Synthesis method of DNA enzyme nano-material for treating tumor and maintaining fertility

Abstract

The invention relates to a synthesis method of a DNA enzyme nano-material for treating tumors and maintaining fertility, which comprises the following steps: synthesizing DNAzyme with APE1 enzyme sites, mixing the DNAzyme with hemoglobin, a ferrous iron solution and deionized water, carrying out vortex, centrifugation, washing and other steps to form a nano-composite, and carrying out wrapping preservation by using tannic acid in the synthesis process. The synthesized novel nano compound can be dissociated in tumor cells with high APE1 expression to play a role, but does not play a role in normal cells, so that targeted therapy is realized, and reproductive organs are effectively protected; meanwhile, the novel nano-composite synthesized through ultrasonic and enzyme double-control activation can realize time-space controllable combined tumor treatment, is used for fertility maintenance of tumor treatment, and avoids damage to reproductive organs.

Description

Technical Field

[0001] The invention relates to the technical field of biomedicine, and in particular to a method for synthesizing a DNA enzyme nanomaterial for treating tumors and maintaining fertility. Background Art

[0002] DNA enzyme (DNAzyme) is a short DNA oligomer that has become a promising tool for gene regulation in disease treatment due to its high catalytic efficiency and specificity.

[0003] Photochemical integration of DNAzymes into DNA nanostructures by cleaving linkers for optical control of gene regulatory activity has been reported. While these photoactivation strategies provide spatiotemporal control of DNAzyme activity, their in vivo application is hampered by shallow tissue penetration of light. In contrast, endogenous enzymes present a more promising triggering mechanism due to their high catalytic efficiency, substrate selectivity, and spatial overexpression in many diseased cells. Recently, enzyme response elements have been incorporated into DNAzyme design to develop strategies to conditionally modulate their catalytic activity in response to specific enzymatic triggers. Despite these advances, the application of enzyme-activated DNAzyme systems for in vivo tumor therapy remains challenging due to the lack of reliable engineering methods.

[0004] Sonodynamic therapy (SDT) is an emerging treatment modality that uses low-intensity ultrasound (US) to activate sonosensitizers within cancerous areas, generating reactive oxygen species (ROS) to eradicate tumor cells, thus providing a highly controllable approach to tumor treatment. The advantages of US include minimal invasiveness, mild side effects, and deep tissue penetration far exceeding that of light (>10 cm), making SDT a promising treatment modality. Therefore, various sonosensitizers, ranging from organic molecules to inorganic nanoparticles, have been explored to improve the efficiency of sonodynamic therapy.

[0005] Auracil / apyrimidinic endonuclease 1 (APE1) plays a crucial role in the base excision repair pathway, which is responsible for excision of the basic (AP) site to promote DNA damage repair. The current study has demonstrated the use of APE1 as a trigger for designer enzyme activation of DNA systems, enabling selective molecular imaging and treatment of diseased cells.

[0006] Hemoglobin (Hb), a natural biomolecule with four heme groups, has significant advantages as a sonosensitizer due to its superior sonodynamic efficiency, water solubility, and biocompatibility, which surpass traditional organic sonosensitizers.

[0007] The therapeutic application of DNAzymes is limited by poor cell membrane permeability and unstable biological environment, which requires the use of nanocarriers for effective intracellular delivery. At the same time, the target RNA molecules degraded by DNAzymes are often expressed in cancer cells and normal cells, resulting in off-target tumor effects and reduced therapeutic precision. To address this issue, researchers have tried to develop stimulus-responsive strategies to achieve spatiotemporal control of DNAzyme activity, but their anti-tumor effects are far from expected. Therefore, controlling the co-delivery of sonosensitizers with other therapeutic agents is crucial to advancing the next generation of SDT systems. Summary of the invention

[0008] In order to solve the above technical problems, the present application designs a DNAzyme with an APE1 control site targeting survivin, which combines hemoglobin and divalent iron ions to form a nanocomplex, thereby achieving the function of DNAzyme to release the AP site in APE1 high-expressing cells, realizing tumor targeted therapy under ultrasound mediation, while not affecting the maintenance of fertility after tumor treatment.

[0009] To achieve the above objectives, the present application aims to propose a method for synthesizing DNA enzyme nanomaterials for treating tumors and maintaining fertility, the method comprising:

[0010] Step S1: Synthesizing DNAzyme with APE1 enzyme site (AP-DZ);

[0011] Step S2: mixing AP-DZ, hemoglobin, ferrous iron solution and deionized water in a synthesis tube;

[0012] Step S3: vortexing the mixed solution obtained in step S1 with a vortexer and then placing it in a metal constant temperature heater for reaction;

[0013] Step S4: vortexing the solution after the reaction again and then centrifuging it in a centrifuge;

[0014] Step S5: After centrifugation, use a pipette to remove the supernatant and keep the precipitate in a collection tube;

[0015] Step S6: adding deionized water to the collection tube and performing a third vortex treatment;

[0016] Step S7: After the vortex treatment, FeCl3·6H2O is added to the tube and then vortexed for the fourth time;

[0017] Step S8: After washing twice, the DNA nanomaterial is stored at 4°C until use.

[0018] Furthermore, in step S2, for every 100 μL of synthesis, the dosage is 15 μL AP-DZ (concentration is 100 μM), 10 μL hemoglobin (concentration is 1 mg / ml), 3 μL divalent iron solution (concentration is 4 mg / ml); and 72 μL deionized water.

[0019] Furthermore, in step S3, the vortex treatment time is 10 seconds, the metal constant temperature heater used needs to be preheated to 95° in advance, and the reaction time is 2 hours.

[0020] Furthermore, in step S4, the vortex treatment time is 5 seconds, the centrifugal condition is 13,000 rpm, and the centrifugal treatment time is 10 minutes.

[0021] Furthermore, in step S6, the amount of deionized water used is 100 μL, the vortex time is 10 s, and 5 μL of TA (with a concentration of 4 mg / ml) is added under the vortex condition.

[0022] Furthermore, in step S7, the concentration of FeCl3·6H2O is 1 mg / mL, the dosage is 5 μL, and the vortex time is 30 s.

[0023] Furthermore, the washing in step S8 includes the following steps:

[0024] Step S81: centrifuge the solution and then add deionized water;

[0025] Step S82: Perform vortex processing.

[0026] Furthermore, in the step S81, the centrifugal condition is 13,000 rpm, the centrifugal treatment time is 3 min, the amount of deionized water is 100 μL, and the vortex time in the step S82 is 10 s.

