inflammation, and fibrosis were characterized after 12 and 24 weeks of NASH diet. In WT control mice fed WD, hepatic steatosis and inflammation were prominent at about 12 weeks, while hepatocyte ballooning and fibrosis (more NASH-specific features) were observed at about 24 weeks. Liver toxicity was monitored by blood AST, ALT, total bilirubin, albumin, and complete blood count before liver harvesting (every 12 weeks). Plasma and liver triglycerides (TG), non-esterified free fatty acids (NEFA), and cholesterol, which are key lipid markers of NASH and metabolic syndrome, were also measured. The harvested livers were sectioned for macroscopic / microscopic evidence of tissue damage, inflammation, and fibrosis. The components of the NASH activity score (NAS) were assessed in a blinded manner: steatosis, lobular inflammation, and hepatocellular ballooning. In addition, the degree of liver fibrosis was quantified.

[0171] Currently, there are no attempts to target CIDEB to treat liver disease. Therefore, the exemplary methods herein will determine whether siRNA molecules against CIDEB can prevent and / or reverse NASH in mice. In short, an siRNA tool compound was determined to study the CIDEB phenotype in mice. Eight available Dharmacon siRNAs against mouse CIDEB were tested and the siRNA sequence with the highest knockout efficiency was determined. These siRNAs were modified and conjugated to GalNAc according to standard methods. In short, by modifying each 2'-position with a 2'-O-methyl group, nucleolytic degradation and immune response in vivo can be minimized. GalNAc conjugation allows efficient delivery to hepatocytes without lipid nanoparticle encapsulation. The optimal in vivo dose regimen of GalNAc-siRNA against CIDEB was then determined. After determining the optimal dose, the ability of GalNAc-siCideb to prevent or reverse NASH was determined. In brief, GalNAc-siRNA SC injections began at 6 weeks of age in mice, and the NASH diet began at 8 weeks of age for 12 weeks (a total of 6 siRNA doses). Mice were euthanized at 20 weeks of age, a time point used to determine steatosis, inflammation, and fibrosis. To determine whether NASH could be reversed, mice that had been on a WD diet for 24 weeks (30 weeks of age) began to be administered siRNA, and WD and siRNA continued for a total of 12 weeks. The liver was then evaluated for NASH pathological features. Hepatocyte ballooning, inflammation, fibrosis, and other NASH features were also evaluated.

[0172] Example 2.

[0173] Specific siRNA sequences targeting CIDEB were designed for the treatment of NASH. Based on human somatic sequencing data that have identified recurrent loss-of-function CIDEB mutations in NASH livers and based on the biological properties of CIDEB in mouse models, CIDEB represents a promising therapeutic target for human NASH.

[0174] The optimized siRNA sequences corresponding to the human sequence of human CIDEB were determined experimentally. This involved screening a number of candidate siRNAs for each gene target using an in vitro luciferase reporter-based assay. Briefly, the full-length CIDEB cDNA (without the 3'UTR) was cloned into the psicheck2 plasmid backbone containing the luciferase gene. This generated a Renilla luciferase-CIDEB fusion gene. The luciferase assay is a dual reporter system with firefly luciferase as a control and Renilla luciferase as a readout for transcription and translation. Therefore, the ratio of Renilla and firefly signals can reflect changes in transfection efficiency and cell viability. The assay was performed in a 96-well plate format with technical replicates at 48 hours as the assay readout. The reporter gene and siRNA were co-transfected into Cos7 monkey kidney cells using lipofectamine. After 48 hours, the cells were lysed and the signal was captured using a luminometer with firefly and Renilla substrates. Effective siRNAs against the target gene showed a reduction in the ratio of Renilla and Firefly signals compared to the non-targeted control group. A total of 37 siRNAs targeting the entire CIDEB cDNA + 3'UTR were designed and tested. siRNAs designed by Dharmacon and Thermo Fisher were also tested. At least 17 siRNAs that are effective against human CIDEB have been identified (Table 2). In other words, the 17 siRNAs shown in Table 2 have less than 40% of the remaining CIDEB mRNA. Figure 2A-2B siRNAs designed and tested in the exemplary methods herein are shown. Optimized siRNAs were modified by conjugation with acetylgalactosamine (GalNAC) in the standard manner and tested in vivo.

[0175] Table 2

[0176]

[0177]

[0178] Example 3.

[0179] Some human siRNAs for CIDEB disclosed herein were tested in a human cell line model of NASH. The test used optimized siRNAs and / or conjugates thereof with acetylgalactosamine (GalNAc) to improve liver targeting. There are three steps in the experimental testing of candidate siRNAs. First, the determined siRNAs are used in human liver cancer cells, such as Huh7 or HepG2, to knock down target genes of interest, such as CIDEB. Specifically, Huh7 cells are grown to 60-80% confluence and then transfected with siRNA. Opti-MEM (Thermo Fisher 31985062) containing siRNAs and liposomes (Lipofectamine) are mixed and incubated, and then cells are added for transfection (to 6-well plates, 400 μl / well; or to 100mm plates, 2.4 ml). After 6 hours, the transfection medium is replaced with medium containing 100 μM FA. Then, the cells are fed with lipids and labeled with lipid dyes. Finally, fluorescence activated cell sorting (FACS) is performed to quantify lipid accumulation. FACS purifies specific cell populations based on phenotypes detected by flow cytometry. This method allows the characterization of a single cell population without the influence of other cells. Cells were stained with 10 μg BODIPY 493 / 503 (BD) (Thermo Fisher D3922) in 1 ml PBS for 15 minutes at room temperature (23°C ± 5°C) and then FACs were measured. Early studies have shown that in cells stained with lipophilic fluorophores, the fluorescence intensity measured by FC reflects lipid levels.

[0180] Aliquots of cells grown under each condition were assayed for triglycerides (TG). Briefly, cells were trypsinized, washed once with PBS, resuspended in PBS containing 10 mM EDTA, and counted. Cells were loaded into 13 × 100 mm glass tubes in triplicate in a final volume of 200 μl. Triolein standards (Sigma T7140) were prepared in parallel in a final volume of 200 μl PBS / 10 mM EDTA and loaded into 13 × 100 mm glass tubes. TGs were extracted and quantified. Briefly, 2 ml of isopropanol: hexane: water (40:10:1) was added to cells or standards, and the samples were then vortexed, covered, and incubated at room temperature for 30 min. Then, 500 μl of a 1:1 mixture of hexane: ether was added to the samples, which were then vortexed and incubated at room temperature for 10 min. Then, 1 ml of water was added to the sample, the tube was vortexed, and the layers were separated by covering at room temperature for 30-45 minutes. The top layer was transferred to a 12×75 mm glass tube using a Pasteur pipette and dried to completion under N2. After the drying step, 400 μl of Infinity triglyceride reagent (Thermo Scientific TR22421) was added to each tube and vortexed. The tubes were covered, incubated at 37°C for 90 minutes, and shaken at 250 rpm. Finally, 300 μl of each sample was transferred to a 96-well plate and the absorbance was measured at a wavelength of 540 nm using a microplate reader. To determine whether fixed cells would affect the measurement of TG, TG quantification was performed on fixed and unfixed cells from the same batch of Huh7 cells cultured in 2 mM FA.

Claims

1. A composition comprising a nucleic acid that downregulates the expression of cell death-inducing DFF45-like effector protein B (CIDEB) or a variant thereof.

2. The composition of claim 1, wherein the nucleic acid that downregulates CIBED expression comprises siRNA, clustered regularly interspaced short palindromic repeats (CRISPR)-associated nucleic acid, single guide RNA (sgRNA), CRISPR-RNA (crRNA), or trans-activating crRNA (tracrRNA).

3. The composition according to claim 2, wherein the nucleic acid that downregulates the expression of CIDEB or its variant gene is a small interfering RNA (siRNA) molecule.

4. A composition comprising a plasmid or a viral vector, wherein the plasmid or viral vector comprises a nucleic acid encoding the siRNA molecule of claim 3.

5. The composition according to claim 3 or 4, wherein the siRNA molecule comprises a nucleotide sequence of 2 to 30 nucleotides in length and at least 80% homologous to at least 2 to 30 consecutive nucleotides in the human CIDEB cDNA sequence. The composition according to claim 5 , wherein the human CIDEB cDNA sequence is SEQ ID NO:

1.

7. The composition according to any one of claims 1-3, wherein the siRNA molecule targets the open reading frame or the 5' or 3' UTR of the CIDEB gene.

8. The composition of any one of claims 3-7, wherein the siRNA molecule comprises at least one sense sequence, at least one antisense sequence, or at least one sense sequence and at least one antisense sequence.

9. The composition according to any one of claims 3-8, wherein the siRNA molecule comprises a nucleotide sequence of SEQ ID NO: 2-97 or any combination thereof.