[0027] Furthermore, the hydrated size of the DNA nanomaterial is 143nm to 163nm.

[0028] Furthermore, the DNA nanomaterial is used in the preparation of drugs for tumor treatment.

[0029] Compared with the prior art, the advantages and effects of this application are as follows:

[0030] 1. The present invention provides a method for synthesizing a DNA enzyme nanomaterial for treating tumors and maintaining fertility. The DNA nanomaterial ADH@TA can dissociate and exert its effect in tumor cells with high expression of APE1, but has no effect in normal cells, thereby achieving targeted treatment and effectively protecting reproductive organs.

[0031] 2. The method for synthesizing DNA enzyme nanomaterials for treating tumors and maintaining fertility of the present invention can realize spatiotemporally controllable combined treatment of tumors and can be used for maintaining fertility in tumor treatment.

[0032] 3. The present invention provides a method for synthesizing a DNA enzyme nanomaterial for treating tumors and maintaining fertility, wherein the tumor killing is further mediated by ultrasound, which can achieve ultrasound of the tumor site and avoid damage to the reproductive organs.

[0033] The above description is only an overview of the technical solution of the present application. In order to more clearly understand the technical means of the present application so that it can be implemented in accordance with the contents of the specification, and to make the above and other purposes, features and advantages of the present application more obvious and easy to understand, the following is a detailed description of the preferred embodiments of the present application in conjunction with the accompanying drawings as follows.

[0034] Based on the detailed description of the specific embodiments of the present application in combination with the accompanying drawings below, those skilled in the art will become more aware of the above and other objects, advantages and features of the present application. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings required for use in the embodiments or the prior art descriptions are briefly introduced below. Obviously, the drawings described below are some embodiments of the present application. For ordinary technicians in this field, other drawings can also be obtained based on these drawings without creative work. In all drawings, similar elements or parts are generally identified by similar reference numerals. In the drawings, each element or part is not necessarily drawn according to the actual scale.

[0036] in:

[0037] Figure 1 :(a) Design of enzyme-activated DNAzyme (En-Dz);(b) Schematic diagram of the synthesis of ADH@TA nanohybrids;(c) Working principle of ADH@TA spatiotemporally controllable combined tumor therapy;

[0038] Figure 2 :(a) Schematic diagram of the interaction between En-Dz and target mRNA;(b) Schematic diagram of ape1-induced release of Dz by En-Dz;(c) Time-dependent fluorescence response of FRET-labeled En-Dz to APE1 (detection intensity is 675nm);(d) PAGE analysis of ape1-mediated En-Dz activation;(e) Schematic diagram showing that ape1 can activate En-Dz to cleave mRNA;(f) In the presence of Mg2+, the fluorescence intensity of FRET-labeled survivin mRNA to En-Dz and APE1. Data are expressed as mean±sd (n=3);

[0039] Figure 3 : PAGE analysis of ape1 activated mRNA by En-Dz;

[0040] Figure 4 :(a) Urea PAGE analysis;(b) The cleavage amount of ape1 activated mRNA by En-Dz under different concentrations of Mg2+ after 4 h of incubation. Data are expressed as mean±sd (n=3);

[0041] Figure 5 :(a) Urea PAGE analysis; (b) En-Dz cleavage kinetics curve of ape1 activated mRNA at different incubation times at 1 mM Mg2+ concentration. Data are expressed as mean±sd (n=3);

[0042] Figure 6 :(a) TEM image of ADH, scale bar is 200;(b) TEM image of ADH, scale bar, 100nm respectively;(c) EDS mapping image of ADH, scale bar is 100nm;(d) TEM image of ADH@TA, scale bar is 100nm;(e) DLS analysis of ADH and ADH@TA;(f) DPBF ultrasonic irradiation at different times (1MHz, 50% duty cycle, 1Wcm-2);(g) Absorption intensity of DPBF at 416nm after irradiation of ADH@TA or ADB@TA at different times. Data are expressed as mean±sd (n=3);(h) ESR spectra of ROS generated by ADH@TA or ADB@TA after 10min of ultrasonication;(i) Fluorescence spectra of released En-Dz in response to APE1 (labeled with FRET pair);(j) Fluorescence spectra of mRNA labeled with FRET pair in response to ADH@TA or ADH@TA+APE1;

[0043] Figure 7 :(a) HAADF-STEM image; (b) corresponding EDS line scan analysis of ADH, scale bar is 100nm;

[0044] Figure 8 :(a) TEM images of ADH in HO2 after different incubation times; (b) TEM images of ADH in PBS after different incubation times; (c) TEM images of ADH@TA in PBS after different incubation times, scale bar is 100 nm;

[0045] Fig. 9 : ADH zeta potential and ADH@TA. Data are presented as mean ± sd (n = 3);

[0046] Fig.10:(a) Iron release of ADH@TA in En-Dz; (b) Iron release of ADH@TA in PBS; Data are expressed as mean±sd (n=3);

[0047] Fig.11 :(a) High-resolution iron 2pXPS spectrum of XPS measurement spectrum;(b) High-resolution iron 2pXPS spectrum of ADH@TA;

[0048] Fig.12 : The absorption intensity of DPBF at 416 nm in the presence of ADH@TA under different ultrasonic powers. Data are expressed as mean±sd (n=3);

[0049] Fig.13 :The singlet oxygen sensor green fluorescence spectroscopy was used to detect ROS generation of ADH@TA under ultrasound at different time periods;

[0050] Fig.14 : FRET pairs of labeled mRNAs only respond to the fluorescence spectrum of APE1;

[0051] Fig.15 : Confocal fluorescence images of MCF-7 cells treated with Cy5- and Rodb-labeled ADH@TA, Cy5-labeled free En-Dz, or Rodb-labeled free Hb. Scale bar: 20 μm;

[0052] Fig.16 :(a) Confocal fluorescence images; (b) Flow cytometric quantification of MCF-7 cells treated with FRET paired labeled ADH@TA or nADH@TA, with or without ultrasound irradiation (1.0 MHz, 50% duty cycle, 0.4 Wcm-2, 5 min). Scale bar: 50 μm. Data are expressed as mean ± SD (n = 3); (c) Confocal fluorescence images; (d) Confocal fluorescence images of MCF-7 cells and L-02 cells after treatment with ADH@TA (with or without ultrasound irradiation). Scale bar is 50 μm; (e) Flow cytometric analysis of MCF-7 cells incubated with DCFH-DA and treated as indicated. Scale bar is 200 μm;

[0053] Fig.17 :(a) Colocalization fluorescence images of MCF-7 cells treated with cy5-labeled ADH@TA and lysosome tracker with or without ultrasound irradiation. Scale bar: 20 μm; (b) Western blot analysis; (c) Quantification of cytoplasmic APE1 in MCF-7 cells with different treatments, data are expressed as mean±sd (n=3). **P<0.01, ***P<0.001, ns, not significant;

[0054] Fig.18:Flow cytometric analysis of MCF-7 in the presence of ADH@TA or nADH@TA with or without ultrasound irradiation;

[0055] Fig.19 : Flow cytometry quantification of MCF-7 cells and L-02 cells with or without irradiation of ADH@TA. Data are presented as mean±sd (n=3). ***P<0.001, ****P<0.0001;

[0056] Fig. 20 :(a) Western blot analysis; (b) corresponding quantification of cytoplasmic APE1 in L-02, MCF-7 and PC-3 cells. Data are expressed as mean±sd (n=3). *P<0.05, **P<0.01;

[0057] Fig.21 : Flow cytometry quantification of MCF-7 cells stained with DCFH-DA and treated with PBS, ADH@TA or ADB@TA, with or without ultrasound irradiation. Data are presented as mean±sd (n=3);

[0058] Fig. 22 :(a) RT-qPCR analysis of survivin mRNA in MCF-7 cells after different treatments. Data are expressed as mean ± sd (n = 3); (b) Western blot analysis of survivin protein levels in MCF-7 cells after different treatments; (c) Confocal fluorescence images of MCF-7 cells treated with JC-1 probe and ADH@TA, with or without ultrasound irradiation, scale bar 100 μm; (d) Cell viability of MCF-7 cells after different treatments, conditions: 1.0 MHz, 50% duty cycle, 1.5 W cm-2, 5 min. Data are expressed as mean ± sd (n = 3); (e) Cell viability of MCF-7 cells and L-02 cells after irradiation with different concentrations of ADH@TA. Data are expressed as mean ± sd (n = 3); (f) Flow cytometric analysis of Annexin V / PI staining of MCF-7 cells after different treatments; (g) Confocal fluorescence images of MCF-7 cells stained with Calcein-AM / PI after different treatments. Scale bar is 200 μm. ***P<0.05, P<0.01, ***P<0.001, ns not significant;

[0059] Fig.23 : Fluorescence intensity ratio of JC-1 monomers and aggregates in the corresponding confocal fluorescence images (green / red), data are expressed as mean ± sd (n = 50). ****P < 0.0001, ns, not significant;

[0060] Fig.24: ATP content in MCF-7 cells treated with PBS, ADH@TA or ADH@TA+US, data are expressed as mean±sd (n=3). ****P<0.0001, ns not significant;

[0061] Fig.25 :Cell viability of MCF-7 cells treated with different concentrations of AcDH@TA. Data are expressed as mean±sd (n=3), Ns, not significant;

[0062] Fig.26 : Flow cytometric analysis of L-02 cells after ADH@TA+US treatment and MCF-7 cells stained with AnnexinV / PI;

[0063] Fig. 27 : MCF-7 cell clone formation with different treatments;

[0064] Fig.28 : Pharmacokinetic study of free En-Dz and ADH@TA (En-Dz only labeled with Cy5) in mice after intravenous injection, data are expressed as mean±sd (n=3);

[0065] Fig.29 :(a) Fluorescence images of MCF-7 tumor-bearing mice at different time points after intratumoral injection of FRET paired labeled ADH@TA or nADH@TA, with or without ultrasound irradiation (1.0 MHz, 50% duty cycle, 1.5 Wcm-2, 5 min); (b) Quantification of intratumoral fluorescence intensity shown in Figure (a). Data are expressed as mean±sd (n=5); (c) Relative fluorescence intensity of tumor site. Data are expressed as mean±sd (n=5); (d) Ex vivo fluorescence images; (e) Quantitative fluorescence analysis of tumors in different groups of mice. Data are expressed as mean±sd (n=5). ***P<0.05, P<0.01, ***P<0.001, ****P<0.0001, ns, not significant;

[0066] Fig.30 :(a) Schematic diagram of in vivo treatment scheme;(b) Changes in tumor volume of MCF-7 (breast cancer) tumor-bearing mice after different treatments. Data are expressed as mean±sd (n=5);(c) Individual tumor growth curve during PBS treatment;(d) Individual tumor growth curve during US treatment;(e) Individual tumor growth curve during AcDH@TA treatment;

[0067] Fig.31:(a) Individual tumor growth curve during ADH@TA treatment;(b) Individual tumor growth curve during nADH@TA+US treatment;(c) Individual tumor growth curve during AcDH@TA+US treatment;(d) Individual tumor growth curve during ADH@TA+US treatment, (n=5). Ultrasound conditions: 1.0MHz, 50% duty cycle, 1.5Wcm-2, 5min;(e) Mouse weight curves under different treatments, data are expressed as mean±sd (n=5);(f) Tumor weight measurements;

[0068] Fig.32 :(a) Corresponding photos of tumors harvested from different treatment groups. Data are expressed as mean ± sd (n = 5); (b) H&E staining; (c) TUNEL staining of tumor sections treated with different combinations, scale bar is 50 μm. ***P < 0.05, P < 0.01, ***P < 0.001, ****P < 0.0001, ns, not significant;

[0069] Fig.33 :Survivin protein immunohistochemical staining of mouse tumor tissues after 14 days of different treatments, scale bar is 100 μm;

[0070] Fig.34 : The biochemical indices of alanine aminotransferase (ALT), aspartate aminotransferase (AST), total protein (TP), albumin (ALB), alkaline phosphatase (ALP), glucose (GLU), blood urea nitrogen (BUN), cholesterol (CHOL), creatine kinase (CK) and globulin (GLOB) in the blood of mice treated with PSB and ADH@TA were measured respectively. The data are expressed as mean ± sd (n = 3);

[0071] Fig.35 : H&E staining of heart, liver, spleen, lung, and kidney sections after PBS or ADH@TA treatment, scale bar, 100 μm;