10. The composition of claim 8, wherein the at least one sense sequence comprises SEQ ID NOs: 2-49.

11. The composition of claim 8, wherein the at least one antisense sequence comprises SEQ ID NOs: 50-95.

12. The composition of claim 2, wherein the nucleic acid that downregulates CIBED expression is a sgRNA molecule.

13. A composition comprising a plasmid or a viral vector, wherein the plasmid or viral vector comprises a first nucleic acid encoding the sgRNA molecule of claim 12 and a second nucleic acid encoding an RNA-guided nuclease.

14. The composition of claim 13, wherein the RNA-guided nuclease is a Cas endonuclease.

15. The composition according to any one of claims 3-11, wherein the siRNA molecule specifically downregulates gene expression of at least one variant of CIBED.

16. The composition according to claim 12 or 13, wherein the sgRNA molecule specifically downregulates gene expression of at least one variant of CIBED.

17. The composition of claim 15 or 16, wherein the at least one variant of CIDEB is associated with liver disease.

18. The composition according to claim 17, wherein the liver disease comprises fatty liver disease (FLD), alcohol-related liver disease (ARLD), non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), end-stage liver disease (cirrhosis) caused by any cause, liver cancer, or any combination thereof.

19. according to the composition described in any one of claims 15-18, at least one variant of wherein said CIDEB comprises rs12590407G>A, rs368997599G>A or its any combination.

20. The composition of any one of claims 1-3 or 12, wherein the nucleic acid molecule is conjugated to at least one targeting ligand.

21. The composition of claim 20, wherein the at least one targeting ligand comprises a liver targeting ligand.

22. The composition of claim 21, wherein the liver targeting ligand comprises at least one N-acetylgalactosamine (GalNAc) conjugate.

23. The composition of claim 22, wherein the siRNA molecule is conjugated to about one to about three GalNAc conjugates.

24. The composition of any one of claims 1-3 or 12, wherein the nucleic acid molecule comprises at least one chemical modification.

25. The composition according to claim 24, wherein the nucleic acid molecule comprises a modification to at least one ribose moiety in its nucleotide sequence.

26. The composition of claim 25, wherein the at least one ribose moiety is modified with 2 2′-O-methyl (2′OMe), 2′-deoxy-2′-fluoro (2′F), 2′-deoxy, 5-C-methyl, 2′-O-(2-methoxyethyl) (MOE), 4′-thio, 2′-amino, 2′-C-allyl, or any combination thereof.

27. The composition of claim 25 or 26, wherein less than about 10% to about 70% of the ribose moieties in the total nucleotide sequence are modified.

28. A pharmaceutical composition comprising the composition of any one of claims 1-27 and at least one pharmaceutically acceptable carrier.

29. The pharmaceutical composition of claim 28, further comprising nanoparticles.

30. The pharmaceutical composition of claim 28 or 29, further comprising a lipid.

31. A method of treating a subject in need thereof, comprising administering a therapeutically effective amount of the composition of any one of claims 1-27 or the pharmaceutical composition of any one of claims 28-30.

32. The method of claim 31, wherein the subject in need thereof is a human subject suffering from or suspected of suffering from liver disease.

33. The method of claim 32, wherein the liver disease comprises fatty liver disease (FLD), alcohol-related liver disease (ARLD), non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), end-stage liver disease (cirrhosis) of any cause, liver cancer, or any combination thereof.

34. The method of any one of claims 31-33, wherein the method of administration comprises parenteral administration.

35. The method of any one of claims 31-34, wherein administration of a therapeutically effective amount of the composition of any one of claims 1-27 or the pharmaceutical composition of any one of claims 28-30 increases the subject's life expectancy compared to an untreated subject with the same disease condition and predicted outcome.

36. The method of any one of claims 31-35, wherein administration of a therapeutically effective amount of the composition of any one of claims 1-27 or the pharmaceutical composition of any one of claims 28-30 improves liver function in the subject compared to an untreated subject with the same disease condition and predicted outcome.

37. The method of any one of claims 31-36, wherein administration of a therapeutically effective amount of a composition of any one of claims 1-27 or a pharmaceutical composition of any one of claims 28-30 reduces liver fibrosis in the subject compared to an untreated subject with the same disease condition and predicted outcome.

38. The method of any one of claims 31-37, wherein administration of a therapeutically effective amount of the composition of any one of claims 1-27 or the pharmaceutical composition of any one of claims 28-30 prevents the subject from developing additional liver fibrosis compared to an untreated subject with the same disease condition and predicted outcome.

39. Kit, including (i) a container containing the composition of any one of claims 1 to 27 or the pharmaceutical composition of any one of claims 28 to 30; (ii) a drug administration device; and (iii) Instructions.

Images