[0072] Fig.36 :(a) RT-qPCR analysis of survivin mRNA in the heart of mice after treatment with PBS and ADH@TA;(b) RT-qPCR analysis of survivin mRNA in the liver of mice after treatment with PBS and ADH@TA;(c) RT-qPCR analysis of survivin mRNA in the spleen of mice after treatment with PBS and ADH@TA;(d) RT-qPCR analysis of survivin mRNA in the lung of mice after treatment with PBS and ADH@TA;(e) RT-qPCR analysis of survivin mRNA in the kidney of mice after treatment with PBS and ADH@TA. Data are expressed as mean±sd (n=3);

[0073] Fig.37 :(a) Changes in tumor volume of PC-3 tumor-bearing mice after different treatments. Data are expressed as mean±sd (n=5); (b) Individual tumor growth curve during PBS treatment; (c) Individual tumor growth curve during US treatment; (d) Individual tumor growth curve during AcDH@TA treatment; (e) Individual tumor growth curve during ADH@TA treatment; (f)

[0074] Individual tumor growth curves during nADH@TA+US treatment;

[0075] Fig.38 :(a) Individual tumor growth curve during AcDH@TA+US treatment; (b) Individual tumor growth curve during ADH@TA+US treatment. (n=5). Ultrasound conditions: 1.0MHz, 50% duty cycle, 1.5Wcm-2, 5min; (c) Mouse weight curve under different treatments. Data are expressed as mean±sd (n=5); (d) Tumor weight measurement; (e) Corresponding photos of tumors harvested from different treatment groups. Data are expressed as mean±sd (n=5). ***P<0.001, ****P<0.0001, ns, not significant; Specific embodiments

[0076] To make the purpose, technical scheme and advantages of the embodiment of the present application clearer, the technical scheme in the embodiment of the present application will be clearly and completely described below in conjunction with the accompanying drawings in the embodiment of the present application. Obviously, the described embodiment is a part of the embodiment of the present application, rather than all of the embodiments. In the following description, specific details such as specific configuration and components are provided only to help fully understand the embodiments of the present application. Therefore, it should be clear to those skilled in the art that various changes and modifications can be made to the embodiments described herein without departing from the scope and spirit of the present application. In addition, for clarity and brevity, the description of known functions and structures is omitted in the embodiment.

[0077] It should be understood that the references to "one embodiment" or "this embodiment" throughout the specification mean that the specific features, structures, or characteristics associated with the embodiment are included in at least one embodiment of the present application. Therefore, the references to "one embodiment" or "this embodiment" appearing throughout the specification do not necessarily refer to the same embodiment. In addition, these specific features, structures, or characteristics may be combined in any suitable manner in one or more embodiments.

[0078] In addition, the present application may repeat reference numerals and / or letters in different examples. This repetition is for the purpose of simplicity and clarity, and does not in itself indicate the relationship between the various embodiments and / or settings discussed.

[0079] The term "and / or" in this article is only a description of the association relationship of associated objects, indicating that there can be three relationships. For example, A and / or B can mean: A exists alone, B exists alone, and A and B exist at the same time. The term " / and" in this article describes another type of association object relationship, indicating that there can be two relationships. For example, A / and B can mean: A exists alone, and A and B exist alone. In addition, the character " / " in this article generally indicates that the associated objects before and after are in an "or" relationship.

[0080] The term "at least one" in this article is merely a description of the association relationship of associated objects, indicating that there may be three relationships. For example, at least one of A and B can mean: A exists alone, A and B exist at the same time, and B exists alone.

[0081] It should also be noted that, in this article, relational terms such as first and second, etc. are only used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Moreover, the terms "include", "comprises" or any other variations thereof are intended to cover non-exclusive inclusions.

[0082] Example 1

[0083] This example discloses a method for synthesizing DNA enzyme nanomaterials for treating tumors and maintaining fertility, see Figure 1 (b), the preparation method comprises:

[0084] Step S1: Synthesizing DNAzyme with APE1 enzyme site (AP-DZ);

[0085] Step S2: mixing AP-DZ, hemoglobin, ferrous iron solution and deionized water in a synthesis tube;

[0086] Step S3: vortexing the mixed solution obtained in step S1 with a vortexer and then placing it in a metal constant temperature heater for reaction;

[0087] Step S4: vortexing the solution after the reaction again and then centrifuging it in a centrifuge;

[0088] Step S5: After centrifugation, use a pipette to remove the supernatant and keep the precipitate in a collection tube;

[0089] Step S6: adding deionized water to the collection tube and performing a third vortex treatment;

[0090] Step S7: After the vortex treatment, FeCl3·6H2O is added to the tube and then vortexed for the fourth time;

[0091] Step S8: After washing twice, the DNA nanomaterial is stored at 4°C until use.

[0092] Furthermore, in step S2, for every 100 μL of synthesis, the dosage is 15 μL AP-DZ (concentration is 100 μM), 10 μL hemoglobin (concentration is 1 mg / ml), 3 μL divalent iron solution (concentration is 4 mg / ml); and 72 μL deionized water.

[0093] Furthermore, in step S3, the vortex treatment time is 10 seconds, the metal constant temperature heater used needs to be preheated to 95° in advance, and the reaction time is 2 hours.

[0094] Furthermore, in step S4, the vortex treatment time is 5 seconds, the centrifugal condition is 13,000 rpm, and the centrifugal treatment time is 10 minutes.

[0095] Furthermore, in step S6, the amount of deionized water used is 100 μL, the vortex time is 10 s, and 5 μL of TA (with a concentration of 4 mg / ml) is added under the vortex condition.

[0096] Furthermore, in step S7, the concentration of FeCl3·6H2O is 1 mg / mL, the dosage is 5 μL, and the vortex time is 30 s.

[0097] Furthermore, the washing in step S8 includes the following steps:

[0098] Step S81: centrifuge the solution and then add deionized water;

[0099] Step S82: Perform vortex processing.

[0100] Furthermore, the centrifugal condition in step S81 is 13,000 rpm, the centrifugal treatment time is 3 min, the amount of deionized water is 100 μL, and the vortex time in step S82 is 10 s.

[0101] Furthermore, all the vortex treatment operation methods are to place the tube of the mixed suspension on a vortex mixer for vortex mixing.

[0102] Furthermore, the hydrated size of the DNA nanomaterial is 143nm to 163nm.

[0103] Furthermore, the DNA nanomaterial is used in the preparation of drugs for tumor treatment.

[0104] The DNA nanomaterial ADH@TA synthesized in this example can dissociate and exert its effect in tumor cells with high expression of APE1, but has no effect in normal cells, thereby achieving targeted therapy and effectively protecting reproductive organs.

[0105] Example 2

[0106] Based on Example 1, this example introduces the design and evaluation of En-Dz, see Figure 1 (a).

[0107] The design of En-Dz includes:

[0108] The sequence of the designed DNAzyme is (SEQ ID NO.1):

[0109] CCTCGGCCAGGCTAGCTACAACGACCGCTCCCGCCACATAAGGCGTGGAGCG.

[0110] APE1-activated DNAzyme (AP-DZ) design: 5′-C*C*T CGG CCA GGC TAG CTA CAA CGA CCGCTC CX CGCC ACA TAA GGCG T GGA GCG-3′;

[0111] DNAzyme with Cy5 / BHQ2: 5'-C*C*T CGG CCA GGC TAG CTA CAA CGA CCG C / BHQ2 / TC C XCGCC ACA TAA GGCG T GGA GCG / Cy5 -3';

[0112] DNAzyme without AP site: 5'-C*C*T CGG CCA GGC TAG CTA CAA CGA CCGCTCCC CGCC ACA TAA GGCG T GGA GCG-3';

[0113] cDNAzyme: 5'-C*C*T CGG CCA GGC TAC CTA CAA CGA CCG CTC CX CGCC ACATAA GGCG T GGA GCG-3';

[0114] sruvivin mRNA substrate: 5'-CC CCG GAG CGG AU GGC CGA GGC UGG-3';

[0115] sruvivin mRNA substrate with Cy3 / BHQ2: 5'-CC CCG GAG / Cy3 / CGG AU GGCCGA GGC UGG / BHQ2 -3';

[0116] Note: "X" represents the enzymatic site of APE1, generally represented by X; Cy5: modified fluorescence of Cy5; DNAzymewithout AP site: without APE1 site; cDNAzyme: DNAzyme of mutant chain, which does not play a cutting role and is used for action comparison.

[0117] This example uses a Cy5 fluorescence-based assay to verify the enzyme-induced activation of En-Dz.

[0118] En-Dz is labeled with Cy5 fluorophore in the middle of the DNAzyme chain and with BHQ2 quencher at the 5' end of the blocking chain. Resonance Energy Transfer (FRET) produces low background fluorescence. Figure 2 As shown in a, the addition of survivin mRNA substrate did not cause an increase in fluorescence, indicating that the mRNA target site could not destroy the stable hairpin structure, thus confirming the successful construction of the inactive En-Dz. After adding APE1, the fluorescence signal of En-Dz increased by about 7.0 times ( Figure 2 b red line), indicating that Dz is released due to AP site cleavage. The time-dependent fluorescence spectrum shows a rapid response of FRET-labeled En-Dz to APE1 ( Figure 2 c), providing further evidence for efficient enzyme activation.

[0119] In addition, polyacrylamide gel electrophoresis (PAGE) analysis confirmed the activation of En-Dz by APE1. Figure 2 As shown in Figure d, En-Dz was cleaved into two strands in the presence of APE1, one of which was identified as Dz. In contrast, a control system (En-Dz) with the same sequence as En-Dz but lacking the AP site did not respond to APE1, further validating the enzyme activation mechanism. Next, we investigated the APE1-activated En-Dz RNA cleavage activity by labeling the survivin mRNA substrate with a Cy3 fluorophore and a BHQ2 quencher at the 5' end, and an enhanced fluorophore signal was observed after DNAzyme-mediated cleavage ( Figure 2 e). Figure 2 As shown in f, in the absence of APE1 activation, the fluorescence intensity did not increase significantly after the addition of En-Dz ( Figure 2 f orange), indicating that the catalytic gene cleavage activity of DNAzyme was inhibited. In contrast, after adding APE1 and En-Dz, the fluorescence was significantly enhanced by about 2 times ( Figure 2 f), indicating that APE1 activation successfully restored the RNA cleavage function of En-Dz. PAGE analysis further confirmed these findings ( Figure 3 ).

[0120] In addition, En-Dz showed a Mg2+ concentration (0.5-2mM)-dependent mRNA cleavage effect. After 2+4 hours of reaction, about 80% of the mRNA was cleaved at 1mM Mg ( Figure 4 ), indicating its potential for gene regulation. Time-dependent evaluation showed that the observed rate constant (K) was 0.009min-1( Figure 5 ).

[0121] The En-Dz designed in this example has strong gene regulation potential.

[0122] Example 3

[0123] Based on Example 1, this example introduces the synthesis and characterization of ADH@TA:

[0124] DNAzyme-Hb nanohybrids (ADHs) were synthesized by a coordination-driven self-assembly approach through the coordination interactions of metal ions with phosphate groups, nitrogen atoms, and oxygen atoms on DNA and proteins. In a typical process, En-Dz, Hb, and Fe(II) were incubated at an appropriate temperature for 2 h, and the final product was then collected by centrifugation. Transmission electron microscopy (TEM) images ( Figure 6 a and 6b) show that the obtained nanohybrid has a spherical morphology with uniform size distribution. Energy dispersive X-ray spectroscopy (EDS) images ( Figure 6 c) and line scan analysis ( Figure 7 ) showed that the signals of iron, phosphorus (from DNA), and sulfur (from protein) elements were evenly distributed, indicating that En-Dz and Hb were successfully encapsulated within the nanosystem. The loading efficiencies of En-Dz and Hb were calculated to be 89% and 46%, respectively. The ADH nanohybrid remained stable in water for at least 48 h but disintegrated within 2 h in PBS due to the disruption of the phosphate-mediated coordination interaction between Fe(II) and DNA ( Figure 8 Since metal phenol networks have been widely used to improve the stability of nanoparticles, a metal phenol network shell was coated on ADH through the coordination interaction between Fe(III) and tannic acid (TA) ( Figure 6 d). The hydrated size of the resulting ADH@TA nanohybrid increased from 112 nm to 153 nm ( Figure 6 e), the zeta potential changes minimally ( Fig. 9 This surface coating significantly improved the stability of the nanohybrids in PBS, leading to the sustained release of En-Dz and metal ions ( Fig.10 In addition, the high-resolution x-ray photoelectron spectroscopy (XPS) of Fe2p has two peaks at 711.4eV and 725.1eV ( Fig.11), corresponding to Fe2p and Fe2p, respectively. The estimated ratios of Fe(II) and Fe(III) in ADH@TA were 57% and 43%, respectively.

[0125] In order to evaluate the sonodynamic performance of ADH@TA, 1,3-diphenylisobenzofuran (DPBF) was used as an indicator to detect ROS generation. Figure 6 As shown in Figure 5, after adding ADH@TA to the DPBF solution, the absorbance of DPBF decreased significantly with the increase of irradiation time, confirming the generation of ROS and thus the sonodynamic effect of ADH@TA. As a control, bovine serum albumin (BSA) was used to replace Hb to synthesize the nanohybrid (ADB@TA). When ultrasound was applied to the mixture of ADB@TA and DPBF, only a slight decrease in DPBF absorption was observed, similar to the blank control (DPBF+US) ( Figure 6 g). In contrast, the ROS generation efficiency of the ADH@TA+US group was much higher, indicating that the sonodynamic effect of ADH@TA was mainly due to the loaded Hb. In addition, the ROS generation capacity of ADH@TA gradually increased with the increase of ultrasound power ( Fig.12 The SDT potential was also determined by electron spin resonance spectroscopy ( Figure 6 h) and singlet oxygen sensor green assay ( Fig.13 ) was confirmed. We further studied the response of En-Dz released by ADH@TA to ape1 triggering. Figure 6 As shown in Fig. i, after the addition of APE1, the fluorescence intensity of the FRET-labeled En-Dz increased by about 3.5 times, which was about 2 times lower than that of pure En-Dz ( Figure 2 b). After incubation in ADH@TA, the fluorescence intensity of the FRET pair labeled target mRNA increased significantly upon addition of APE1, whereas minimal fluorescence change was observed in the absence of APE1, confirming the enzyme-activated RNA cleavage reactivity of the released En-Dz ( Figure 6 j). Notably, APE1 itself has no effect on the cleavage of its RNA target ( Fig.14 ).

[0126] The hydrated size of the ADH@TA nanohybrid obtained in this example is 143 nm to 163 nm, and has strong stability in PBS and has a sonodynamic effect.

[0127] Example 4

[0128] Based on Examples 1-3, this example introduces the ultrasound and enzyme dual-controlled activation ADH@TA reaction:

[0129] To visualize cellular uptake, En-Dz and Hb were labeled with Cy5 and Rhodamine B (RodB) fluorophores, respectively, and their presence in MCF-7 cells was observed using confocal microscopy. After 3 h of ADH@TA incubation, MCF-7 cells showed obvious red and green fluorescence signals from Cy5 and RodB, respectively ( Fig.15 ). In contrast, cells treated with free En-Dz and free Hb showed minimal fluorescence signals, indicating that ADH@TA significantly enhanced the intracellular delivery of the dual biomolecules.

[0130] Next, nanohybrids prepared from FRET pair-labeled En-Dz or En-Dz were incubated with MCF-7 cells for 3 h and then exposed to ultrasound. Fig.16 As shown in a, the ADH@TA group exhibited stronger fluorescence intensity compared with cells treated with nADH@TA (assembled from En-Dz), confirming APE1-mediated Dz release. Notably, ultrasound significantly enhanced the fluorescence intensity of ADH@TA-treated cells, while the signal change in the nADH@TA group was negligible. This ultrasound-mediated enhancement of the fluorescence intensity of ADH@TA-treated cells may be due to SDT-induced APE1 translocation from the nucleus to the cytoplasm, thereby increasing the level of cytoplasmic APE1, resulting in more FRET-labeled En-Dz being cleaved. Flow cytometry analysis showed that the fluorescence intensity of the ADH@TA+US group was 2.1 times and 1.3 times higher than that of the nADH@TA+US group and the non-ultrasounded ADH@TA group, respectively ( Fig.16 b and Fig.18 In addition, compared with L-02 cells (a normal cell line with relatively low cytoplasmic APE1 expression), higher fluorescence signals were observed in MCF-7 cells after ADH@TA treatment ( Fig.16 d and Fig.19 ), indicating high selectivity for cancer cells, which is consistent with the overexpression of cytoplasmic APE1 in MCF-7 cells ( Fig. 20 ).

[0131] The triggered ROS generation in ADH@TA cells was studied using the fluorescent indicator 2',7'-dichlorodihydrofluorescein diacetate (DCFH-DA). Fig.16 As shown in c, among all groups, the fluorescence of ADH@TA-incubated cells after ultrasound was the brightest, indicating that US-mediated ADH@TA produced efficient ROS in cells. The fluorescence intensity of the ADH@TA+US group was 14.3 times higher than that of the ADH@TA group ( Fig.16 e and Fig.21). In contrast, ADB@TA showed no obvious intracellular sonodynamic effect when exposed to ultrasound, confirming the key role of Hb as a sonosensitizer. Subsequently, cells were co-stained with LysoTracker Green to detect the endosomal escape performance of the nanohybrids. After ADH@TA treatment, the red fluorescence signal of cy5-labeled En-Dz partially overlapped with the green fluorescence signal of endosomes, with a Manders correlation coefficient (MCC) of 0.67±0.05, indicating that the nanohybrids were mainly localized in endolysosomes ( Fig.17 a). However, after ultrasound irradiation, the overlap between the two signals was significantly reduced, with an MCC value of 0.09 ± 0.04, indicating that most of the nanohybrids had escaped from the endosomes. This improved endosomal escape was attributed to the ROS-induced destabilization and rupture of the endosomal membrane, which promoted the efficient release of the nanosystem. It is worth noting that the weakening of the LysoTracker green fluorescence signal in ultrasound-treated cells may be due to ROS-induced endosomal damage. Western blot analysis of cytoplasmic APE1 expression. Fig.17 As shown in Figures 17b and 17c, the cytoplasmic APE1 levels in ADH@TA-treated cells showed negligible changes compared with the control group. In contrast, irradiation resulted in a 1.5-fold increase in cytoplasmic APE1 levels, likely due to Ros-induced oxidative stress, which promoted the translocation of APE1 from the nucleus to the cytoplasm. Therefore, the gene regulatory activity of this system can be controlled by both ultrasound and APE1 with improved spatiotemporal precision. These findings highlight the potential of ADH@TA for spatiotemporally controlled tumor therapy through a dual mechanism involving triggered ROS generation and enzyme-activated gene regulation.

[0132] This example found that ultrasound and enzyme dual-controlled activation of ADH@TA can improve spatiotemporal precision, thus demonstrating its potential in spatiotemporal controlled tumor therapy.

[0133] Example 5

[0134] Based on Examples 1-4, this example introduces the dual-control gene regulation and in vitro therapeutic effects:

[0135] We used real-time quantitative polymerase chain reaction (RT-qPCR) to evaluate the gene regulation of survival mRNA by ADH@TA in MCF-7 cells. Fig. 22As shown in a, ADH@TA-treated cells showed a 67% decrease in survivin mRNA expression after ultrasound irradiation, indicating that the system effectively knocked out mRNA. In contrast, the nADH@TA+US group showed minimal changes in mRNA expression, highlighting the important role of enzyme cleavage in DNAzyme-mediated gene regulation. However, ADH@TA-treated cells that were not exposed to ultrasound showed only a slight downregulation of survivin mRNA, which emphasized the significant enhancement of gene regulation by the sonodynamic effect.

[0136] As a control, cells treated with AcDH@TA (in which the catalytic core sequence of the DNAzyme was mutated, resulting in loss of catalytic activity) and ultrasound irradiation showed no significant changes in mRNA levels. Western blot analysis of survivin protein levels further verified the controlled gene regulation ability of ADH@TA ( Fig. 22 b) Subsequently, the mitochondrial membrane potential was measured using the JC-1 probe. Fig. 22 As shown in c, compared with the control group, the green signal corresponding to the JC-1 monomer increased and the red signal corresponding to the JC-1 aggregate decreased in ADH@TA-treated cells after ultrasound irradiation, indicating that ROS induced mitochondrial membrane damage. The green and red signals of the ADH@TA+US group were 4.1 times higher than those of the unirradiated ADH@TA group, indicating that the mitochondrial membrane potential was significantly reduced due to ultrasound-mediated ROS generation ( Fig.23 In addition, the intracellular ATP level of cells treated with ADH@TA+US decreased by 63%, while the intracellular ATP content of cells not treated with ultrasound did not change significantly, further demonstrating the ROS-induced disruption of mitochondrial function ( Fig.24 ).

[0137] Then, the cell counting kit-8 (CCK-8) was used to evaluate the therapeutic effect of ADH@TAwas. The results showed that ADH@TA-treated cells showed obvious cytotoxicity under ultrasound irradiation, which was the result of the combined action of spatiotemporal controlled gene regulation and SDT ( Fig. 22 d). In contrast, the irradiated AcDH@TA group and the non-irradiated ADH@TA group showed only moderate cytotoxicity, indicating that the efficacy of single SDT or gene silencing in treating tumors is limited.

[0138] However, due to the effect of SDT alone, cells treated with nADH@TA+US showed similar cell viability to cells treated with AcDH@TA+US. Fig. 22 d) or AcDH@TA( Fig.25) treated with ADH@TA, no obvious cytotoxicity was observed, confirming the good biosafety of low-dose ultrasound and DNA scaffolds. In addition, normal cell line L-02 cells showed higher cell viability than MCF-7 cells after different concentrations of ADH@TA and ultrasound irradiation, indicating that the nanosystem has high tumor-specific cytotoxicity ( Fig. 22 e). Annexin V / propidium iodide (PI) co-staining was used to evaluate cell death by flow cytometry. The ADH@TA+US group had the highest level of apoptosis among all groups ( Fig. 22 f). It is noteworthy that the apoptosis level of L-02 cells treated with ADH@TA+US was significantly reduced compared with that of MCF-7 cells under the same conditions ( Fig.26 ), which is consistent with the CCK-8 results. In addition, live cell / dead cell staining ( Fig. 22 g) and coated plate method ( Fig. 27 ) confirmed the combined anticancer efficacy of ADH@TA.

[0139] This example demonstrates that ADH@TA is capable of achieving highly tumor cell-selective gene regulation and efficient SDT, providing promising therapeutic potential for spatiotemporally controlled tumor treatment.

[0140] Example 6

[0141] Based on Examples 1-5, this example describes the anti-tumor efficacy of ADH@TA in vivo. Pharmacokinetic studies have shown that ADH@TA has a longer circulation time (half-life of 30 minutes) compared to free En-Dz ( Fig.28 ), indicating improved plasma stability.

[0142] The spatiotemporal control of DNAzyme activation was investigated in MCF-7 tumor-bearing BALB / c mice. Twenty mice were randomly divided into four groups (n=5) and injected intratumorally with Cy5 / bhq2-labeled ADH@TA or nADH@TA (DNAzyme dose 50 nmol / kg, Hb dose 0.2 mg / kg-1), and the tumor site was irradiated with ultrasound. Cy5 fluorescence was monitored at different time intervals after injection. Fig.29 As shown in a and 29b, the fluorescence signal in the tumor area of ​​ADH@TA-treated mice was significantly enhanced, while the fluorescence signal in the tumor of nADH@TA-treated mice was less enhanced. 12 hours after injection, the fluorescence intensity in the tumor of the ADH@TA group was 2.2 times higher than that of the nADH@TA group, indicating that the overexpressed APE1 in the tumor activated the nanosystem ( Fig.29c). Furthermore, ultrasound treatment resulted in a 3.1-fold increase in intratumoral fluorescence in ADH@TA-injected mice compared to nADH@TA and ultrasound-treated mice and a 1.4-fold increase compared to the non-irradiated ADH@TA group, confirming the enhanced sonodynamic effect-induced APE1 activation. Furthermore, negligible differences in intratumoral fluorescence were observed between ultrasound-irradiated and non-irradiated nADH@TA groups, confirming that the fluorescence changes were indeed due to APE1 activation. Fluorescence images of ex vivo tumors further confirmed these results ( Fig.29 d). The fluorescence intensity of tumors in mice treated with ADH@TA+US was 2.0 and 1.3 times higher than that in the nADH@TA+US and ADH@TA groups, respectively ( Fig.29 e).

[0143] Next, the antitumor effect of ADH@TA was evaluated in the MCF-7 tumor-bearing mouse model. Fig.30 As shown in a), after tumor inoculation, mice were treated with different samples (DNAzyme dose of 100 nmol kg-1, Hb dose of 0.4 mg kg-1), and the indicated groups were subjected to ultrasound irradiation (1.0 MHz, 50% duty cycle, 1.5 W cm-2, 5 min) 2 h after injection. Tumor volume measurements showed no significant changes between the PBS, US, and AcDH@TA groups, indicating that these treatments did not affect tumor growth ( Fig.30 In contrast to the rapid tumor growth observed in the PBS group, ADH@TA treatment alone resulted in moderate tumor suppression due to its gene silencing ability ( Fig.31 a). Notably, both nADH@TA+US and AcDH@TA+US treatments significantly inhibited tumor growth, which was attributed to SDT alone ( Fig.31 b and 31c). The ADH@TA+US group showed the highest antitumor effect among all treatment groups ( Fig.30 b and 31d), indicating that the combination of ultrasound-controlled SDT and enzyme-activated gene therapy is more effective than either modality alone. These results confirm that the therapeutic effect of nanohybrid (ADH@TA) originates from SDT and activated gene silencing. In addition, the changes in body weight of mice in all treatment groups were negligible. ( Fig.31 e). Tumor weight measurements and photos of resected tumors further verified the superior therapeutic effect of ADH@TA+US ( Fig.31 f and 32a). Hematoxylin and eosin (H&E) staining of tumor sections showed that the ADH@TA+US treatment group had the highest level of cell death ( Fig.32b). Terminal deoxynucleotidyl transferase dUTP nickel end labeling (TUNEL) staining showed the strongest green fluorescence in ADH@TA+US-treated tumors, indicating the greatest degree of cell apoptosis ( Fig.32 c). Immunohistochemistry (IHC) analysis of tumor tissues showed that ADH@TA treatment induced a significant downregulation of survivin protein, while the addition of ultrasound in the ADH@TA+US group further reduced the expression of survivin protein ( Fig.33 ), verifying ultrasound-mediated gene regulation enhancement. Blood biochemical analysis ( Fig.34 ) and H&E staining of normal organ tissues ( Fig.35 ) showed that ADH@TA had minimal side effects. In addition, RT-qPCR analysis showed that there was no change in survivin mRNA expression in major organs ( Fig.36 ). Under the conditions applied, sonication had no adverse effects on mouse health, which emphasizes the safety of the sonication conditions used in this example, which is consistent with conditions used in other studies.

[0144] A PC-3 tumor-bearing mouse model was established to further study the anti-tumor effect of ADH@TA. Literature studies have reported that APE1 expression is higher in the cytoplasm of PC-3 cells compared with normal cells. Consistent with the prior art. PC-3 tumor-bearing mice were randomly divided into 7 groups (n=5) and subjected to different sample treatments and ultrasound irradiation. The results showed that the ADH@TA+US group had the highest anti-tumor effect, while the tumor inhibition levels of the ADH@TA, nADH@TA+US, and AcDH@TA+US groups were moderate ( Fig.37 and Fig.38 ), confirming that ultrasound-induced SDT combined with enzyme-activated gene therapy can enhance the therapeutic effect. These results suggest that the nanosystem has universal potential in different cancers.

[0145] The above description is only the preferred embodiment of the present invention, which does not limit the protection scope of the present invention. For those skilled in the art, the present invention can be modified and varied in various ways. Within the spirit and principle of the present invention, any change, modification, replacement, integration and parameter change of these embodiments by conventional substitution or capable of achieving the same function without departing from the principle and spirit of the present invention shall fall within the protection scope of the present invention.

Claims

1. A method for synthesizing DNA enzyme nanomaterials for treating tumors and maintaining fertility, characterized in that: The synthesis method comprises the following steps: Step S1: Synthesizing DNAzyme with APE1 enzyme site (AP-DZ); Step S2: mixing AP-DZ, hemoglobin, ferrous iron solution and deionized water in a synthesis tube; Step S3: vortexing the mixed solution obtained in step S1 with a vortexer and then placing it in a metal constant temperature heater for reaction; Step S4: vortexing the solution after the reaction again and then centrifuging it in a centrifuge; Step S5: After centrifugation, use a pipette to remove the supernatant and keep the precipitate in a collection tube; Step S6: adding deionized water to the collection tube and performing a third vortex treatment; Step S7: After the vortex treatment, FeCl3·6H2O is added to the tube and then vortexed for the fourth time; Step S8: After washing twice, the DNA nanomaterial is stored at 4°C until use.

2. The method for synthesizing a DNA enzyme nanomaterial for treating tumors and maintaining fertility according to claim 1, characterized in that: In the step S2, for every 100 μL of synthesis, the dosage is 15 μL AP-DZ (concentration is 100 μM), 10 μL hemoglobin (concentration is 1 mg / ml), 3 μL divalent iron solution (concentration is 4 mg / ml); and 72 μL deionized water.

3. The method for synthesizing a DNA enzyme nanomaterial for treating tumors and maintaining fertility according to claim 1, characterized in that: The vortex treatment time in step S3 is 10 seconds, the metal constant temperature heater used needs to be preheated to 95° in advance, and the reaction time is 2 hours.

4. The method for synthesizing a DNA enzyme nanomaterial for treating tumors and maintaining fertility according to claim 1, characterized in that: In step S4, the vortex treatment time is 5 seconds, the centrifugal condition is 13,000 revolutions, and the centrifugal treatment time is 10 minutes.

5. The method for synthesizing a DNA enzyme nanomaterial for treating tumors and maintaining fertility according to claim 1, characterized in that: In step S6, the amount of deionized water used is 100 μL, the vortex time is 10 s, and 5 μL of TA (with a concentration of 4 mg / ml) is added under the vortex condition.

6. The method for synthesizing a DNA enzyme nanomaterial for treating tumors and maintaining fertility according to claim 1, characterized in that: In step S7, the concentration of FeCl3·6H2O is 1 mg / mL, the dosage is 5 μL, and the vortex time is 30 s.

7. The method for synthesizing a DNA enzyme nanomaterial for treating tumors and maintaining fertility according to claim 1, characterized in that: The washing in step S8 comprises the following steps: Step S81: centrifuge the solution and then add deionized water; Step S82: Perform vortex processing.

8. The method for synthesizing a DNA enzyme nanomaterial for treating tumors and maintaining fertility according to claim 7, characterized in that: The centrifugal condition in step S81 is 13,000 rpm, the centrifugal treatment time is 3 min, the amount of deionized water is 100 μL, and the vortex time in step S82 is 10 s.

9. The DNA nanomaterial obtained by the synthesis method according to any one of claims 1 to 8, characterized in that: The hydrated size of the DNA nanomaterial is 143nm-163nm.

10. Use of the DNA nanomaterial according to claim 9 in the preparation of drugs for tumor treatment.

Images